Нажмите "Enter", чтобы перейти к контенту

Пресенилин 1 подавляет функцию гомодимеров C-Jun посредством взаимодействия с Qm / Jif-1

Presenilin 1 Suppresses the Function of C-Jun Homodimers via Interaction with Qm/Jif-1
Источник: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2164975/

Пресенилин 1 (PS1) является причинным геном аутосомно-доминантной семейной болезни Альцгеймера (AD), отображаемой на хромосому 14. Здесь мы показываем, что QM / Jun-взаимодействующий фактор (Jif) -1, отрицательный регулятор c-Jun, является кандидата для опосредования функции PS1 в ячейке. Мы проводили скрининг на белки, которые связываются с PS1 из библиотеки кДНК эмбриональной мозговой оболочки человека с использованием двухгибридного метода и изолированного одного клона, кодирующего ген QM / Jif-1. Связывание QM / Jif-1 с полноразмерным PS1 подтверждали in vitro методом вытягивания и in vivo с помощью иммунопреципитационных анализов с образцами человека, включая мозг AD. Иммуноэлектромикроскопический анализ показал, что QM / Jif-1 и PS1 колокализуются в эндоплазматическом ретикулуме и ядерная матрица в нейронах мозга человека. Анализ Хлорамфеникол-ацетилтрансферазы в клетках F9 показал, что PS1 подавляет трансактивацию c-Jun / c-Jun, но не гетеродимерами c-Jun / c-Fos, что согласуется с сообщенной функцией QM / Jif-1. Было показано, что, контролируя флуоресцентный рекомбинантный белок и анализы сдвига подвижности геля, показано, что PS1 ускоряет транслокацию QM от цитоплазмы к ядру и тем самым подавляет связывание гомодимера c-Jun с 12-O-тетрадеканоилфорбор-13-ацетатом (TPA ) — ответный элемент (TRE). PS1 подавлял c-jun-ассоциированный апоптоз ретиноевой кислотой в клетках эмбриональной карциномы F9, тогда как это подавление апоптоза ослабляется мутацией в PS1. В совокупности новая функция PS1 через QM / Jif-1 влияет на c-jun-опосредованную транскрипцию и апоптоз.

Было показано, что мутации в гене presenilin 1 (PS1) 1 влияют на внутриклеточный метаболизм β-амилоида (Aβ) и увеличивают отношение пептидов Aβ1-42, которое, как представляется, является более фибриллогенным, чем Aβ1-40 в плазме пациента, а также как в мозгах трансгенных мышей (обзоры см. Hardy 1997, Selkoe 1997, Masters and Beyreuther, 1998). Кроме того, амилоидные отложения фактически образуются ранее у двукратно трансгенных мышей, коэкспрессирующих мутант PS1 и белок-предшественник мутантного амилоида (APP), чем у мышей, сопоставленных с возрастом (Borchelt et al., 1997; Holcomb et al., 1997), в соответствии с болезнью Альцгеймера человека (AD ) патологии.

В дополнение к полученной функции мутантных генов PS1 физиологически незаменим для эмбрионального морфогенеза. Мыши PS1 — / — проявляли аномальное паттернирование осевого скелета и спинномозговых ганглиев и развивали церебральную кавитацию (Shen et al., 1997; Wong et al., 1997). PS1 представляет собой многокомпонентный трансмембранный белок, гомологичный SEL-12, белку Caenorhabditis elegans, который опосредует передачу сигналов от рецепторов поверхности клеток Notch / Lin-12 (Levitan and Greenwald 1995) и локализована в эндоплазматическом ретикулуме (Kovacs et al., 1996) ), Аппарат Гольджи (Kovacs et al., 1996), ядерная мембрана (Li et al., 1997) и плазматическая мембрана (Dewji and Singer 1997). PS1 протеолитически расщепляют на два фрагмента (Thinakaran et al., 1996), затем предположительно деградируют по протеасоме (Kim et al., 1997). Во время развития мутантные молекулы PS1, по-видимому, функционируют нормально, потому что до наступления болезни ни морфологические, ни функциональные аномалии не наблюдаются у пациентов, связанных с мутациями PS1.

Функциональный анализ PS1 по-прежнему остается спорным. Было показано, что PS1 участвует непосредственно в расщеплении APP (Wolfe et al., 1999). Между тем, ряд молекул, включая калсенилин (Buxbaum et al., 1998), β-catenin (Zhang, Z., et al., 1998), филамин (Zhang, W., et al., 1998) и tau ( Takashima et al., 1998), как сообщается, связываются с PS1, некоторые из которых предположительно влияют на сигнализацию смерти клеток. Кроме того, хотя считается, что образование амилоидной бляшки является центральным событием в патогенезе AD, сообщалось, что смерть нейронов, усиленная мутантным трансгеном PS1, предшествует внеклеточному осаждению амилоида у пожилых трансгенных мышей (Chui et al., 1999).

Поэтому необходимо дополнительно охарактеризовать молекулы, взаимодействующие с PS1, чтобы понять механизм, лежащий в основе этого сложного и широкого спектра клеточных функций для молекулы PS1. В этом исследовании мы обнаружили, что QM / Jun-взаимодействующий фактор (Jif) -1 (Dowdy et al., 1991; Monteclaro and Vogt, 1993), транскрипционный фактор, который взаимодействует с c-jun и ингибирует его транскрипционную активацию, длина PS1. Мы также обнаружили, что QM / Jif-1 и PS1 колокализуются в нейронах головного мозга человека, включая те, которые затронуты PS-1-ассоциированным семейным AD, и что полноразмерный PS1 опосредует эффекты QM / Jif-1 на c- Jun-опосредованная функция. Эти результаты показывают, что QM / Jif-1 является другой молекулой, опосредующей функцию PS1.

кДНК, кодирующая полноразмерную PS1, амплифицировали из мРНК гиппокампа человека (Clontech) с помощью ПЦР с обратной транскриптазой с использованием праймеров F, 5′-AAAGAATTCATGACAGAGTTACCTGCACCGT-3 ‘(данные последовательности, доступные из EMBL / GenBank / DDBJ под номером присоединения L42110, нуклеотиды [nt] 249-270) и R, 5’-AAACTCGAGCCATGGGATT-CTAACCGC-3 ‘(nt 1677-1660) и субклонировали между сайтами EcoRI и XhoI плазмиды pEG202-LexA. После подтверждения того, что котрансфекция плазмид pEGPS1 и pJG4-5 не проявляет неспецифического связывания, скрининг ~ 5 × 105 клонов из библиотеки ДНК криогенной эмбриональной мозговой оболочки (предоставил доктор Роджер Брент, Гарвардская медицинская школа, Бостон, Массачусетс). Второй скрининг проводили на обеих пластинах SG-HWUX-gal и SG-HWUL. Положительные клоны субклонировали в pBluescript KS + (Stratagene) и секвенировали с использованием автоматического секвенатора (Applied Biosystems, Inc.).

100 мг каждой ткани коры головного мозга суспендировали в 1 мл буфера для лизиса (10 мМ Трис-HCl, pH 7,8, 1% NP-40, 150 мМ NaCl, 1 мМ ЭДТА, 1 мМ PMSF, 10 мкг / мл лейпептина, 10 мкг / мл апротинина), инкубировали при 4 ° С в течение 10 мин и прерывали путем повторной аспирации через иглу 21 калибра. Клеточный мусор удаляли центрифугированием при 10000 г в течение 10 мин. Аликвоты клеточных лизатов инкубировали с различными антителами в течение 1 часа при 4 ° С, затем осаждали белком G-агарозой (онкогеновая наука). Анти-NH2-концевое антитело (αN) и антитело против петли (αL) использовали, наконец, при разведении 1: 200. Поликлональное антитело против QM (C-17) (Santa Cruz Biotechnology) использовалось при разведении 1: 1000. αN антитело специфично для аминокислот 21-80 человека PS1 (Lah et al., 1997). αL — поликлональная антисыворотка, которая реагирует с эпитопами в области гидрофильной петли (аминокислоты 263-407) человека и мыши PS1 (Thinakaran et al., 1996). Гранулы интенсивно промывали буфером для анализа радиоиммуно-белка, затем разделяли 12% -ным SDS-PAGE, блоттировали на мембране Hybond-ECL (Amersham Pharmacia Biotech), инкубировали с анти-QM-поликлональным антителом (Santa Cruz Biotechnology), затем обнаруживали с системой анализа ECL в Вестерн-блоттинге (Amersham Pharmacia Biotech).

Экспрессирующие векторы различных форм PS1, а также слитых белков глутатион-S-трансферазы (GST) -QM были сконструированы следующим образом. Полноразмерную кДНК PS1 амплифицировали с помощью праймеров F182 (5′-AAACTCGAGTCTATACAGTTGCTCCAATGAC, nt 232-254) и R182 (5′-AAATCTAGACCATGGGATTCTAACCGCA, nt 1677-1660) из мРНК человека-гиппокампа и субклонировали между сайтами XhoI и XbaI экспрессии pCIneo млекопитающих вектор (Promega). Структура и последовательность были подтверждены секвенированием ДНК и анализом сайта рестрикции. Для pCImPS1, несущего мутацию Met → Leu в кодоне 146, связанную с ранним семейным AD, сайт-направленный мутагенез проводили с помощью набора Mutagenesis на основе трансформатора (Clontech) в соответствии с коммерческим протоколом.

Для векторов, экспрессирующих слитые белки GST в Escherichia coli, кДНК QM субклонировали между BamHI и EcoRI pGEX3X (Amersham Pharmacia Biotech) с использованием ПЦР с синтетическими праймерами для корректировки рамки считывания. Белки Fusion, связанные с удаленным QM (см. Фиг.2с), были сконструированы аналогично с использованием ПЦР. Протеин PS1 синтезировали и меченым радиоактивным изотопом с помощью [35S] метионина (NEN) путем транскрипции in vitro и трансляции с помощью системы лизата ретикулоцитов TNT T7 / T3 (Promega). Взаимодействие между белками PS1 и GST-QM проводилось в соответствии с сообщенным методом (Chen et al., 1997).

5 мм3 ткани получали из коры головного мозга 37-летней женщины через 24 часа после ее смерти с потерей крови и фиксировали 4% параформальдегидом. Секции для электронной микроскопической иммуноцитохимии постфиксации в 1% -ном тетроксиде осмия, окрашивали 2% -ным уранилацетатом, дегидратировали с использованием градуированного спирта и пропиленоксида и внедряли в смолу Eponate 12. 40 мкм были окрашены mAb крысы против PS121-80 (Lah et al., 1997) при разведении 1: 100-500 и анти-QM-поликлональном кроличьем антителе (Santa Cruz Biotechnology) при разведении 1: 1000 одновременно. Для локализации первичных антител использовали 10 нм золотосопряженные антитела против крысы Ig и 5 нм золотые конъюгированные антитела против кроликов. Контрольные эксперименты проводились без первичных антител. Для анализов с пораженными мозгами секции фиксированной формальдегидом и парафиновой коры депарафинизировали и использовали для инкубации с антителами. Для иммуногистохимии головного мозга мыши участки 40 мкм окрашивали анти-QM-поликлональным антителом (Santa Cruz Biotechnology), затем визуализировали с помощью 0,05% 3,3′-DAB тетрагидрохлорида и 0,01% H2O2 в 50 мМ Tris, pH 7,6, как описано ранее (Lah et al., 1997).

Трансфекцию проводили, как описано ранее (Okamoto et al., 1990; Okazawa et al., 1991). Использовали 10 мкг репортерной плазмиды и 10-20 мкг эффекторных плазмид. 10-20 мкг pBluescript KS + (Stratagene) добавляли для уравновешивания общего количества плазмид для трансфекции. Конструирование эффекторных и репортерных плазмид сообщалось ранее (Angel et al., 1987). Эффективность транскрипции была проверена pCH110 (Amersham Pharmacia Biotech), эукариотическим вектором, содержащим ранний промотор вируса обезьян и структурный ген E. coli-β-galactosidase (LacZ). Каждый эксперимент повторяли по меньшей мере четыре раза, а вариабельность эффективности трансфекции составляла <20%.

Экспрессирующие векторы слитых белков флуоресцентного белка-QM были сконструированы путем введения различных форм кДНК QM в pEGFPN1 (Clontech). Полноразмерную кДНК QM амплифицировали с помощью ОТ-ПЦР из мРНК миндалин человека с праймерами QMF (AACGAATTCCCATGGGCCGCCGCCCCGCCCGTT) и QMR (AATGGATCCGTGAGTGCAGGGCCCGCCA) и субклонировали между сайтами EcoRI и BamHI pEGFPN1.

Эффект PS1 на активность c-Jun NH2-терминальной киназы (JNK) анализировали путем трансфекции 6 мкг T7-помеченного JNK1 10 мкг pCIPS1 или pBS-KS в качестве контроля в клетках F9. Белок JNK1 выделяли иммунопреципитацией мышиным mAb против T7-эпитопа (Invitrogen). После того, как смолу Sepharose промывали пять раз лизисным буфером, содержащим 20 мМ Трис-HCl, pH 8,0, 2 мМ ЭДТА, 50 мМ -глицерофосфата, 0,1 мМ Na3VO4, 1% Triton X-100, 0,5% дезоксихолата, 0,1% SDS, 10% глицерина, 1 мМ PMSF, 10 мкг / мл лейпептина и 10 мкг / мл апротинина, белки были извлечены буфером для образцов SDS и проанализированы с помощью Вестерн-блоттинга с антителами против T7-Tag.

Для создания стабильных клеток, экспрессирующих антисмысловый c-jun, pCIneo (Promega), содержащий полноразмерную кДНК c-jun в обратной ориентации, конструировали и трансфицировали в клетки F9. Они были выбраны в α-среде (Sigma Chemical Co.) с 300 мкг / мл G418 в течение 2 недель. Стабильные клетки, экспрессирующие нормальный или мутантный PS1, аналогичным образом получали путем трансфекции pCIPS1 и pCImPS1. 1 × 105 F9 или стабильные клетки культивировали в α-среде: 10% FBS с 1 мкМ полностью транс-ретиноевой кислотой (Sigma Chemical Co.) в течение 48 часов. Все клетки собирали и их геномную ДНК экстрагировали и разделяли на 3% нузив-агарозном геле (FMC BioProducts).

Для анализа влияния делеционных конструкций QM на апоптоз клетки 1 × 105 F9PS1 транзиторно трансфецировали 20 мкг каждого экспрессионного вектора, описанного ниже, с использованием SuperFect (Qiagen) в 10-сантиметровой чашке для культивирования ткани. Через 24 ч после трансфекции клетки обрабатывали 1 мкМ полностью транс-ретиноевой кислотой (Sigma) в течение дополнительных 48 часов. Все клетки были собраны, и процент гибели клеток был оценен с помощью исключения трипанового синего красителя.

Фрагменты кДНК QM / Jif-1 амплифицировали с помощью RT-PCR из мРНК гиппокампа человека (Stratagene). Использовали праймеры: F1 (AAACTCGAGCCTGGTGTCGCCATG; данные о последовательности, доступные из EMBL / GenBank / DDBJ, по номеру № M64241; nt 30-44), R1 (AAAGAATTCAATTCGGGCAGCCTCCA, nt 251-235), F2 (AAAGAATTCCGCATCAACAAGATGT, nt 333-348), R2 (AAATCTAGAAGCCCTCATGAGTGCA, nt 691-676) и R3 (AAATCTAGAACATC-TTGTTGATGCG, nt 348-333). Различные порции кДНК QM амплифицировали с помощью F1 и R3 для Δ1 или с F1 и R1 для Δ2, расщепляли XhoI и XbaI или XhoI и EcoRI и субклонировали в соответствующие сайты вектора pCIneo (Promega) соответственно. Для Δ3 два фрагмента кДНК, амплифицированных с помощью F1 / R1 или F2 / R2, расщепляли XhoI / EcoRI или EcoRI / XbaI, соответственно, затем субклонировали между сайтами XhoI и XbaI pCIneo.

Мы исследовали функцию PS1, выделив молекулы, которые взаимодействуют с PS1. Мы проверили человеческую эмбриональную библиотеку мозга, используя двухгибридную систему дрожжей. После двухсекундных экранов с использованием дефицитных лейцинов пластин и пластин X-gal мы, наконец, судили шесть клонов, демонстрируя сильное взаимодействие, чтобы быть положительным. В нашем опыте с двухгибридной системой это число положительных клонов было небольшим по сравнению с другими приманками. Среди них мы нашли клон, идентичный QM / Jif-1. Эта молекула была первоначально выделена как предполагаемый ген супрессора опухолей Вильмса (Dowdy et al., 1991), затем описывается как фактор транскрипции, который взаимодействует с c-Jun и ингибирует его транскрипционную активацию (Monteclaro and Vogt 1993). Недавно было показано, что он идентичен рибосомальному белку L10 (Chan et al., 1996), поэтому было предложено быть рибосомным белком, обладающим множественными экстрарибосомальными функциями (Wool 1996).

Этот клон (PS309-4) не имел NH2-концевой части из 43 аминокислот и кодировал вариант Ser202Asn (фиг.1а). QM / Jif-1 не обладает лейциновой застежкой-молнией, но может содержать цинковый паз C2H2 (рис.1а). Ретрансформация клеток дрожжей EGY48 плазмидами pEGPS1 и pJGPS309-4 показала высокую активность β-галактозидазы в независимых дрожжевых колониях (рис.1, б).

Чтобы определить связывающий домен молекулы PS1 для QM / Jif-1, мы провели делеционный анализ PS1 с помощью двухгибридного анализа. кДНК, соответствующие различным областям молекулы PS1, субклонировали в вектор pEG и котрансфецировали pJG309-4 в дрожжевые клетки. Интересно, что любая частичная последовательность PS1 не сильно связывалась с QM / Jif-1. Вместо этого полноразмерный PS1 показал сильное взаимодействие с QM / Jif-1 (рис.1, с). Этот результат хорошо согласуется с результатами анализа вестерн-блоттинга с использованием человеческих мозгов, описанных ниже.

Чтобы проверить взаимодействие между QM и PS1 in vivo, мы провели иммунопреципитационный анализ с мозгом человека, в том числе с семейными и несемейными пациентами AD. Приблизительно 50 кД полноразмерных PS1 были обнаружены в осадках αN и αL от нормального, контроля болезни (боковой амиотрофический склероз), неамильного AD и PS1-связанных головного мозга AD (фиг.2a), тогда как мы не могли наблюдать четкие полос, соответствующих расщепленным фрагментам PS1. Этот результат в мозге человека, а также результаты двухгибридного делеционного анализа (рис.1 с) показывают, что для тесного взаимодействия с QM / Jif-1 необходимы несколько областей в полноразмерной структуре PS1. Эта идея может иметь некоторое отношение к недавнему выводу о том, что NH2- и COOH-терминальные фрагменты PS1 восстанавливают и образуют стабильный комплекс (Capell et al., 1998; Thinakaran et al., 1998).

Интересно отметить, что полоса была видимой, но очень слабой в дорожках 6 и 7, загруженных образцами из пациентов с PS1-связанной AD (фиг.2а). По сравнению с полосами PS1 в Вестерн-блот-анализе с использованием тех же проб мозга (рис.2, б), это связано не с различием количества белка PS1 среди образцов мозга. Вместо этого это может быть связано с различием остаточных нейронов, где QM и PS1 могут взаимодействовать между образцами или из-за разницы в сродстве QM к нормальному и мутантного PS1. В обратном анализе иммунопреципитации мы обнаружили QM в осадках на αN, а также на αL (фиг.2c), подтвердив взаимодействие между PS1 и QM / Jif1 in vivo. Мы провели иммунопреципитацию неиммунными сыворотками и несколькими неспецифическими антисыворотками, использующими одни и те же образцы головного мозга, но не обнаружили QM или PS1 в осадках (данные не показаны).

Чтобы наблюдать взаимодействие между QM и PS1 в мозге морфологически, мы провели иммуногистохимический анализ. Поскольку экспрессия QM ранее не сообщалась, мы подтвердили, что сообщение QM широко выражено в мозге по нозерн-блотному анализу (фиг.3). На светлом микроскопическом уровне анти-QM-поликлональное антитело окрашивало цитоплазму нейронов в коре головного мозга мыши (фиг.4а). Чтобы далее характеризовать субклеточную локализацию белка QM, мы наблюдали образец мышиного мозга с помощью электронной микроскопии и обнаружили, что области, очень близкие к структурам трубчатой ​​мембраны, которые обладают особенностями гладкого эндоплазматического ретикулума, были преимущественно окрашены (рис.4b и рис. C). Эта субклеточная локализация QM была точно такой же, как и на PS1, зарегистрированной до настоящего времени (Lah et al., 1997).

Затем мы спросили, являются ли QM и PS1 белки колокализуемыми в нейронах мозга человека. Иммуногистохимический анализ проводили с использованием вторичных антител, конъюгированных с различными размерами частиц золота, и с мозгом 37-летней женщины, которая умерла из-за потери крови. Мы заметили, что 5-нм зерно PS1 и 10-нм зерно QM расположены очень близко друг к другу на краю гладких мембранных структур в цитоплазме кортикальных нейронов (рис. 4d). Большинство этих структур представляли собой гладкий эндоплазматический ретикулум, тогда как некоторые из них обладают особенностями аппарата Гольджи (данные не показаны). Меньше зерен наблюдалось также в ядре (рис. 4, е). Хотя иммунореактивность была дополнительно уменьшена в фиксированных формальдегидом и вложенных в парафин тканях непиминиальных или PS1-связанных мозгов AD, мы неоднократно обнаружили, что эти два зерна были колокализованы при мембранной структуре в цитоплазме (фиг.4, f-i).

Затем мы исследовали биологическую значимость взаимодействия между QM / Jif-1 и PS1. Jif-1 выделяли в виде связывания белка с c-Jun из библиотеки кДНК, экранированной биотинилированным c-Jun (Monteclaro and Vogt 1993). Работа Монтекларо и Фогта по функции Jif-1 показала, что слитые белки GST-QM / Jif-1 не связывают с 12-O-тетрадеканоилфорбор-13-ацетатом (TPA) -рецептивным элементом (TRE) в сдвиге подвижности геля анализы, но препятствуют связыванию гомодимера c-Jun с TRE (Monteclaro and Vogt 1993). Более того, гетеродимер c-Jun / c-Fos может переопределить это ингибирование Jif-1. Через это ингибирование связывания Jif-1 ингибирует трансактивацию гена c-Jun. QM / Jif-1 чрезвычайно сохраняется во время эволюции от дрожжей к млекопитающему (Farmer et al., 1994), предполагая, что этот фактор необходим для основных клеточных функций. Из этих наблюдений мы предположили, что выражение PS1 может влиять на функцию c-Jun посредством взаимодействия с QM.

Чтобы проверить эту гипотезу, мы провели анализ котрансфекции хлорамфениколацетилтрансферазы (CAT) с векторами экспрессии c-jun или c-fos в качестве первой эффекторной плазмиды, нормальных или мутантных экспрессирующих векторов PS1 в качестве второй эффекторной плазмиды (фиг.5а) и человека коллагеназы (-517 / -42) TKCAT, содержащей TRE в качестве репортерной плазмиды. Мы использовали клетки эмбриональной карциномы F9 в анализах, потому что они практически не обладают активностью активированного белка (AP) -1 (Angel et al., 1988), но достаточно экспрессируют белок QM (данные не показаны). Было сложно предсказать, какие результаты будут возникать при добавлении экспрессирующего вектора PS1, поскольку связывание может содержать QM в эндоплазматическом ретикулуме, где PS1 наиболее распространен (Kovacs et al., 1996), или он может помочь транспортировать QM к ядру, где иммунореактивность PS1 также обнаружена (Li et al., 1997). Возможно, что котрансфекция может не влиять на активность CAT из-за нефункционального связывания между двумя молекулами.

Среди этих возможностей мы получили самый простой и ясный результат. c-jun или c-jun / c-fos трансактивировали экспрессию CAT-гена (фиг.5b), как ожидалось. Трансактивация гомодимером c-Jun была подавлена ​​нормальным PS1, а также мутантом PS1, тогда как трансактивация гетеродимером c-Jun / c-Fos не влияла на добавление векторов экспрессии PS1 (фиг.5, а и b). Этот супрессивный эффект считался специфичным, поскольку избыточная экспрессия многопроходного трансмембранного белка, транспортера 1 глютута (GLUT1), который, как известно, перемещается из эндоплазматического ретикулума в аппарат Гольджи, не подавляет активность CAT (фиг.5b). Слабая трансактивация c-Fos, которая могла быть вызвана слабой эндогенной активностью c-Jun, не зависела ни от нормального, ни от мутантного PS1. Эти наблюдения очень хорошо соответствовали взаимодействующему поведению QM с молекулами AP-1, о которых сообщалось ранее (Monteclaro and Vogt 1993). Подавление мутанта PS1 казалось более слабым, чем нормальный PS1 (фиг.5b).

Чтобы проверить, опосредуется ли эффект PS1 TRE, мы изменили репортерную плазмиду на те, которые содержали только TRE (фиг.5а). Как и ожидалось, PS1 воспроизводил подавление трансактивации c-Jun в коллагеназе 1 × TRE CAT и металлотионеин IIa 1 × TRE CAT (фиг.5с). Эти результаты подтвердили нашу гипотезу о том, что PS1 влияет на регуляцию гена через c-jun через TRE. Интересно, что, используя 1 × TRE CAT плазмиды, мы более четко заметили, что подавление индуцированной c-Jun трансактивации было более слабым в мутантном PS1, чем в нормальном PS1 (фиг.5c).

Во-вторых, мы тестировали, влияет ли PS1 на регуляцию транскрипции другими членами семейства c-jun, образующими комплекс AP-1. Экспрессия junB и junD улучшала транскрипцию из коллагеназы 1 × TRE CAT репортерной плазмиды (фиг.5d). Трансактивация junD была явно подавлена ​​экспрессией нормального и мутантного PS1, тогда как трансактивация junB не была затронута (рис.5d). В этом случае подавление junD-опосредованной трансактивации нормальным PS1 не было заметно отличным от такового мутантом PS1 (фиг.5d), в отличие от наших наблюдений с трансактивацией c-jun-опосредованной (фиг.5b и рис. C) , В описанных выше тестах CAT мы подтвердили, что экспрессия белка c-Jun не зависит от котрансфекции PS1 и что экспрессия нормальных и мутантных PS1-белков является эквивалентной (фиг.5 e). Мы суммировали результаты всех анализов CAT, описанных выше, с гистограммой, показывающей средние транзакции сгиба (рис. 5f).

Из данных, описанных выше, мы предположили, что PS1 каким-то образом способствует транслокации белка QM из цитоплазмы в ядро, препятствует связыванию гомодимера c-Jun с TRE и тем самым подавляет трансактивацию c-jun. Мы использовали флуоресцентный белок (регенерацию зеленой флуоресцентной белки [EGFP]), чтобы наблюдать, как внутриклеточный перенос белка QM модулируется PS1 и наблюдается, что транслокация слитого белка в ядро ​​фактически ускоряется путем котрансфекции PS1 (фиг. .6 а). С другой стороны, коэкспрессия мутанта (Met146Leu) PS1 не вызывала заметного продвижения ядерной транслокации.

Интересно отметить, что эффекты PS1 на транскрипцию и на перенос белка были замечательными, хотя уровень экспрессии PS1 был не таким высоким, как уровень PS1 (фиг.5 e), или как уровень эндогенной экспрессии QM / Jif- 1 (данные не показаны). Рассматриваемый с помощью функции PS1, способствующей ядерному переносу QM, трансфецированная молекула PS1 может быть эффективно рециркулирована в клетках, что приводит к замечательному влиянию на функцию c-Jun через белок QM, транслоцированный и накапливаемый в ядре.

Затем мы провели анализ сдвига подвижности геля с использованием ядерных экстрактов, полученных из клеток F9, экспрессирующих транскрипционные факторы AP-1 с PS1 или без него. Мы обнаружили, что PS1 подавляет связывание гомодимера c-Jun с TRE и очень слабо подавляет гомодимер JunD, но не относится к гетеродимеру c-Jun / c-Fos или гомодимером JunB (фиг.6b). Кроме того, обычный PS1 подавлял связывание с TRE более эффективно, чем мутантный PS1 (фиг.6b). Эти результаты согласуются с результатами анализа CAT (рис.5, a-f) и подтверждают идею о том, что ядерная транслокация QM / Jif-1 стимулируется нормальным PS1, тем самым препятствуя связыванию гомодимера c-Jun с TRE.

Мы проверили еще одну возможность того, что PS1 ингибирует JNK и тем самым подавляет трансактивацию c-jun (обзор см. В Minden and Karin 1997). Экспрессирующий вектор T7-Tag-JNK1 подвергали трансплантации PS1, иммунопреципитировали, и активность JNK тестировали с помощью c-Jun, полученного в бактериях в качестве субстрата. В этом анализе мы не наблюдали изменения активности JNK (данные не показаны). Это открытие указывает, что PS1 подавляет функцию c-jun преимущественно путем переноса QM / Jif-1, но не через фосфорилирование c-Jun JNK, хотя необходимы дальнейшие анализы, чтобы определить, частично ли JNK участвует в подавлении по PS1.

c-jun был охарактеризован как протоонкоген, способствующий клеточной пролиферации, тогда как последние данные показывают, что c-jun участвует в некоторых типах апоптоза. Экспрессия c-jun-доминантных негативных мутантов защищает симпатические нейроны от гибели клеток, вызванной изъятием NGF, а сверхэкспрессия самого c-jun вызывает апоптоз в симпатических нейронах (Ham et al., 1995). Трансфекция рекомбинантной гибридной белковой химеры c-Jun и гормона-связывающего домена рецептора эстрогена индуцирует апоптоз в клетках NIH 3T3 с β-эстрадиолом, добавленным в культуральную среду (Bossy-Wetzel et al., 1997). Кроме того, индукция c-fos отмечена как раннее событие запрограммированной гибели клеток (Smeyne et al., 1993), а c-fos участвует в индуцированной светом дегенерации сетчатки (Hafezi et al., 1997). Интересно, что временной ход экспрессии белка в апоптозе нейронов, вызванный изъятием трофического фактора, был иным. c-jun сначала регулируется, а c-fos следует за ним; выражение junD не изменяется (Ham et al., 1995). Эти данные показали, что AP-1 играет важную роль в гибели клеток, хотя каждый член комплекса AP-1 может играть другую роль.

Учитывая эти предыдущие данные, мы исследовали, влияет ли PS1 на апоптоз, опосредованный c-jun. Мы использовали клетки F9 для этого анализа, поскольку лечение ретиноевой кислотой индуцирует апоптоз (Atencia et al., 1994) и повышение активности экспрессии c-jun (Yamaguchi-Iwai et al., 1990). Подавление c-jun антисмысловой экспрессией транскрипта приводило к апоптозу, вызванному ретиноевой кислотой (фиг.7а), что указывает на то, что c-jun опосредует этот тип гибели клеток. Таким образом, мы создали стабильные трансформанты, выражающие> в 10 раз больше белка PS1, чем родительские клетки F9 (рис. 7b), и наблюдали влияние PS1 на апоптоз, вызванный ретиноевой кислотой. Апоптотические клетки были обнаружены с помощью анализа концевых меченых концевых трансфераз (рис.7 с) и анализа исключения на основе красителя трипана (рис.7d), после чего анализировали статистически (фиг.7d). Обычный PS1 значительно подавлял процент апоптотических клеток, тогда как мутант PS1 подавлял его довольно слабо. Эти результаты последовательно наблюдались в стабильных клеточных линиях с высоким выражением (n = 3). Кроме того, мы подтвердили эти результаты фрагментацией ДНК в клеточных ядрах (рис. 7е). Слабый антиапоптотический эффект мутантного PS1 хорошо соответствует его слабому подавляющему эффекту на индуцированную c-jun трансактивацией в анализах CAT (рис. 5b, рис. C и рис. F).

В конце этого исследования мы исследовали роль предполагаемого домена пальцев цинка (zif) QM / Jif-1 во взаимодействии с PS1, в регуляции транскрипции и при апоптозе. Во-первых, мы сделали различные конструкции для удаления QM / Jif-1 (рис.8a) и протестировали их связывание с PS1 с помощью анализа спуска. Нормальный или мутантный (Met146Leu) PS1, меченный радиоактивным изотопом [35S] метионин транскрипцией / трансляцией in vitro, взаимодействовал с слитыми белками GST QM in vitro и снесен глутатион-сефарозой 4B. Полноразмерная QM взаимодействовала с обычным PS1, тогда как конструкции удаления, не имеющие zif, не связывались с PS1 (рис.8b), что указывает на то, что этот регион необходим для взаимодействия. Мутант PS1 также связывается с слитыми белками GST-QM. Однако соотношение между входным и выведенным количествами было ниже в мутанте PS1 (60%), чем в нормальном PS1 (95%).

Затем мы проверили, влияет ли удаление zif на регуляцию транскрипции. Поскольку QM / Jif-1 изобильно экспрессируется во всех клеточных линиях, мы разработали доминантный отрицательный эксперимент. Мы выбрали клетки F9PS1, в которых трансфецированные QM транслоцируются в ядро. Эукариотические экспрессирующие векторы, содержащие делеционные конструкции QM, были котрансфицированы c-jun и QM экспрессионными векторами в клетки F9PS1. Трансфекция полноразмерной QM подавляемой трансактивации c-jun-индуцированной (рис.8 с, полосы 2 и 3). Δ1 противодействует этому подавлению QM. Активность CAT при котрансфекции Δ1 (рис.8 с, дорожки 4 и 5) была выше, чем у индуцированной c-jun трансактивацией (рис.8 с, полоса 2), что указывает на то, что антагонистический антагонизм Δ1 в дополнение к трансфицированному QM , Этот доминирующий отрицательный эффект не наблюдался в других конструкциях без zif, которые не могут взаимодействовать с PS1 (рис.8 с, полосы 6-9). Следовательно, Δ1, вероятно, ингибирует связывание QM с PS1 конкурентным способом и подавляет функцию QM, поскольку Δ1, переносимый в ядро, не оказывает подавляющего эффекта на c-Jun. Последовательно, транслокация в ядро ​​слитого белка GFP наблюдалась в Δ1, но не в других делеционных конструкциях, лишенных zif (рис.8d). Без трансфекции вектора экспрессии c-jun сама трансактивация по Δ1 не наблюдалась в клетках F9PS1, которые не экспрессируют c-jun (данные не показаны).

Наконец, мы проверили роль zif в c-jun-ассоциированном апоптозе. Клетки F9PS1 трансфицировали векторами, экспрессирующими удаленную QM / Jif-1. Трансфекция Δ1 увеличивала процент гибели клеток, вызванной обработкой ретиноевой кислотой, тогда как другие конструкции не влияли на апоптоз (рисунок 8 e). Этот результат снова показал доминирующий отрицательный эффект Δ1 на апоптоз. В целом было сделано заключение, что zif имеет важное значение для взаимодействия QM с PS1 и эффектов QM на c-Jun, полученных из взаимодействия.

Это исследование показало, что PS1 связывается с отрицательным кофактором c-Jun, QM / Jif-1 и что PS1 регулирует функции c-jun при транскрипции и гибели клеток. Продвижение ядерной транслокации QM / Jif-1 с помощью PS1, по-видимому, является основным механизмом, который связывает первый и второй выводы. Конкретным моментом в наших результатах является то, что QM / Jif-1 связывается с полноразмерным PS1. Сообщалось, что большинство молекул PS1 расщепляются на два фрагмента, которые повторно связываются с образованием гетеродимера (Thinakaran et al., 1996, Thinakaran et al., 1998). Однако вестерн-блот-анализ в этом исследовании (рис.2, а и б) и в предыдущих докладах (Lah et al., 1997) показывает, что полноразмерный PS1 также существует в мозге in vivo, хотя функция этой формы имеет неясно. Наши результаты показывают, что полноразмерная форма также обладает функциональной ролью, связанной с жизнеспособностью клеток.

До сих пор более пяти молекул, включая APP (Waragai et al., 1997; Xia et al., 1997), калсенилин (Buxbaum et al., 1998), β-catenin (Zhang, Z., et al., 1998), филамин (Zhang, W., et al., 1998) и tau (Takashima et al., 1998) были выделены в качестве связывающих белков в PS1. Причина, по которой многие белки связываются с PS1, неизвестна. Однако это может быть объяснено предположением, что PS1 функционирует как своего рода внутриклеточный транспортер с относительно низкой специфичностью. Многокомпонентная трансмембранная структура PS1, особенно полноразмерной формы, не противоречит этой гипотезе, и этот вид активности фактически проявлялся в случае транспорта амилоидного белка (Naruse et al., 1998). Наше наблюдение за ядерной транслокацией QM / Jif-1 также совместимо с этой идеей.

Было предложено активировать c-jun, особенно опосредованное JNK, для участия в различных типах гибели клеток, включая апоптоз, индуцированный TNF- или Fas (Verheij et al., 1996). Многочисленные сообщения продолжают появляться на этом апоптозном каскаде. Сообщалось, что JNK усиливает апоптоз, вызванный геном восприимчивости к раку молочной железы BRCA1, посредством активации GADD45 (Harkin et al., 1999). JNK-зависимый апоптотический путь был вовлечен в морфогенез крыла Drosophila (Adachi-Yamada et al., 1999). Кроме того, индуцированный каиновой кислотой апоптоз в гиппокампе был предотвращен у мышей, у которых отсутствовал ген Jnk3 (Yang et al., 1997), что указывает на то, что JNK3 необходим для этого типа апоптоза. Роль JNK в индуцированном каиновой кислотой апоптозе была подтверждена у мышей, несущих мутации на сайтах JNK-фосфорилирования гена c-jun (Behrens et al., 1999). В мозге АД наблюдалось увеличение иммунореактивности c-Jun и сильно коррелировало с патологическими изменениями (Anderson et al., 1996). Мутации в PS1 могут влиять на такие каскады на заключительном этапе c-Jun и тем самым влиять на апоптоз. Поскольку наши результаты показали, что ингибирующее действие мутантного PS1 на апоптоз, опосредованный c-jun, было слабее, чем у нормального PS1, мутация в PS1 может быть фактором, способствующим апоптозу c-jun-опосредованным.

Тем не менее, продолжаются дискуссии о роли c-jun и JNK в апоптозе in vivo. Хотя нарушение двойного гена Jnk1 и Jnk2 приводит к тяжелой дисрегуляции апоптоза во время развития в определенных областях мозга, Jnk3 не влияет на этот апоптоз (Kuan et al., 1999). Сообщалось, что c-jun может быть недоступен при смерти клеток развития и аксогенезе сетчатки (Herzog et al., 1999). Эти расхождения могут предполагать, что каскад c-Jun / JNK играет разные роли в смерти нейронов развития и смерти зрелого нейрона. Поэтому наши результаты по каскаду от PS1 до c-Jun следует тщательно применять к различным типам гибели клеток.

До сих пор функции нормального и мутантного PS1 в клеточной гибели по-прежнему трудно сочетать (обзор см. В Barinaga 1998). Сообщалось, что нормальный PS1 способствует клеточной гибели в основном путем воздействия на метаболизм Аβ. Между тем, накопление данных из независимых лабораторий показало, что PS1 также модифицирует различные каскады смертности клеток. Он подавляет апоптоз, связанный с активацией p53 и p21WAF1 (Roperch et al., 1998) и способствует антиапоптотической функции β-катенина (Zhang, Z., et al., 1998). В этих случаях нормальный PS1 подавляет гибель клеток, тогда как мутации в PS1 прерывают эту функцию.

Подавление гомодимера c-Jun с помощью PS1 может привести к другому результату в сигнальных путях, отличных от апоптоза c-jun-опосредованного в этом исследовании. Например, нейротрофины связываются с мембранными рецепторами тирозинкиназного типа и активируют c-Jun через митоген-активированный протеин (MAP) киназный путь. Многие другие трофические факторы, в том числе фибробласты (FGF), эпидермальные (EGF), тромбоцитарные (PDGF) и факторы роста гепатоцитов (HGF), индуцируют подобные сигнальные каскады и способствуют выживанию клеток. В таком состоянии, когда активация c-Jun в основном способствует выживанию, PS1 может способствовать апоптозу. Подобно нейротрофинам, которые трансдуцируют сигналы выживания и смерти через рецепторы с высоким сродством и низким сродством, соответственно (обзор см. В Dechant and Barde 1997), PS1 может трансформировать оба типа сигналов через различные молекулы, связывающиеся с PS1.

Другими словами, наши результаты, возможно, предложили еще одно объяснение того, почему PS1 вызывает различные эффекты на судьбу клетки. Каскад PS1 / QM / c-Jun приводит к противоположному результату, выживанию или смерти, в зависимости от конечного эффекта c-Jun, на который влияют клеточные условия. Хотя пока неизвестно, какие факторы определяют отношение c-Jun в клетках, другие типы сигнальных каскадов, индуцированные PS1, включая выделение кальция из эндоплазматического ретикулума (Guo et al., 1996) и сигнализацию белка G (обзор см. В Nishimoto 1998 ), может перекрестно говорить и изменять реакцию клеток на активацию c-Jun.

В мозгах AD, которые обычно вырождаются более чем на несколько лет, возможно, что как c-jun-ассоциированные, так и c-jun-неассоциированные гибели нейронов происходят в различных ситуациях. Хотя сам апоптоз является довольно быстрым процессом в одном нейроне, он встречается в многочисленных нейронах мозга наугад, и поэтому массовое дегенерация мозга происходит постепенно. Поэтому мы предполагаем, что апоптоз, опосредованный c-jun, под влиянием PS1, может быть аддитивным фактором для изменения судьбы нейронов в мозге AD и может функционировать параллельно с амилоидным осаждением, способствуемым мутациями PS, а также патогенными механизмами, опосредованными другие связывающие белки.

Мы благодарим доктора Роджера Брента за то, что он разрешил нам использовать двухгибридную систему и библиотеку кДНК для эмбриональной мозговой оболочки мозга, д-р A.I. Леви (Школа медицины Университета Эмори, Атланта Г.А.) для моноклональных антител αN и αL PS1, д-р. S.S.Sisodia и G. Thinakaran (Чикагский университет, Чикаго, Иллинойс и Университет Джонса Хопкинса, Балтимор, MD) за предоставление αL, Dr. Т. Асано и К. Инукай (Токийский университет, Япония, Япония) для pCAGGS-GLUT1 и д-р К. Камакура (Национальный медицинский колледж обороны, Сайтама, Япония) для поддержки иммуногистохимии. Мы благодарны доктору Гэри Левину (Центр молекулярной медицины им. Макса Дельбрюка, Берлин, Германия) за критическое чтение рукописи и за полезные советы.

Эта работа была поддержана грантами (07558233 и 10670574) от Министерства образования, культуры и спорта Японии для Х. Окадзавы.

1.used в этой статье: Aβ, β-амилоид; AD, болезнь Альцгеймера; αL, антитело против петли; αN, анти-NH2-концевое антитело; AP, активированный белок; APP, белок-предшественник амилоида; CAT, хлорамфеникол-ацетилтрансфераза; EGFP, усиленный зеленый флуоресцентный белок; GLUT1, транспортер глюкозы 1; GST, глутатион-S-трансфераза; Jif, Jun-взаимодействующий фактор; JNK, c-Jun NH2-терминальная киназа; nt, нуклеотид (ы); PS1, пресенилин 1; RT, обратная транскриптаза; TRE, 12-O-тетрадеканоилфорбор-13-ацетат (TPA) -резонансный элемент

I. Имафуку и Т. Масаки внесли вклад в эту работу.

(a) Протеиновая последовательность QM / PS309-4. Стрелка указывает на NH2-конец клона PS309-4. Аминокислотная замена в PS309-4 (Ser202Asn) обозначается жирным шрифтом. (б) Двухгибридное взаимодействие между PS309-4 и PS1. pJGPS309-4 ретрансфицировали в клетки дрожжей EGY48, которые были трансформированы плазмидой приманки pEGPS1 и репортерной плазмидой pSH18-34. Две независимые колонии были взяты из пластины SD-HWU и испытаны на пластинах SG-HWUL и SG-HWU-Xgal. Отрицательные (pEGPS1 / pJG4-5) и положительные (pEGShc / pJGShc) контрольные образцы были одинаково проверены. (c) Двухгибридный анализ взаимодействия между QM и различными частями белка PS1. Частичные кДНК, соответствующие количеству аминокислот делеционных плазмид, амплифицировали с помощью ПЦР с помощью синтетических праймеров и субклонировали в ПЭГ. Дрожжевые клетки EGY48 подвергали трансплантации этими векторами pEG, pJGPS309-4 и pSH18-34, а затем инкубировали в течение 2 дней на селекционных планшетах. Количественный анализ активности β-галактозидазы проводили в соответствии со стандартным протоколом (Guarente, 1983).

(a) Полноразмерный PS1 был соосажден с QM анти-QM-антителом из тканей мозга коры головного мозга нормальных (образцы 1 и 2), борьбы с болезнями (амитрофический боковой склероз) (образец 3), не-амилиальных AD (образцы 4 и 5) , или PS1-связанный мозг AD (образцы 6 и 7). Образец 6 был у пациента с мутацией Met146Leu, а образец 7 был у пациента с мутацией Ala246Glu. Полоса приблизительно 50 кДа полной длины PS1 была обнаружена αN и αL. Иммунопреципитат из нормального мозга (образец 1) неспецифической сывороткой (NS) также был обнаружен как отрицательный контроль. Те же фильтры подвергали воздействию антител против QM (нижние панели), чтобы подтвердить, что равные количества образцов белка были загружены на гели. (б) Вестерн-блот-анализ тех же образцов человеческого мозга с αN и αL. (c) QM был соосажден с PS1 с помощью αN или αL антител из коры головного мозга нормального человеческого мозга. Неспецифическую сыворотку (NS) использовали для иммунопреципитации как отрицательный контроль.

Нозерн-блот-анализ экспрессии QM в различных органах и различных областях мозга. В качестве зонда использовалась кДНК PS309-4. Конечная промывка составляла 0,1 × SSC / 0,1% SDS при 60 ° C в течение 60 минут. нуклон, ядро.

(a) Легкая микроскопическая иммуногистохимия мышиной коры головного мозга. Цитоплазму кортикальных нейронов окрашивают анти-QM-антителом. Бар, 5 мкм. (б) Электронно-микроскопическая иммуногистохимия с DAB, показывающая один нейрон в коре головного мозга мыши. Цитоплазму окрашивают гранулированным способом. Бар, 1 мкм. (c) Мощное увеличение нейрона в коре головного мозга мыши. Окрашивание DAB расположено в основном на гладких трубчатых мембранных структурах (стрелки). Бар, 100 нм. (d) Электронно-микроскопическая иммуногистохимия человеческого кортикального нейрона с антителами, конъюгированными с золотом. QM (5-нм золотые зерна) и PS1 (10-нм золотые зерна) расположены преимущественно вокруг гладких мембранных структур. Бар, 100 нм. (e) Зерна PS1 и QM в ядре (нуклеате) человеческого кортикального нейрона меньше, чем в цитоплазме, но иногда колокализуются. Бар, 100 нм. (f-i) зерна 5 и 10 нм существуют близко друг к другу (головки стрелок) в нормальном человеческом мозге (f), нефамильный человеческий мозг AD (g), PS1-связанный мозг AD человека (h) и в амиотрофическом болевой склероз человеческого мозга (i). Бар, 100 нм (f-i).

(а) Конструкции векторов экспрессии PS1 и 1 × TRE CAT плазмид. PS1 кДНК субклонировали в pCIneo, направленный непосредственным ранним энхансером / промотором цитомегаловируса. Для 1 × TRE CAT плазмид синтетические олигонуклеотиды были вставлены в tkCAT. (b) Анализ CAT, показывающий действие нормального или мутантного (Met146Leu) PS1 на c-jun-, c-fos- или c-jun / c-fos-опосредованную трансактивацию. Выражение нормальной, а также мутантной PS1 репрессированной трансактивации энхансера / промотора гена коллагеназы с помощью c-jun, но не c-fos или c-jun / c-fos. В качестве контроля исследовали влияние GLUT1 на индуцированную c-jun трансактивацию. pBluescript KS + добавляли для уравновешивания общего количества плазмид. (c) Анализ CAT с использованием различных 1 × TRE CAT репортерных плазмид. Котрансфекция PS1 явно подавляла трансактивацию c-jun на векторах 1 × TRE. (d) Анализ CAT с использованием векторов экспрессии junB и junD. Экспрессия PS1 подавляла junD-индуцированную трансактивацию, но не junB-индуцированную трансактивацию. (e) Экспрессия белка c-Jun и нормального или мутантного PS1 в трансфицированных клетках, используемых для анализа CAT. Белки получали из клеток, используемых для анализа CAT, разделяли SDS-PAGE и детектировали анти-c-Jun антителом (αJun) или антителом против PS1-петли (αPS1L). Полосы, соответствующие c-Jun, полноразмерному PS1 и COOH-концевому фрагменту PS1, были обозначены стрелками. Дорожки 1-4 соответствуют дорожкам 1-4 в b. (f) Гистограмма, показывающая среднюю деактивацию кратковременных анализов.

(a) Транслокация слитого белка EGFP-QM в ядро ​​стимулировалась котрансфекцией нормального PS1. Когда pEGFQM трансфицировали только в клетки F9, он распределялся преимущественно в цитоплазме. Посредством совместного экспрессии PS1 распределение слитого белка EGFP-QM переносилось в ядро. Эта ядерная транслокация не была очевидна, когда мутант (Met146Leu) PS1 был коэкспрессирован. Экспрессия нормальных и мутантных белков PS1 была эквивалентна в Вестерн-блот-анализе, выполненном аналогично фиг. 5 e. Процент ядерной транслокации рассчитывался по (числу клеток с более сильной флуоресценцией в ядре) / (общее количество флуоресцентно-положительных клеток) × 100. В каждой трансфекции наблюдалось около 100 флуоресцентно-позитивных клеток. (б) Анализ сдвига подвижности геля, показывающий влияние нормального или мутантного PS1 на связывание ДНК-белка различных AP-1 комплексов. F9 клетки трансфицировали векторами экспрессии c-jun, c-jun / c-fos, junD или junB с pBluescript в качестве контроля, нормальным PS1 (PS1) или мутантом PS1 (mPS1). 10 мкг каждой плазмиды трансфицировали методом фосфата кальция и ядерный экстракт получали через 36 ч после трансфекции. Олигонуклеотид, соответствующий металлотионеину IIa TRE, был радиоактивно мечен ферментом Кленова и использовался в качестве зонда. C, ДНК-белковый комплекс. F, свободный зонд. Котрансфекция нормального PS1 замечательно подавляла связывание гомодимера c-Jun, тогда как мутант PS1 подавлялся слабо. ДНК-белковый комплекс гетеродимера c-Jun / c-Fos и гомодимер JunB не был заметно затронут. Комплекс гомодимера JunD слабо ингибировался.

(a) Аппоз, индуцированный ретиноевой кислотой, был подавлен в стабильных клетках, экспрессирующих антисмысловый c-jun. SDS-PAGE и Вестерн-блот-анализ показывают, что экспрессия белка c-Jun индуцируется обработкой ретиноевой кислотой в клетках F9, но не в стабильных клетках, экспрессирующих антисмысловый c-jun. Анализ геномной ДНК этих клеток показывает, что формирование лестницы ДНК, соответствующее апоптозу, было подавлено в антисмысловых стабильных клетках. Аналогичные результаты были получены и в других стабильных клеточных линиях (n = 3). (б) Вестерн-блот-анализ с антителом против PS1-петли, показывающим уровень экспрессии белка PS1 в стабильных клетках. F9PS1, стабильная клеточная линия, выражающая нормальный PS1; F9mPS1, стабильная клеточная линия, экспрессирующая мутант (Met146Leu) PS1; FL, полноразмерный PS1; CTF, COOH-концевой фрагмент PS1. (c) Анализ маркировки конца нитей, показывающий, что апоптоз, индуцированный ретиноевой кислотой, заметно снижался в F9PS1, но слегка в F9mPS1. Флуоресцентную маркировку апоптотических ядер проводили с помощью системы обнаружения апоптоза (Promega) в соответствии с коммерческим протоколом. (d) Эффекты PS1 или mPS1 на апоптоз, индуцированный ретиноевой кислотой, были обнаружены с помощью анализа нитей с концевой маркировкой (белые полосы) и анализа исключения трианового синего красителя (заштрихованные полосы). В каждой избыточной экспрессии анализировались три независимые стабильные клеточные линии. Процент апоптоза в восьми визуальных полях (среднее ± SD) значительно снижался (ANOVA, P <0,01) в F9PS1 (линии клеток 1-3) и F9mPS1 (клеточные линии 1 и 2) по сравнению с F9. (д) Анализ геномной ДНК клеток F9 и стабильных клеток, экспрессирующих нормальный или мутантный PS1 в индуцированном ретиноевой кислотой апоптозе. Клетки культивировали в присутствии 0,1 мкМ полностью транс-ретиноевой кислоты в течение 48 часов. Как плавающие, так и адгезивные клетки собирали вместе для приготовления ДНК. ММ, маркер молекулярной массы IV (Boehringer Mannheim).

(а) Конструкцию детекции QM / Jif-1 субклонировали в вектор экспрессии белка гибридного белка GST или в вектор экспрессии эукариот. (б) Слитые белки GST, лишенные предполагаемого домена пальцев цинка (zif), не связывались с полноразмерным PS1 в анализе сдерживания. IP, вход. (c) Удаление zif влияет на регуляцию транскрипции. Котрансфекция полноразмерных QM в клетки F9PS1 подавляла индуцированную c-jun трансактивацию, тогда как Δ1 улучшала индуцированную c-jun трансактивацию. Этот эффект не был обнаружен в других конструкциях, не имеющих zif. 10 или 20 мкг Δ1-3 подвергали транстрансфекции 5 мкг экспрессирующего вектора c-jun, экспрессирующего вектора QM и / или коллагеназы 1 × TRE CAT в 1 × 106 F9PS1 клеток. Общее количество трансфецированных плазмид контролировали с помощью pBluescript KS +. (d) Слитые белки QM-GFP, содержащие делеционные конструкции QM, экспрессировали в клетках F9PS1 и анализировали их субклеточную локализацию. 1 или 2 (Δ2). QM-GFP и Δ1-GFP локализовались преимущественно в ядре в клетках F9PS1. (e) Клетки F9PS1 трансфицировали векторами, выражающими полноразмерную или удаленную QM. Трансфекция Δ1 увеличивала количество апоптозных клеток при лечении ретиноевой кислотой, тогда как другие конструкции не влияли на апоптоз, связанный с c-jun. Статистический анализ подтвердил увеличение процентного апоптоза при трансфекции Δ1 (ANOVA, P <0,01) от значения при трансфекции QM.

Комментариев нет.

Добавить комментарий

Ваш e-mail не будет опубликован. Обязательные поля помечены *