Нажмите "Enter", чтобы перейти к контенту

Миристоилированный кальцийсвязывающий белок, который предпочтительно взаимодействует с болезнью Альцгеймера Пресенилин 2-белок

A Myristoylated Calcium-binding Protein that Preferentially Interacts with the Alzheimer's Disease Presenilin 2 Protein
Источник: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2133148/

Адресная корреспонденция Мервину Дж. Монтейру, Центр медицинской биотехнологии, номер N352, 725 West Lombard Street, Балтимор, MD 21201. Тел .: (410) 706-8132. Факс: (410) 706-1732. E-mail: monteiro@umbi.umd.edu

Хорошо известно, что мутации в генах presenilin 1 и 2 вызывают большинство ранних стадий болезни Альцгеймера (AD). Однако наше понимание клеточных функций белков, которые они кодируют, остается рудиментарным. Знание белков, с которыми взаимодействуют пресенилины, должно привести к лучшему пониманию функции пресенилина в нормальных и болезненных состояниях. Мы сообщаем здесь об идентификации кальцийсвязывающего белка, успокаирина, который взаимодействует преимущественно с пресенилином 2 (PS2). Кальмирин является миристоилированным, связанным с мембраной и colocalizes с PS2, когда два белка сверхэкспрессируются в клетках HeLa. Дрожжевые двухгибридные жидкостные анализы, аффинная хроматография и эксперименты с коиммунопреципитацией подтверждают связывание между PS2 и каурипином. Функционально, успокаирин и PS2 увеличивают гибель клеток при котрансфецировании в клетки HeLa. Эти результаты ссылаются на несколько провокационных возможностей для динамической роли успокаирина в передаче сигналов, смерти клеток и AD.

Болезнь Альцгеймера (AD) 1 является дегенеративным расстройством, которое клинически характеризуется прогрессирующей деменцией и невропатологически наличием старческих бляшек и нейрофибриллярных клубок (NFT). Генетические исследования показывают, что этиология AD гетерогенна. Мутации в (белок-предшественник амилоида (βAPP), пресенилин 1 (PS1) и пресенилин 2 (PS2) (рассмотренный Hardy, 1997; Cruts and Van Broeckhoven, 1998) связаны с аутосомно-доминантным наследованием раннего семейного AD (то есть, FAD до 65 лет). Многие другие гены, в том числе некоторые, которые действуют как модификаторы или факторы риска, по-видимому, связаны с поздним AD (> 65 лет, Corder et al., 1993; Payami et al., 1997; Pericak-Vance et al., 1997; Blacker et al., 1998; Montoya et al., 1998). Примерно 50% всех случаев FAD связаны с генами пресенилина, где missense-мутации обычно обнаруживаются в остатках, которые сохраняются между два белка с редкими исключениями делеций в рацевых сплайсингах и преждевременных усечениях. Механизмы, с помощью которых мутации в генах PS и βAPP вызывают AD, неизвестны, хотя мутации в этих генах как-то взаимосвязаны по мере увеличения накопления амилоидогенного Aβ-фрагмента (см. Харди, 1997).

Человеческие PS1 и PS2-гены экспрессируются повсеместно, но при низких уровнях белка, которые приводят к трудностям и несоответствиям в их обнаружении и локализации. При избыточной экспрессии пресенилины были локализованы в ER и ядерную оболочку (см. Kovacs et al., 1996; Janicki and Monteiro, 1997 и ссылки в ней), причем одна группа сообщала данные также о локализации клеточной поверхности (Dewji and Singer, 1997). Эндогенные белки PS1 и PS2, в свою очередь, локализованы в различных структурах, включая ER, везикулярные структуры соматодентрического отделения, внутри аксонов, в центросомах и центромерах, а также на плазматической мембране (Busciglio et al., 1997; Capell et al., 1997; Li et al., 1997; Ye and Fortini, 1998).

Протеины PS1 и PS2 человека идентичны на 67%, они имеют самое высокое сходство в их COOH-терминальной последовательности и во многих внутренних областях, которые структурно прогнозируются для образования трансмембранных доменов (TMD). Предполагая, что пресенилины являются трансмембранными белками, их топография в соответствии с большинством моделей представляет собой белок, который восемь раз переливается через мембраны с доменами NH2- и COOH-терминалов и большой «петлей», охватывающей предполагаемый шестой и седьмой TMD, все из которых обращены к цитоплазме ( см. рис.1, Харди, 1997).

Несколько строк доказательств от разных видов показали, что пресенилины играют важную роль во время развития. Во-первых, гомогенез Caenorhabditis elegans presenilin, sel-12, облегчает клеточную сигнализацию Linch-12, ген, участвующий в определении судьбы клеток и развитии вульвы (см. Levitan and Greenwald, 1995). Во-вторых, мыши с нокаутом PS1 умирают вскоре после рождения с эмбрионами, которые обнаруживают дефекты центральной нервной системы и аномальное паттернирование осевого скелета и спинномозговых ганглиев (Shen et al., 1997; Wong et al., 1997). В-третьих, разрушение гена Drosophila PS является летальным, вызывая дефекты обработки Notch, а также Notch-подобные фенотипы (Strul and Greenwald, 1999; Ye et al., 1999). Хотя эти результаты явно указывают на роль пресенилинов в развитии, механизмы, с помощью которых мутации FAD в генах пресенилина вызывают AD, неизвестны. Интересно, что мыши, нарушенные PS1, могут быть спасены человеческими трансгенами, содержащими FAD-связанные мутации PS, что указывает на то, что мутации FAD не влияют на функции PS, связанные с развитием эмбриона у млекопитающих (Davis et al., 1998; Qian et al., 1998) , Напротив, мутант C. elegans sel-12 более способен различать трансгены PS дикого типа и FAD, функционально спасенные экспрессией пресенилинов человеческого дикого типа, но только частично пресенилинами, содержащими мутации FAD (Levitan et al. , 1996; Baumeister et al., 1997). Считается, что мутации PS, связанные с FAD, дают некоторый неизвестный вредный прирост функции, который коррелирует с измененной обработкой βAPP (см. Davis et al., 1998; De Strooper et al., 1998; Qian et al., 1998).

Пресенилины также участвовали в регуляции запрограммированной гибели клеток (апоптоз). Доказательства такой роли были впервые продемонстрированы, когда фрагмент кДНК, кодирующий 103 COOH-концевые аминокислоты мышиного PS2, называемый ALG-3, был выделен на экране для кДНК, которая могла бы спасти Т-клетки от рецептор-индуцированного апоптоза (Vito et al. ., 1996a). Это спасение, по-видимому, является следствием фрагмента ALG-3, действующего доминирующим негативным образом, поскольку экспрессия полноразмерного PS2 приводит к апоптозу (Vito et al., 1996b). По сравнению с апоптозом, вызванным сверхэкспрессией PS2 дикого типа в клетках PC12 и HeLa, мутация FAD PS2-N141I вызывает еще более высокие уровни апоптоза (Deng et al., 1996; Wolozin et al., 1996; Janicki and Monteiro, 1997). Аналогично, сверхэкспрессия PS1 также сенсибилизирует клетки к апоптозу (Guo et al., 1996, 1997; Wolozin et al., 1998). Механизмы, с помощью которых пресенилины индуцируют апоптоз, до конца не поняты, но возмущения кальция, окислительного стресса (Guo et al., 1996; Keller et al., 1998), дестабилизация β-catenin (Zhang et al., 1998) и усиленная сигнализация гетеротримерными GTP-связывающими белками была вовлечена (Wolozin et al., 1996; Smine et al., 1998).

Чтобы лучше понять функцию пресенилина, мы использовали двухгибридную систему дрожжей для идентификации белков, с которыми взаимодействует человеческий PS2. Используя область петли PS2 в качестве приманки, мы выделили и охарактеризовали недавно идентифицированный кальцийсвязывающий белок, который связывается преимущественно с PS2 по сравнению с последовательностью петли PS1. Этот белок, успокаирин, проявляет несколько интересных свойств, включая миристоилирование, мембранную ассоциацию и колокализацию с PS2 в котрансфецированных клетках. Подобно пресенилину, успокаинин вызывает гибель клеток при сверхэкспрессии в клетках HeLa, и, что интересно, коэкспрессия PS2 и успокаинов способствует аддитивному увеличению гибели клеток. Взаимодействие этого кальций-связывающего белка с PS2 может поэтому иметь важное значение в функции пресенилина.

B3 ‘: 5’GCTGAGTACGCTCGAGGTAGGGGAGCTGGAGGGC3’; B5 ‘: 5’CGCTTCTGGAATTCCCCAAAGGGCCTCTGAG3’; C3 ‘: 5’GCTAGCATCGCTCGAGCCACACCATGGCAGATG3’; D5 ‘: 5’CGCTTCTGGAATT CCCCACGGTTGGCATG3’; E3 ‘: 5’TATCGCTTAAGTCGACGATGTAGAGCTGATGGG3’; E5 ‘: 5’CGGTACGTGAATTCAAGAAGGCGCTGCC3’; F3 ‘: 5’GCTAGCATCGCTCGAGATACTTGGAATTTTTGG3’; F5 ‘: 5’CGTCATCAGCGAATTCCCGAAAGGTCCACTTCG3’; G3 ‘: 5’CTCGCCTAGCCTCGAGCCACACCATTGTTGAGG3’; L3 ‘: 5’TCGTGAGGATCCTCGAGCTACTGGAGCCGCGACAGGC3’; L5 ‘: 5’CTAGACCTGAATTCCCAATGGCGACTGCGACCCC3’; M3 ‘: 5’CGAGTAGCATGTCGACCAGGACAATCTTAAAGGA3’; M5 ‘: 5’GCTACACTAGCCGCGGGAATTCGGCACGAGGCG3’; N3 ‘: 5’CGAGTAGCATGTCGACTCACAGGACAATCTTAAA3’; N5 ‘: 5’GCTACACTAGCCGCGGCCACCATGGAGCAAAAGCTCATTTC TGAAGAGGAC TT GAAT CGCGGCGGGGCGATGGG3. Подчеркиваются сайты рестрикционных ферментов, внедренные в праймеры для облегчения клонирования.

Дрожжевой двухгибридный экран для белков, взаимодействующих с PS2, выполняли по существу, как описано Golemis et al. (1996), с необходимыми плазмидами и библиотекой кДНК, полученной от доктора Роджера Брент (Гарвардская медицинская школа, Кембридж, Массачусетс). Приманка PS2-петли (обозначенная PS2-петля B, см. Фиг.1A) была сконструирована путем ПЦР-амплификации области из PS2 человека (Janicki and Monteiro, 1997) с использованием праймеров B5 ‘и B3’. Полученный ПЦР-фрагмент длиной 150 п.о. дважды расщепляли с помощью EcoRI и XhoI и лигировали в соответствующие сайты плазмиды pEG202 LexA. Эта конструкция для приманки и репортерная плазмида LacZ pSH18-34 котрансформировали в дрожжевой штамм EGY48, который затем трансформировали с помощью ~ 5 мкг библиотеки кДНК мозга эмбриона человека в pJG4-5. 1,5 × 107 полученных трансформантов высевали на планшеты Gal / Raf / CM-ura-his-trp-leu для скрининга транскрипционной активации хромосомно интегрированного репортерного гена LEU2. 100 лей + дрожжевые колонии отбирали на основную пластинку Glu / CM-ura-his-trp, затем реплицировали в Glu / CM-ura-his-trp-leu, Gal / Raf / CM-ura-his-trp-leu , Glu / Xgal / CM-ura-his-trp и Gal / Raf / Xgal / CM-ura-his-trp, чтобы проверить галактозо-зависимую экспрессию leu2 и lacZ. Двойную экспрессию репортеров показывали 15 колоний, из которых библиотечные плазмиды были выделены в штамме JBe15 Escherichia coli и затем трансформировались обратно в EGY48, содержащий pSH18-34, и bait bEG pEG202LexA / PS2 или один из нескольких отрицательных контролей для тестирования специфичность взаимодействия с PS2-петлей B. Библиотечные плазмиды, которые продуцировали сильное и специфическое взаимодействие с PS2-петлей В, были выделены в штамме Е. coli DH1 и определена последовательность ДНК их вставок.

ДНК и белковые последовательности анализировали с использованием MacVector 6.5 (Oxford Molecular). Поиск гомологии в базах данных NCBI выполнялся с использованием программы BLAST. Три из семи предполагаемых взаимодействий были независимыми клонированием той же самой кДНК, которую мы назвали спокойным. Для дальнейших экспериментов клон 7, библиотечная плазмида, которая содержала полноразмерную кДНК калмырина, расщепляли EcoRI и XhoI и субклонировали в вектор pBluescript KS (-) или pGST / His T1 (Pharmacia Biotech, Inc.).

Специфичность взаимодействия каутиринов тестировалась на трех конструкциях области PS2-петли, двух различных конструкциях с PS1-контурами, одна из которых была дополнительно мутирована с соответствующей последовательностью PS2, одной PS2-COOH-терминальной конструкцией и контролем ламина. Консервированную область петли 31-аминокислот (обозначенную PS2-петлю C) получали с использованием праймеров B5 ‘и C3’ для ПЦР генерировать фрагмент длиной 93 п.н. Более расходящаяся область петли (обозначенная PS2-петля D) была сгенерирована с использованием праймеров D5 ‘и B3’. Конструкцию, кодирующую последние 40 аминокислот PS2 (обозначенной PS2-Cterm), была создана с использованием праймеров E5 ‘и E3’. Соответствующие области B и петли C в PS1 были амплифицированы ПЦР с использованием праймеров F5 ‘с F3’ или G3 ‘, соответственно, из полноразмерного клона PS1, полученного от доктора S.S.Sisodia (University of Chicago, IL). Область С1-петлевой С, которая отличается только тремя аминокислотами из соответствующей петли PS2 (содержащей треонин вместо пролина в положении 281 (см. Фиг.1А, пронумерованный согласно PS1), лейцин вместо изолейцина в положении 282 и треонин для аланина в положении 291), мутировали в каждом из трех расходящихся остатков поодиночке и во всех возможных сочетаниях с соответствующей последовательностью PS2 с использованием подходящих праймеров ПЦР и метода сайт-направленного мутагенеза QuikChange ( Stratagene). Конструкцию контрольной приманки, которая содержала первые 31 аминокислоту ламина В, получали ПЦР с праймерами L5 ‘и L3’ из ламина B, клонированного в pBluescript KS (-) (Mical and Monteiro, 1998).

Все ПЦР-амплифицированные области расщепляли EcoRI и XhoI, клонировали в pEG202 и подтверждали секвенированием ДНК. Эти различные приманки трансформировали в EGY48 и обнаружили путем иммуноблоттинга дрожжевых экстрактов для экспрессии слитых полипептидов lexA-PS соответствующего размера. Три изолята из дрожжей, трансформированных с помощью успокаирина в pJG4-5 (клон 7) плюс каждая приманка PS или контрольная приманка для ламина, анализировали на активность фермента β-галактозидазы в жидких культурах с использованием ONPG (O-нитрофенил-d-галактопиранозида) в виде субстрат (Reynolds and Lundblad, 1989).

32P-меченые ДНК-зонды были получены с помощью стандартной случайной праймерной маркировки 100 нг полноразмерной кДНК калмырина или человеческого рецептора β-актина. Клетка с многократной множественностью тканей человека (MTN) и многоцелевая ткань человеческого мозга Northern Blot II (CLONTECH Laboratories, Inc.) гибридизовалась с зондом с каримином при 68 ° C в течение ночи, промывалась в 0,1 × SSC при 50 ° C и подвергалась воздействию фильм. Затем блоты были удалены из зонда успокаивателя и подвергнуты анализу с контролем β-актина (CLONTECH Laboratories, Inc.).

Оригинальная конструкция pGST или конструкция pGST, содержащая полную последовательность консираринов, слитую COOH-терминально и в рамке с GST, трансформировали в бактерии CAG456. Неиспользуемая индукция гибридного белка GST и GST / платирина с IPTG, инкубация с глутатион-агарозой и элюция с уменьшенным глутатионом были такими же, как описано в Janicki and Monteiro (1997).

Для экспрессии белка в клетках HeLa использовали вектор pGEM-CMV, плазмиду экспрессии CMV, содержащую my-тег COOH-конца (описанный в Janicki and Monteiro, 1997). Конструкцию конситурина, содержащую CO-концевой myc-эпитоп в рамочном COOH-конце, была создана путем ПЦР-амплификации фрагмента паутирина из pBS-каутирина с праймерами M5 ‘и M3’, что привело к получению ПЦР-продукта с энергией 600 п.о., который расщепляли SacII и SalI и лигировали в pGEM-CMV.

Конструкцию конъюринина с NH2-терминальным myc-tagged также создавали с помощью ПЦР с использованием праймера N5 ‘с праймером N3′, чтобы ввести одиннадцать остатков myc-эпитопа (Monteiro et al., 1994), а затем четыре остатка, закодированные 5’-нетранслируемой последовательностью карипирина к полной кодирующей последовательности. Полученный в результате продукт PCR ~600 п.о. расщепляли SacII и SalI и лигировали в pGEM-CMV.

Невзаимодействующую конструкцию экспрессии конъютирина полной длины была создана путем переваривания pBS-сатиририна с помощью SacII и XhoI, гель, изолирующий фрагмент размером ~ 650 п.н., и лигирование его на SacII / SalI линеаризованный pGEM-CMV. Клонирование и экспрессия как полноразмерной PS2, так и конструкции PS2, удаленной из цикла и COOH-концевой последовательности [pPS2 (268aa) + Myc], были описаны ранее (Janicki and Monteiro, 1997). Экспрессия полноразмерной субъединицы нейрофиламентного типа дикого типа (NF-L) была достигнута с использованием экспрессионной конструкции CMV-NF-L (Lee et al., 1993).

Очищенный белок GST / капитирин и слитый белок GST / PS2 (NH2-терминальный) (описанный в Janicki and Monteiro, 1997) были отправлены в Covance Research Products для инокуляции кроликов. Специфичность этих кроличьих антител определяли с помощью иммуноблоттинга (Janicki and Monteiro, 1997) и иммунофлуоресцентного окрашивания клетки HeLa, трансфецированной стабилином или PS2. Для иммуноблоттинга анти-успокаининовые и анти-PS2-антитела использовались при разведении 1 / 500-1 / 700 и были обнаружены с помощью конъюгированных с пероксидазой хрена антител к кроличьим вторичным антителам и субстрата SuperSignal (Pierce Chemical Co.).

Клетки HeLa выращивали в DME, дополненном 10% FBS и транзиторно трансфицировали соответствующими плазмидными ДНК в виде осадка фосфата кальция (Janicki and Monteiro, 1997). Альтернативно, 20 мкг ДНК и 2 × 106 клеток HeLa электроролировали при 960 мкФ и 0,3 кВ.

Клетки HeLa трансфицировали непосредственно на стеклянные покровные стекла, фиксированные и окрашенные антитела, как описано в Janicki and Monteiro (1997). Используемыми антителами были кроличья анти-кариминовая сыворотка (разведенная 1: 250), антитело против PS2 (NH2-концевое) козы (разведенное 1: 150, Santa Cruz Biotechnology, Inc.), кроличьи антиламинарные сыворотки (разведенные 1: 200; Mical and Monteiro, 1998), кроличьи анти-NFL-сыворотки (разведенные 1: 250, сгенерированные в этой лаборатории с использованием рекомбинантно-очищенной, бактериально экспрессированной легкой цепи нейрофиламента мыши), M30 CytoDEATH мышиное антитело против цитокератина 18 (разведенное 1:50; Boehringer Mannheim), флуоресцеин- и родамин-конъюгированные осел-анти-кролик, анти-козлиные и антимышиные антитела (Jackson ImmunoResearch Laboratories, Inc.). Флуоресцентное окрашивание клеток визуализировалось на инвертированном микроскопе Leica DM IRB, и изображения были захвачены с помощью камеры Photometrics SenSys и обработаны программным обеспечением IPLab Spectrum и Multiprobe (Scanalytics) на Power Macintosh. Конфокальная микроскопия и обработка изображений выполнялись с использованием цели × 100 системы конфокальной и визуализации Leica (Leica Inc.) с помощью доктора Тимоти Микала и доктора Джозефа Галла (Институт Карнеги, Балтимор, MD).

Селезенка, мозг, почка, печень, сердце и ткани скелетных мышц были вскрыты у взрослой мыши, нарезанной лезвием бритвы в 1-2 мл буфера для лизиса (Monteiro and Mical, 1996), гомогенизированной на льду, коротко обработанной ультразвуком на льду, и центрифугировали при 2000 об / мин в течение 5 мин. Собирали супернатанты тканевых лизатов, их концентрацию белка определяли с помощью анализа белка BCA (Pierce) и 100 мкг каждого образца отделяли SDS-PAGE, переносили в нитроцеллюлозные фильтры и иммуноблоттировали антителом против сатиридина кролика.

Ткани почек и сердца у 8-12 мышей 2-мерного дробления были измельчены бритвенным лезвием, ресуспендированы в 2 мл 0,25% коллагеназы в PBS, вихревые, инкубированы при 37 ° С в течение 15 мин, центрифугированы и промыты 3 × PBS , Клетки культивировали в среде EGM, дополненной BBE (Clonetics) и 10% FBS в течение 2-7 дней. Для иммунофлюоресценции клетки культивировали непосредственно на покровные стекла и фиксировали и окрашивали, как описано выше.

Недетергентные растворимые и нерастворимые фракции клеток HeLa получали, по существу, как описано Gerace and Globel (1980). Клетки HeLa (~ 1 × 106) собирали через 24 часа после трансфекции путем скрещивания клеток в ледяном PBS и центрифугирования при 10000 g. Клетки ресуспендировали в 0,25 мл 10 мМ триэтаноламин-HCl (рН 7,4), 10 мМ KCl, 1,5 мМ MgCl2, 5 мМ иодацетамида и 1 мМ Pefabloc (Boehringer Mannheim). После 10-минутной инкубации на льду клетки разрушали 10 нежными штрихами в гомогенизаторе Potter-Elvehjem объемом 0,5 мл. Затем добавляли 0,25 мл 10 мМ триэтаноламин-HCl (pH 7,4), 270 мМ KCl, 1,5 мМ MgCl2, 5 мМ иодацетамида и 1 мМ Pefabloc и после смешивания гомогенаты центрифугировали при 100000 g в течение 15 минут в Beckman TLX ультрацентрифуга. Супернатанты удаляли и гранулы ресуспендировали в буфере для лизиса (Monteiro and Mical, 1996) до объема, равного объему их соответствующих супернатантов.

Фракции клеток HeLa, обработанных Triton X-100, получали лизированием трансфицированных клеток в 0,5 мл ледяного 1% Triton X-100, 10 мМ триэтаноламин-HCL (pH 6,9), 140 мМ KCl, 1,5 мМ MgCl2, 5 мМ иодацетамида , и 1 мМ Pefabloc. После 10-минутной инкубации лизаты центрифугировали при 140000 g в течение 15 мин. Супернатанты собирали и гранулы ресуспендировали в буфере для лизиса. Эквивалентные объемы фракций супернатанта и гранул обработанных детергентами и необработанных клеток разделяли SDS-PAGE и иммуноблоттировали с использованием антитела против сатинирина кролика или антитела против ламина кролика. Та же процедура фракционирования клеток была использована на культурах первичных клеток, полученных из мышиной почки.

После трансфекции добавляли пируват натрия до конечной концентрации 1 мМ и 0,1-0,2 мКи 3H-миристиновой кислоты (Amersham Life Science Inc.), добавляли к свежей среде в каждую чашку для культивирования клеток. Через ~ 24 ч после трансфекции клетки соскабливали со дна тарелки, и среду собирали и центрифугировали 5 мин при 3000 об / мин. Осадок клеток промывали PBS, центрифугировали, ресуспендировали в 400 мкл буфера для лизиса (50 мМ Hepes, 100 мМ KCl, 0,3% NP40, 1 мМ EDTA, 1 мМ EGTA, pH 7,5, + коктейль ингибитора протеазы с апротонином, лейпептином и PMSF, Boehringer Mannheim) и гомогенизировали на льду. Нерастворимый материал осаждали и супернатант собирали и разбавляли равным объемом буфера для разведения (50 мМ Hepes, 1 мМ EDTA и 1 мМ EGTA, pH 7,5). 150 мкл лизатов инкубировали с 5 мкл антитела (анти-сатиринин кролика, кролик против PS2 или контрольная преиммунная сыворотка кролика) в течение 2 ч при 4 ° С. Затем к лизатам добавляли 45 мкл суспензии белковых гранул A-Sepharose (Pharmacia Biotech, Inc.) и инкубировали с ротаминированием еще 1 час. Гранулы осаждали путем центрифугирования и после удаления надосадочной жидкости гранулы промывали четыре раза буфером для лизиса / разбавления. Весь иммунопреципитат и одну шестую часть образца супернатанта разделяли SDS-PAGE. После окрашивания и обезжиривания голубым кумасси геля вымачивали в течение трех 15-минутных изменений ДМСО, погружали в 22% PPO (2,5-дифенилоксазол) в течение 90 мин, промывали в воде, сушили и подвергали воздействию пленки флюорографией в течение 1 недели до 2 мес.

Через ~ 24 ч, ложные или PS2-трансфецированные клетки HeLa (~ 1 × 106 клеток) промывали в охлажденном льдом PBS, очищали до PBS и осаждали центрифугированием в течение 5 мин при 3000 об / мин. Клетки ресуспендировали в 400 мкл буфера для лизиса (см. Раздел миристоилирования), обрабатывали ультразвуком и гомогенизировали на льду. Нерастворимый материал осаждали и супернатант собирали и разбавляли равным объемом буфера для разбавления. Весь растворимый лизат инкубировали в течение ночи при 4 ° С с активированными CNBr сефарозными гранулами (Pharmacia Biotech, Inc.) в сочетании с эквивалентным количеством (240 мкг) либо очищенного GST, либо GST / каллирин. Гранулы сефарозы затем гранулировали центрифугированием и удаляли супернатант, содержащий несвязанный белок. Гранулы промывали 2,5 М KCl, ресуспендировали в буфере Леммли и 1/2 образца отделяли SDS-PAGE и иммуноблоттировали для присутствия PS2 с использованием козьего анти-PS2 (NH2-концевого) антитела.

Дублирующие блюда клеток HeLa (покрытые смесью ~ 3 × 105/100 мМ) трансфицировали различными комбинациями pGEM-CMV-успокаирин, pGEM-CMV-PS2 и контрольного вектора (базовый вектор экспрессии CAT, Promega). Через ~ 48 ч плавающие клетки каждого блюда собирали, собирая всю среду, центрифугируя в течение 5 мин при 3000 об / мин и удаляя все, кроме ~ 500 мл супернатанта. После встряхивания измеряли точный объем каждой клеточной суспензии. Количество клеток подсчитывалось дважды для каждого образца на гемацитометре. Эти подсчеты клеток корректировали в соответствии с начальным объемом ресуспендирования, чтобы дать общее количество плавающих клеток на блюдо. Счетчики для двух независимых блюд каждой комбинации конструкции трансфекции были усреднены и графически. Было обнаружено прямое соответствие между плавающими клетками и апоптотическими клетками, причем ~ 85% плавающих клеток демонстрируют положительное окрашивание CytoDEATH.

Используя двухгибридную систему дрожжей, библиотеку кДНК мозга эмбриона человека скринировали на белки, которые связывают область петли PS2. Полноразмерная PS2 была непригодна в качестве приманки, предположительно потому, что она не могла быть перенесена в ядро ​​из-за наличия гидрофобных трансмембранных доменов. Кроме того, поскольку это одна из самых расходящихся областей между пресенилиновыми белками, мы полагали, что наши шансы на поиск СР2-специфических взаимодействий будут увеличены. После того, как мы обнаружили, что наша начальная самозастраиваемая транскрипция PS2-цикла (остатки 270-361), мы усекали приманку, уменьшая ее до первых 50 аминокислот, чтобы удалить несколько кислых остатков и обозначили ее PS2-петлю B (B для приманки Фиг.1А). Конструкцию наживки PS2-петли B, плазмиду lacZ-репортера и плазмиды библиотеки ДНК кДНК плода человека трансформировали в дрожжи, а из 1,5 × 107 первичных трансформантов, экранированных, были выделены 15 предполагаемых взаимодействий. Изолированные библиотечные жертвенные плазмиды тестировали на их способность воспроизводить специфический фенотип взаимодействия, когда сосуществуют с приманкой с петлей, но не с несвязанными приманками (такими как человеческий ламин B). Клоны, которые продуцировали специфический фенотип взаимодействия, были секвенированы и идентифицированы с помощью поиска базы данных BLAST. Интересно, что три из них были независимыми кДНК, все из которых содержали полную кодирующую последовательность недавно идентифицированного кальцийсвязывающего белка, но с различными NH2-терминальными нетранслируемыми расширениями. Две другие группы выделили этот кальций-связывающий белок в двухгибридных сетях дрожжей и назвали его CIB для его способности связывания кальция и интегрина αIIb (Naik et al., 1997) и KIP из-за его взаимодействия с эукариотиком ДНК-зависимая протеинкиназа, ДНК-PKcs (Wu and Lieber, 1997). Вместо того, чтобы выбирать между этими двумя именами, мы выбрали этот белок как успокаирин (для связывающего кальция миристоилированного белка с гомологией кальцинеурину), потому что он описывает присущие ему свойства без предвзятости по отношению к своим многочисленным партнерам по связыванию.

Чтобы количественно определить специфичность связывания успокоирина к PS2-петле и определить, взаимодействует ли этот белок с петлей PS1, которая идентична аминокислотной последовательности на 45%, мы измерили активность β-галактозидазы в анализах на дрожжах. При котрансформировании с успокаирином приманка PS2-петли B приводила к 8-кратному увеличению активности β-галактозидазы по сравнению с отрицательным контролем ламина B, тогда как соответствующая область PS1 (PS1-петля B) приводила к 1,9-кратному увеличению активности (Фиг.1В). Концевая конструкция PS2-COOH, содержащая CONOH-концевую 39-аминокислотную последовательность после восьмого TMD, также не взаимодействовала с успокаином.

Чтобы далее нанести карту сайта связывания успокоина в петле PS2, были построены две новые приманки, которые разделили петлю на консервативную часть, петлю C (28 из 31 аминокислоты идентичны PS1) и дивергентную область, петлю D (только 33% идентичности для PS1, рис. 1 A). Так как успоирин не взаимодействовал преимущественно с сопоставимой зоной петли PS1 (PS1-loop B), мы ожидали, что сайт связывания сатиринов будет находиться в пределах расходящейся области последовательности PS2-петли (PS2-loop D). К нашему удивлению, приманка PS2-loop D слабо взаимодействовала с успокаирином, что в 2,2 раза превышало контроль (рис.1B). Однако высококонсервативная область петли PS2, PS2-петля C, обеспечила 74-кратное увеличение активности (рис.1C). Для сравнения, соответствующая конструкция PS1-loop C увеличивала активность только в 5,8 раза.

Хотя две PS-петлевые C-байты в значительной степени сохраняются в последовательности, они различаются тремя аминокислотами: PS1 содержит треониновые остатки в положениях 281 и 291 вместо пролина и аланина соответственно (см. Рисунок 1 A, пронумерованный согласно PS1) , и лейцин вместо изолейцина в положении 282. Мы исследовали, как эти три расходящиеся остатки влияли на взаимодействие кауризина с областью С-петли С в дрожжевых двухгибридных анализах путем введения аминокислот PS2 в приманку PS1, так что каждый из три дивергентных остатка мутировали поодиночке и во всех возможных сочетаниях с соответствующей последовательностью PS2. Эти данные показали, что все три остатка способствовали различным и сложным способам взаимодействия (рис.1С). Интересно, что взаимодействие с каримином восстанавливалось примерно до половины уровня PS2 путем одиночной мутации остатка 281 в пролин, который, как предсказывали, вводил бы перегиб в петле. Для сравнения, одиночная мутация остатка 282 в изолейцин не увеличивала связывание в какой-либо значительной степени, тогда как мутация остатка 291 с аланином увеличивала связывание с третьим уровнем уровня PS2. Двойные мутанты подтвердили важность остатков 281 и 291. Когда оба пролина и аланина присутствовали вместе (T281P, T291A), они значительно увеличивали связывание, что привело к приблизительно двукратному более высокому уровню связывания по сравнению с приманкой PS2 с диким типом. Этот мутант предполагает, что изолейцин в остатке 282 в PS2 может фактически скомпрометировать связывание, поскольку это будет эквивалентно тройной замене (T281P, L282I, T291A, т. Е. Возвращению его к последовательности PS2). В соответствии с этим ожиданием изолейцин 282, когда он присутствует вместе с аланином 291, не увеличивал связывание выше, чем у последнего последнего, тогда как парадоксально, когда он был замещен вместе с пролином 281, он увеличивал связывание в 1,7 раза выше, чем когда пролин был замещен в одиночку.

191-аминокислотная последовательность консиририна имеет ряд заметных признаков (фиг.2А). Сравнение последовательностей указывает на то, что успокаирин наиболее тесно связан с человеческим кальцинейрином B, регуляторной субъединицей белковой фосфатазы 2B, разделяющей 25% идентичности и 44% общего сходства. Белок содержит две полные руки EF, консервативный мотив, связанный с связыванием кальция, и на самом деле было показано, что он связывает радиоактивно меченый кальций в анализах наложения пятен (Naik et al., 1997). Белок также содержит сайт миристолирования, основанный на NH2, котрансляционную модификацию, связанную с нацеливанием белков на мембраны. Для проверки размера и структуры экспрессии транскриптов сутиририна был проведен нозерн-блот-анализ поли (А) + РНК, выделенной из нескольких взрослых тканей человека (рис. 2В). Сплошный континент, который гибридизован с транскриптом ~ 1,2 кб, который был повсеместно экспрессирован в исследуемых тканях, расширяет доказательства того, что он широко экспрессируется (Naik et al., 1997; Wu and Lieber, 1997) и подразумевает, что он играет общую функцию в большинстве, если не во всех ячейках. Хотя экспрессия мРНК была относительно мала в головном мозге, нозерн-блоттинг конкретных областей мозга показал, что экспрессия транскриптов успокаивателя была легко обнаружима и довольно однородна (рис. 2С).

Для дальнейшего изучения белка консиририна кроличьи поликлональные антистатириновые антитела были сгенерированы с использованием аффинно очищенного слитого белка GST / капитирина (фиг.3А, дорожка 7). Благодаря иммуноблоттингу эти антитела, по-видимому, являются высокоспецифичными для успокоинов, поскольку они реагируют только с полипептидами соответствующего размера (~ 22-25 кД) в клетках HeLa, сверхэкспрессирующих кДНК калмырина (фиг.3В). Полоса 1 на фиг.3В показывает, что при изображенном времени экспозиции антитела не обнаруживали эндогенный каутирин в нетрансфицированном лизате. Только после продолжительной экспозиции обнаружилась слабая полоса спокойного состояния (данные не показаны), что указывает на то, что эндогенные уровни этого кальцийсвязывающего белка относительно низки в клетках HeLa. Тем не менее, в соответствии с нашим анализом в области нозерн-блоттинга в человеческом лизате взрослого человека была обнаружена эндогенная иммунореактивная полоса при ~22 кДа (фиг.3С). Анти-успокаиновые антитела также успешно обнаруживали мышечную форму этого белка в нескольких лизатах тканевой ткани мыши (фиг.3D) из-за высокой сохранности между белками-капсирином человека и мыши (всего пять разнородных остатков, Saito et al., 1999) , Значение быстрой мигрирующей иммунореактивной полосы в мышечной скелетной мышце (фиг.3D, полоса 6) не было определено.

Поскольку субклеточная локализация успокоговорителя была неизвестна, мы использовали антитело против успокоения для определения его распределения в клетках млекопитающих с помощью непрямой иммунофлуоресцентной микроскопии. В первичных культурах от мышиной ткани сердца эндогенный сатиририн локализуется в ядре и в ретикулярно-подобном образце по всей цитоплазме (рис.3Е). Это окрашивание было четко различимо с неспецифическим фоном, полученным при исследовании с сывороткой преиннокулята кролика (данные не показаны), и, кроме того, эта картина окрашивания была воспроизведена сверхэкспрессией успокогорина при трансфекции (см. Ниже).

Поскольку PS2 представляет собой трансмембранный белок, а наши двухгибридные результаты дрожжей свидетельствуют о том, что успокоитель взаимодействует с PS2, то, что касается мембранного потенциала консенсусного сайта миристоилирования в успокаининге, нас особенно заинтриговали. Чтобы определить, является ли успокаирин миристоилированным in vivo, мы добавили 3H-миристиновую кислоту в среду клеток HeLa, трансфецированных немаркированным консирином. Для сравнения, клетки HeLa также трансфецировали конъюгированными конструкциями, в которых myc-метки сливались либо с концами белка NH2-, либо с COOH. Предсказание заключалось в том, что myc-тег (MEQKLISEEDLN), слитый с NH2-терминальным концом, нарушит миристолирование, поскольку он перемещает глициновый остаток, который необходим для миристолирования более вниз по течению (Olshevskaya et al., 1997). Через 24 ч клетки лизировали, а успокаирин был иммунопреципитирован анти-успокаивающим антителом. Миристоилированные белки визуализировали флюорографией после SDS-PAGE (фиг.4А). Флюорограф меченых лизатов клеток HeLa показал, что иммунопреципитированный C-myc-tagged -типирин и немаркированный диализ дикого типа были миристоилированы как очевидные путем включения радиоактивной метки 3H-миристиновой кислоты (полоса в дорожках 4 и 6, обозначенных стрелками), тогда как, как ожидается, что N-myc-мечение белка предотвращает миристоилирование (отсутствие полосы в полосе 2). Нижняя панель этой фигуры содержит иммуноблот из этих же лизатов клеток HeLa, чтобы показать, что оба белки-конъюрины с NH2- и COOH-терминально были выражены эффективно и до эквивалентных уровней, тогда как немаркированный успокаиватель накапливается на более низком уровне белка, объясняя более слабый миристоилированный кауризин полоса, наблюдаемая на дорожке 6 по сравнению с дорожкой 4. На самом деле, когда соотношение белков консиририна и радиоактивной меченый 3H-миристиновой кислоты сравнивается для белков C-myc-tagged и дикого типа, то они являются похожими, что ожидается, так как миристоилирование считается, что происходит котрансляционно (Wilcox et al., 1987). Причина более высокой экспрессии C- и N-myc-tagged-белков-консиринов неизвестна, но, возможно, слияние myc-эпитопа влияет на стабильность или токсичность белка, позволяя белкам накапливаться до более высоких уровней. Аналогичные попытки продемонстрировать миристоилирование эндогенного кауририна в клетках мыши и человека оказались безуспешными, по-видимому, из-за низкой экспрессии белка или медленного протекания белка.

Как только мы установили, что успокаирин действительно был миристоилирован, мы определили, был ли этот белок связан с мембранами фракционированных клеток. Трансфецированные клетки HeLa фракционировали в отсутствие каких-либо детергентов в растворимый (цитозольный) супернатант и нерастворимый (мембранный и цитоскелетный) осадок. Эквивалентные количества фракций супернатанта и фракции гранул разделяли SDS-PAGE и иммуноблоттировали для присутствия ламинов и кауририна (фиг.4В, дорожки 1 и 2). Lamins A и C, цитоскелетные компоненты, используемые в качестве контроля процесса фракционирования, были обнаружены как 68- и 66-kD полипептиды в нерастворимом грануле, как ожидалось (Gerace and Blobel, 1980; Mical and Monteiro, 1998). Большинство (> 85%) успокогорина было найдено в нерастворимой фракции. Поскольку этот способ фракционирования клеток не отличает мембранные компоненты от других нерастворимых структур, клетки также фракционируют в присутствии 1% Triton X-100, который растворяет мембраны. После этой процедуры белок-спаририн смещался в растворимую (мембранную) фракцию, тогда как слои, как и ожидалось, оставались нерастворимыми (фиг.4В, дорожки 3 и 4). Такое же фракционирование проводили на первичных культурах почки мыши и демонстрировали аналогичную картину локализации мембраны для эндогенного консиририна (фиг.4В, нижняя панель). Интерпретируя вместе, эти результаты фракционирования клеток обеспечивают сильные биохимические данные, свидетельствующие о том, что контагирин связан с клеточными мембранами.

Из-за слабого окрашивания эндогенного успокоирина в первичных и установленных клеточных культурах, успокаиватель был насильственно экспрессирован в клетках HeLa путем переходной трансфекции немаркированных и myc-tagged консиляриновых конструкций для дальнейших исследований иммунофлуоресцентной локализации. Как видно на фиг.5А, клетки, экспрессирующие немаркированный консиририн, имели сильное окрашивание в ядре и цитоплазме, картина очень похожа на субклеточную локализацию эндогенного успокоина, обнаруженного в клетках мыши. При более высоком увеличении многие из этих трансфецированных клеток проявляли четкое окрашивание спокойным пятном тонких проекций с поверхности клетки, а также ретикулярное окрашивание в цитоплазме, согласующееся с мембраной, нацеленной на плазматическую мембрану и ER (фиг.5С). Клетки, экспрессирующие C-myc-кауризин, имели большее различие в окрашивании, многие из которых проявляли заметную локализацию к ER и плазматической мембране и часто меньше окрашивали в ядре (фиг.5D). Двойное иммунофлуоресцентное окрашивание для кальретинулина, белка маркера ER и успокаирина показало, что в цитоплазме значительная часть успокаинистого колокализована с кальретинулином (данные не показаны), подтверждающие впечатление, что в этих трансфицированных клетках локализация паутирина включает, но не ограничивается ими, ER мембраны. Напротив, клетки, экспрессирующие N-myc-успокаирин, показали преобладающее ядерное окрашивание, более диффузное цитоплазматическое окрашивание и меньшее окрашивание на плазматической мембране, что было особенно заметно в низко экспрессирующих клетках (рис. 5 E). Это наблюдаемое уменьшение ассоциации мембран не было неожиданным, учитывая наш предыдущий вывод о том, что эта конструкция, помеченная NH2-терминально, не была миристолирована. Чтобы выяснить, связано ли яркое ядерное окрашивание с локализацией сатиририна в ядерной оболочке или во всей нуклеоплазме, мы дважды окрашивали клетки крыс HeLa дикого типа, которые были преобразованы в кариес, для успокаининов и ламинов A / C. Согласно конфокальной микроскопии, ламины A и C имели флуоресценцию обода (рис. 5 G) в соответствии с их известной локализацией в виде клетчатой ​​сетки нитей, привязанных к внутренней ядерной оболочке (см. Mical and Monteiro, 1998). В том же конфокальном Z-разрезе (1,0 мкм), где у ламинов была флуоресценция обода, во всей клетке присутствовала иммунореактивность капитирина и, очевидно, внутри нуклеоплазмы (фиг.5F). В целом, эти результаты указывают на то, что успокаины локализуются во многих различных клеточных компартментах, в соответствии с белком, обладающим свойствами динамического нацеливания. Особый интерес к этому исследованию представлял собой сравнение шаблонов окрашивания по шкапирину и PS2 при избыточной экспрессии в клетках HeLa. Хотя два окрашивающих шаблона частично перекрывались, особенно ретикулярное окрашивание ER с немаркированным и C-myc-каптарином, окрашивание PS2 было легко различимо по его эксклюзивной схеме окрашивания ER и ядерной оболочки (рис.5H).

Когда успокаирин был коэкспрессирован с помощью PS2, его окрашивающий рисунок был резко изменен, так что он почти колликализовался с PS2 (рис.6). Как показано в двух клетках, показанных на панелях А и В, белок-спаририн был менее заметен в ядре в коэкспрессирующих клетках, чем в клетках, трансфицированных исключительно с помощью успокаирина (фиг.5А). Еще одно указание на то, что эти два белка связываются друг с другом, было замечено в небольшом подмножестве клеток, где успокаирин и PS2 колокализуются отчетливо в необычных внутриядерных пятнах (фиг.6С). Внутриядерные пятна не колокализуются с антицентромерным окрашиванием с помощью двойной иммунофлюоресцентной микроскопии (данные не показаны), что указывает на то, что они отличаются от PS-иммунореактивных структур, наблюдаемых Li et al. (1997). Сдвиг в локализации лайтирина и почти одинаковые окрашивающие закономерности между PS2 и успокаином (см. Объединенные изображения) в этих сосуществующих клетках дают убедительные доказательства того, что эти два белка взаимодействуют in vivo. Кроме того, когда каустрин был подвергнут транскрипции с помощью конструкции PS2, удаленной из петли и всей ее последовательности COOH, окрашивающие структуры отображали значительно меньшее перекрытие; как видно из пятнистых агрегатов PS2, которые исключили спокойный (фиг.6D, обозначенный стрелками). Неудача этой конструкции удаления PS2 полностью колокализуется с успокаирином в агрегатах, что контрастирует с колокализацией белка PS2 дикого типа и успокаирином в ядерных включениях, что усиливает наше мнение о том, что область PS2-петли облегчает связывание успокаирина.

Несмотря на результаты двухгибридных анализов дрожжей, экспериментов по фракционированию клеток и гистологической колокализации, которые все последовательно аргументируют взаимодействие между успокаирином и PS2, наши первоначальные попытки продемонстрировать связывание двух белков in vitro оказались трудными. После пробы различных комбинаций аффинной хроматографии и иммунопреципитации с гибридными белками GST, трансформированных белков in vitro и экспрессированных клетками клеток HeLa в нескольких разных условиях буфера, два из этих экспериментов дали дополнительные доказательства связывания успокоидина и PS2. Во-первых, лизаты клеток HeLa сверхэкспрессированного PS2 инкубировали с очищенным GST-карипирином или GST только (показанным на фиг.3А), который ковалентно связывался с сефарозой. Затем две колонки Sepharose промывали и удерживание PS2 определяли путем иммуноблоттинга антителом против PS2. На фиг.7А показано, что GST-сатириновая сефароза связывает PS2 с примерно в три раза большим сродством (дорожка 4, см. Стрелку), чем контроль GST-связанной сефарозы (дорожка 3). Второй проверкой связывания была коиммунопреципитация миристоилированного белка консиририна из котрансфецированных лизатов клеток HeLa антителами против PS2 (фиг.7В, дорожка 5). Миристоилированный белок-стабирины не иммунопреципитировали, когда использовали преиммунную анти-PS2-сыворотку (фиг.7В, полоса 6), но, как и ожидалось, можно было иммунопреципитировать анти-успокаиновым антителом (фиг.7В, дорожка 4).

Поскольку мы ранее показывали, что избыточная экспрессия PS2 в клетках HeLa вызывает апоптоз (Janicki and Monteiro, 1997), мы хотели бы определить, какое влияние может оказать избыточная экспрессия успокоителя на жизнеспособность клеток. Для обнаружения апоптоза мы использовали антитело M30 CytoDEATH. Этот моноклональный мыши связывает эпитоп цитокератина 18, который обнажается только после расщепления каспазы, раннего события в апоптозе (Caulin et al., 1997; Boehringer Mannheim). В соответствии с нашими предыдущими выводами, на рисунке 8А показано, что подмножество (два из трех) клеток, сверхэкспрессирующих PS2, оказалось апоптотическим (особенно только округленным) в соответствии с как положительным окрашиванием CytoDEATH, так и конденсированными ядрами. Аналогичным образом, при избыточном экспрессию успокоителя наблюдался аналогичный апоптоз (рис.8B).

Котрансфекция PS2 и успокаирин вызывала еще более высокий апоптоз. Чтобы более четко продемонстрировать высокие уровни апоптоза, которые были вызваны сверхэкспрессией этих двух белков, приведены примеры изображений, полученных при малом увеличении. На фиг.8С показано, что через 16 ч после котрансфекции почти 13% клеток, экспрессирующих PS2 (которые предположительно также экспрессировали успокаирин, так как окрашивание PS2 и окрашивание с помощью остыририна показало близкое соотношение 1: 1 [данные не показаны]) на покровных были положительными для окрашивания CytoDEATH , К 40 ч доля апоптотических клеток увеличилась до ~ 50% от окрашенных PS2 клеток. Высокий уровень апоптоза, наблюдаемый на покровных стеклах, был поразительным, тем более, что этот метод только фиксировал короткое «окно» прогрессирования клеток в апоптоз, так как во время запрограммированной клеточной гибели клетки HeLa теряют сцепление с покровным стеклом и уплывают в среду. Это явление объясняет уменьшение общих клеток и, прежде всего, PS-экспрессирующих клеток (всего 10 клеток), оставшихся на покровном стекле через 40 ч после котрансфекции (фиг.8D). В примерах, показанных на фиг.8, только подмножество сверхэкспрессирующих клеток PS было апоптотическим, что указывает на зависящий от времени процесс, тогда как следствием того, что все апоптотические клетки также были сверхэкспрессорами, всегда считались истинными. В отличие от этого, когда контрольный белок, нейрофиламентный свет (NF-L) субъединица была сверхэкспрессирована в клетках HeLa (рис.8 E), был обнаружен минимальный апоптоз (<1%), а общее количество клеток и уровни экспрессии оставались высокими даже при 40 час Примечательно, что одиночная апоптотическая клетка в этом поле не окрашивалась для NF-L и что, наоборот, имеется несколько округленных и сильно экспрессирующих клеток (предположительно, в митозе), ни одна из которых не появилась апоптотической. Поля клеток, сверхэкспрессирующие успокаирин или PS2, индивидуально демонстрировали уровни апоптоза выше фоне нейрофиламента, но меньше, чем соэкструсоры. К сожалению, из-за различия между (и даже внутри) покровными стеклами этот метод не оказался подходящим для статистически значимой количественной оценки.

Поскольку маркировка CytoDEATH на покровных стеклах захватывала только узкое «окно» клеток, подвергающихся апоптозу, мы решили количественно определить общее количество гибели клеток, накопленное во времени, подсчитав общее количество плавающих клеток в среде после трансфекции различными количествами ДНК плазмид, кодирующей успокаирин и PS2. Этот простой метод был более надежным в количественной оценке гибели клеток. Как показано на рисунке 9, переходная сверхэкспрессия PS2 увеличивала гибель клеток дозозависимым образом, в то время как гибель клеток, вызванная избыточной экспрессией карипирина, достигала плато на 10 мкг трансфицированной ДНК. Более интересно, когда оба белка были коэкспрессированы в диапазоне линейной клеточной гибели их соответствующих ДНК, клеточная гибель увеличивалась в 5,9 раза по сравнению с контролем, по сравнению с 2,7 и 2,4 раза для тех же самых соответствующих трансфекционных количеств успокоирина и PS2 индивидуально, что указывало на то, что что эти два белка имеют аддитивные эффекты в развитии клеточной смерти. Когда эти плавающие клетки собирали и окрашивали антителом CytoDEATH, ~85% клеток окрашивали положительно для этого маркера апоптоза, что подтвердило нашу уверенность в том, что подсчет плавающих клеток является надежной мерой смерти клеток.

В этом исследовании мы демонстрируем по нескольким критериям, что белок PS2 человека взаимодействует с недавно обнаруженным кальцийсвязывающим белком, который мы называем успокаирином. Во-первых, успокаиватель взаимодействует с PS2-петлевой последовательностью в дрожжевых двухгибридных анализах. Во-вторых, два белка связываются друг с другом с помощью аффинной хроматографии и могут быть коиммуноосадки. В-третьих, два полноразмерных белка колокализуются, когда сосуществуют in vivo. Насколько нам известно, взаимодействие успокоина с PS2 также является первым, по нашему мнению, первым белком, который взаимодействует преимущественно с PS2 (по крайней мере, с помощью двухгибридного анализа дрожжей), предлагая различные функции для высоко гомологичных пресенилиновых белков.

Две линии доказательств благоприятствуют области PS2-петли в качестве критического участка взаимодействия каутиринов: уменьшалась in vivo colocalization, когда успокаирин был коэкспрессирован с недостаточной петлей конструкцией PS2 и увеличивал связывание жидкой культуры дрожжей с помощью успокаирина на PS2-петлю, а не на PS2 — COOH-терминальный домен. Анализ удаления показал, что связывание страринина опосредовано в первую очередь NH2-терминальными 31 аминокислотами PS2-петли. Примечательно, что, несмотря на только разницу в три аминокислоты, сравниваемая область петли PS1 взаимодействовала с менее чем одной десятой силы в аналогичных дрожжевых двухгибридных анализах. Site-направленный мутагенез, в котором три расходящихся остатка PS2 вводились поодиночке и в двойных комбинациях в PS1 указывали на то, что на самом деле все три аминокислоты приводят к различным изменениям специфичности успокаирина для PS2. Особенно интересным было выраженное увеличение связывания, обеспечиваемое конверсией треонина в положениях 281 и 291 в PS1 в пролин и аланин соответственно. Напротив, лейцин в положении 282 в PS1 при превращении в изолейцин, как и в PS2, вызывал pleotrophic эффекты, увеличиваясь, уменьшаясь и не вызывая никаких изменений во взаимодействии в зависимости от его контекста с остальными двумя остатками. Эти данные свидетельствуют о том, что незначительные изменения в последовательности петли PS индуцируют конформационные изменения в этом регионе с резкими последствиями для белково-белковых взаимодействий. Кроме того, область петли представляет собой сайт, связанный с несколькими явлениями PS-обработки, включая протеолитическое расщепление, расщепление каспазы, а также аномальное сращивание (Perez-Tur et al., 1995; Thinakaran et al., 1996; Kim et al., 1997). , Loetscher et al., 1997; рассмотрено Hass, 1997). Было обнаружено, что наряду с успокаином несколько других белков взаимодействуют с PS-петлей, а именно: γ-catenin, filamin, calselinin, mu-calpain и armadillo protein p007 (Zhou et al., 1997; Buxbaum 1998; Murayama et al. ., 1998; Shinozaki et al., 1998; Zhang et al., 1998; Stahl et al., 1999). Наши данные, свидетельствующие о том, что незначительные (одиночные аминокислоты) изменения в последовательности циклов могут приводить к резким изменениям в связывании белка, не только имеют последствия с точки зрения функции успокоения, но также могут иметь важные последствия для других событий обработки и связывающих партнеров, связанных с этим регионом , Поэтому неудивительно, что многие мутации FAD соответствуют петле PS1.

В дополнение к важности белково-белковых взаимодействий для локализации наши исследования по иммунофлуоресцентной микроскопии и биохимическому фракционированию показывают, что миристолирование консиририна важно для динамического нацеливания этого белка на несколько субклеточных отделений, включая: цитоплазму, длинные выступы плазматической мембраны , и нуклеоплазма. Элегантные исследования регенера, миристоилированного кальция-связывающего белка, участвующего в передаче сигналов в сетчатку, установили, что этот белок чередуется между конформациями, в которых миристиловая группа подвергается воздействию или секвестрируется, конформации, которые зависят от связывания кальция (Kennedy et al., 1996) Ames et al., 1997). Эти кальций-миристоильные переключатели являются известным механизмом нацеливания белка и трансдукции сигнала. Радиолокационные и биохимические исследования показывают, что успокаирин является миристоилированным и связан с мембранами. В настоящее время мы не можем четко разделить роли, которые играют миристолирование и белково-белковые взаимодействия в in vivo, нацеленном на успокаивание на мембраны. Фактически, наши данные свидетельствуют о том, что оба они важны. Дрожжевые двухгибридные анализы с петлевыми конструкциями, содержащими сайт-направленные мутации, ясно показывают важность белково-белковых взаимодействий в опосредовании ассоциации между успокаирином и интегральным мембранным белком PS2. Кроме того, ожидается, что слияние Gal4-кислотной последовательности блоха на NH2-конце конъютирина в дрожжевых двухгибридных клонах предотвратит эту модификацию жирной кислоты, предполагая, что миристолирование не является существенным для взаимодействия. Как это ни парадоксально, однако, это миристилоидная форма успокаирина, которую мы смогли показать coimmunoprecipated с PS2. Возможно, введение миристоильной группы в липидный бислой инициирует конформационное изменение, которое улучшает сродство успокогорина для PS2. Аналогично, Gal4-кислотный blob, возможно, сохранил успокаирин в конформации, которая была более склонна к связыванию PS2.

Клетки, сверхэкспрессирующие белки-стиририны, способные к миристолированию, проявляли большую вариацию в окрашивании, часто с увеличением направленности успокоения на цитоплазму и плазматическую мембрану, предполагая, что миристолирование может быть вовлечено в это динамическое поведение. У успокаирина, который локализовался в цитоплазме, был ретикулярный окрашивающий образец, который колокализуется с окрашиванием PS2, когда два белка коэкспрессируются. Мы полагаем, что ретикулярное окрашивание представляет собой нацеливание белкового белка на ER, поскольку мы и другие показали, что сверхэкспрессированный PS2 локализуется в ядерной оболочке и ER (см. Kovacs et al., 1996; Janicki and Monteiro, 1997). Интересно, что в клетках, зараженных PS2-котрансфецитом, в ядре присутствовало относительно небольшое количество кауририна, а вместо этого вся популяция почти полностью колокализовалась PS2 в ER. Это перераспределение в ER согласуется с стехиометрическим изменением сайтов связывания, доступных для успокаирина, когда PS2 был сверхэкспрессирован. Однако нельзя исключать возможность того, что экспрессия PS2 может изменить обработку или внутриклеточное таргетирование успокаинителя.

Поскольку известно, что миристоилирование важно для мембранного нацеливания, любопытно, что в нуклеоплазме присутствует значительный пул успокоинов, несмотря на отсутствие классического сигнала ядерной локализации. Кальмирин достаточно мал, чтобы пассивно диффундировать через ядерные поры (белки ~65 кД и более должны активно переноситься) и могут быть секвестрированы внутри нуклеоплазмы путем связывания с ядерными резидентными белками, такими как ДНК-PKcs, который также, как было показано, связывает дрожжевых двухгибридных анализов (Wu and Lieber, 1997). Локализация успокоителя к длинным проекциям плазматической мембраны может аналогичным образом представлять собой связывание с другим известным взаимодействующим сайтурином, αIIb-субъединицей интегрина. Эти результаты указывают на то, что успокаирин может распространяться между несколькими белками и факторами, что указывает на роль успокаирина в сложных сигнальных процессах. Как эти процессы связаны с AD, и / или апоптоз неизвестен, но интересно, что Volado, новый интегрин, который динамически опосредует клеточную адгезию и трансдукцию сигнала, недавно был идентифицирован как новый мутант памяти у Drosophila (Grotewiel et al., 1998) ). Также ДНК-PKcs является единственной известной эукариотической протеинкиназой, активированной двунитевыми разрывами ДНК, которая является поражением, индуцированным во время апоптоза (см. McConnell and Dynan, 1996; Sheih et al., 1997). Возможность того, что успокаины, интегрины, ДНК-PKcs и PS2 каким-либо образом связаны или вовлечены в болезни человека, является интригующей, но спекулятивной.

При гипотезе о физиологической роли взаимодействия между PS2 и консирином мы особенно заинтересованы в изучении участия кальция и апоптоза. Следует отметить, что калсенилин, еще один белок Ca2 + -связывающий с сходством последовательностей с регенерином, связывается с COOH-терминальной областью пресенилиновых белков и подобно перераспределению паутинов с пресенилиновыми белками в котрансфецированных клетках (Buxbaum, et al., 1998). Кальмирин не обладает высокой степенью сходства аминокислот с калсенилином, вместо этого белковая последовательность успокогорина наиболее гомологична человеческому кальциневрину В, регуляторной субъединице Ca2 + -каммодулин-зависимой протеинфосфатазы 2В, которая играет важную роль в стрессе, апоптозе , сигнализация клеток кальция и трансдукция сигналов (см. Guerini, 1997; Crabtree, 1999; Wang et al., 1999). Наибольшая гомология встречается в областях, окружающих кальцинейрин B, с четырьмя кальцийсвязывающими моделями EF и его сайтом миристолирования на NH2-терминале. Несмотря на то, что эти регионы относительно хорошо сохраняются, общая схожесть составляет 44%, у каждых двух функциональных EF-рук у каждых двух функциональных EF-рук есть два вставки, которые, как прогнозируется, нарушают связывание кальция. Naik et al. (1997) продемонстрировали, что успокаирин действительно может связывать кальций, но неизвестно, регулирует ли это свойство фосфатазную активность. Если успокаинист ведет себя аналогично кальциневрину В в регуляции фосфатазы, он может иметь некоторое отношение к AD, где есть предположение, что образование PHF и гиперфосфорилирование тау происходит из-за неправильной регуляции белковых фосфатаз или киназ (Matsuo et al., 1994; Gong et al., 1996; Kayyali et al., 1997).

Наши данные о гибели клеток указывают на то, что связывание успокаирина с PS2 может быть связано с функцией PS2 при апоптозе. В предыдущем исследовании мы обнаружили, что избыточная экспрессия PS2 в клетках HeLa индуцирует апоптоз. Нынешний вывод о том, что коэкспрессия успокогорина с пресенилинами в клетках HeLa увеличивает апоптоз, предполагает, что они действуют сообща на пути или пути, регулирующие гибель клеток. Хотя мы не определили путь, через который эти два белка функционируют во время запрограммированной гибели клеток, тот факт, что конситурин является кальцийсвязывающим белком (Naik et al., 1997), вызывает некоторые очевидные возможности. Во-первых, успокойрин может «ощущать» Ca2 + изменения и впоследствии регулировать функцию PS2. Альтернативно, белки PS2 (включая мутанты FAD) могут изменять гомеостаз кальция, что приводит к изменению связывания кальция с помощью успокаирина, который затем может инициировать каскад трансдукции сигнала. Эта последняя возможность является привлекательной, поскольку показано, что избыточная экспрессия пресенилинов вызывает нарушения в гомеостазе кальция (Guo et al., 1996; Keller et al., 1998). Интересно, что экран спасения апоптоза, в котором был выделен фрагмент PS2 ALG3 (см. Введение), дал другую кДНК под названием ALG2, которая вызывала антисмысловое ингибирование кальция-связывающего белка (Vito et al., 1996). Однако, когда ALG2 экспрессировали в чувственной ориентации, этот индуцированный кальцием белок индуцировал апоптоз (Lacana et al., 1997). Можно утверждать, что коэкспрессия любого кальцийсвязывающего белка с пресенилинами вызовет повышенную гибель клеток. Это явно не так, поскольку сверхэкспрессия другого кальцийсвязывающего белка, calbindin D28k, подавляла проапоптотические функции PS (Guo et al., 1998). Дисбаланс в регуляции кальция может быть катастрофическим для клетки из-за центральной роли кальция в клеточных процессах, включая его участие в индукционной фазе апоптоза (см. McConkey and Orrenius, 1997).

Хотя есть некоторые разногласия относительно того, связано ли AD с нарушением регуляции кальция (см. Etcheberrigaray et al., 1998), консенсус исследований (мнений) свидетельствует о таком дефекте. Неопределенность частично усложняется отсутствием надежных и легких методов измерения внутриклеточного кальция, не говоря уже о сравнении их у разных людей. Тем не менее, многочисленные исследования показали, что уровни кальция изменяются в клетках, культивируемых у пациентов с АД, особенно тех, которые содержат (или трансфицируют) гены пресенилина, содержащие мутации, связанные с FAD (Ito et al., 1994; Gibson et al., 1997; Mattson et al., 1998).

Таким образом, наши результаты показывают, что тирепирин, связывающий кальций миристоилированный белок, может играть динамичную и разнообразную роль во внутриклеточной передаче сигналов, и мы предлагаем, чтобы это было важно при модуляции функции пресенилина. Понимание сложного взаимодействия между регуляцией кальция, апоптотической сигнализацией и белково-белковыми взаимодействиями, без сомнения, поможет в расшифровке механизмов, посредством которых функция пресенилинов, которая в свою очередь могла бы дать представление о патогенезе болезни Альцгеймера.

Мы хотели бы поблагодарить доктора Роджера Брент (Гарвардская медицинская школа) за любезное предоставление дрожжевых двухгибридных реагентов и Дженнифер Уильямс за отличную техническую помощь в экспериментах по аффинной хроматографии. Мы благодарим доктора Энн Плуту и ​​Алекса Маха за критические замечания по рукописи.

Эта работа финансировалась частично за счет гранта от Национального института здоровья AG11386 до М. Дж. Монтейру.

Болезнь Альцгеймера

семейный AD

множественная ткань северная

нейрофиламентный свет

нейрофибриллярные сплетения

пресенилин

трансмембранные домены

Пресенилинские контурные конструкции и их взаимодействие с успокаирином. (A) Обобщена общая топология множественного трансмембранного белка пресенилина и представлена ​​последовательность аминокислотной последовательности петлевого региона между PS1 и PS2. В качестве приманки в ловушке взаимодействия использовались первые 50 аминокислот контура B2, обозначенного петлей PS2 (большая пунктирная линия). В цикле исследования связывания с жидкостным анализом B дополнительно подразделяли на консервативную область (петля C, сплошная линия) и более расходящаяся область (петля D, небольшая пунктирная линия). Коробки заключают одинаковые (темные оттенки) и аналогичные (светлые оттенки) остатки. (B и C) Результаты анализа двух гибридных жидкостей дрожжей с использованием приманки, описанной в (A), изображены со стандартными ошибками.

Кальмириновая аминокислотная последовательность и экспрессионная картина транскрипта. (A) Полная аминокислотная последовательность успокаирина показана по сравнению с человеческим кальцинейрином B. Две сохраненные кальций-связывающие руки EF обведены кружком, а две руки EF, которые нарушены в спокойном состоянии, отмечены пунктирной линией. (B) Клетки ДНК с множественной тканью в организме человека и (C) нон-блоттинговую ткань с множественными тканями человека сначала были исследованы с помощью 32P-меченой кДНК капитирина, лишенной и впоследствии исследованной с 32P-меченной β-актиновой кДНК в качестве контроля. Полоса гибридизации ~1,2 кб соответствует ожидаемому размеру транскрипта для успокоения.

Экспрессия и очистка белка GST / бутиририна, характеристика анти-успокаивающих антител и обнаружение эндогенных белков консиририна. (A) Голубой окрашенный кумасси, документирующий индукцию и очистку GST (дорожки 1-3) и GST / каллирин (дорожки 5-7). Отображаются неиндуцированный бактериальный лизат (дорожки 1 и 5), индуцированный лизат (полосы 2 и 6), белки с аффинной очисткой глутатион-агарозой (дорожки 3 и 7) и маркеры молекулярной массы (4). Очищенный слитый белок ~45-kD GST / капитирина, показанный на дорожке 7, инокулировали кроликам для получения поликлональных антител. (B) Иммуноблот клеточных лизатов HeLa, зондированных кроличьей анти-успокаиновой сывороткой. Клетки HeLa трансфицировали C-myc-успокаином (дорожка 2), N-myc-капирином (дорожка 3) и тирепином дикого типа (дорожка 4) или были ложно трансфицированы (дорожка 1). Анти-успокаиновые антитела реагируют с полипептидами соответствующего размера только в трансфицированных капсирином клетках. Обратите внимание на отсутствие неспецифического фонового окрашивания и невозможность обнаружить какой-либо эндогенный капсирин в клетках HeLa при этом воздействии. (C) Иммуноблот лизата человеческого мозга, загружаемый при 100 мкг общего белка и зондированный кроличьей анти-кариминовой сывороткой. Пожалуйста, обратите внимание, что эндогенный кауризин в мозге мигрирует в виде белка 22 кД. (D) Иммуноблот из различных тканей мыши, загружаемых на 100 мкг общего белка и прощупанный антисатуридином для определения эндогенных уровней успокогорина. (E) Иммунофлуоресцентная локализация эндогенного успокаирина в культуре первичных клеток сердца мыши указывает, что этот белок находится в ядре и во всей цитоплазме. Бар, 5 мкм.

Иммунопреципитация миристоилированного каутирина и локализация калмырина до мембранной фракции. (A) Флюорография миристоилированных белков, иммунопреципитированных кроличьим анти-карипирином из клеток HeLa после трансфекции с помощью N-myc-успокаирина (дорожка 1 и 2), C-myc-капитирина (дорожка 3 и 4) или диализата дикого типа (дорожка 5 и 6) и 24 ч инкубации с 3Н-миристиновой кислотой. Показаны образцы лизатов клеток (L) и иммунопреципитации (IP). Миристоилированная полоса спокойствия присутствует в дорожках 4 и 6 (обозначена стрелками), но отсутствует на полосе 2. Нижняя панель показывает иммуноблот из супернатантов (S) и иммунопреципитантов (IP) этих же трансфицированных клеточных лизатов, чтобы подтвердить уровень экспрессии и успешное иммунопреципитация успокогорина. (B) Иммуноблоттинг экспрессирующих карицин экспрессирующих липиды клеток HeLa для ламинов A и C (68 и 66 кД) и каллирина (22 кД) после фракционирования в отсутствие (-) детергента (дорожки 1 и 2) или в присутствии (+ ) 1% Triton X-100 (дорожка 3 и 4) в растворимый супернатант (S) и нерастворимый осадок (P). Нижняя панель показывает идентичное фракционирование эндогенного успокаирина в культуре первичных клеток почки мыши.

Иммунофлуоресцентная локализация белкового белка в трансфицированных клетках HeLa. (A и B). Поле двух клеток, трансфецированных диализом дикого типа и окрашенных анти-успокаирином (A) и DAPI (B), показало, что антитело к каритину является специфическим, поскольку нижняя правая нетрансфицированная клетка (см. Стрелку) имеет яркую DAPI окрашенное ядро, но не имеет окрашивания флуоресцеином-паутирином. В клетке, сверхэкспрессирующей успокаирин, белок локализуется в ядре и цитоплазме. Обратите внимание, что в ядре накопление успокоинителя близко напоминает окрашивание хроматина DAPI. (C) Крупный план из клетки, экспрессирующей успокаирин, чтобы выделить локализацию успокоителя к проекциям плазматической мембраны. (D) Схема окрашивания флуоресцеином клеток, сверхэкспрессирующих C-myc-капитирин, несколько отличается от (A) с меньшим количеством белка в ядре. (E) Контрастно, N-myc-белок-стабилинер накапливается преимущественно в ядре и вызывает более диффузное цитоплазматическое окрашивание. (F и G) Конфокальные изображения клетки, сверхэкспрессирующей диализный тирепирин и окрашенные антисатурином (F) и антиламинами (G), указывают на то, что локализация сатурарина не ограничивается ядерной оболочкой. (H) Также показан пример шаблона окрашивания ER сверхэкспрессированного PS2. Бар, 5 мкм.

Иммунофлуоресцентная колокализация успокогорина с PS2 в трансфецированных клетках HeLa. (A-C) клетки HeLa, котрансфицированные с использованием дикого типа и катионов PS2, окрашивали через 24 часа после трансфекции анти-успокаивающим антибиотиком кроликов и козами против PS2. Зеленые (левые панели) представляют собой флуоресцеин с маркированным консиририном, красный (центральные панели) представляет собой родамин с маркировкой PS2, а желтый (правые панели) представляет собой объединенное изображение, указывающее, что флуоресцеин и родаминовые сигналы колокализуются. Как иллюстрируется тремя выделенными клетками, когда коэкспрессированный консиририн показывает образец локализации, почти идентичный PS2. В то время как большинство котрансфецированных клеток показывают окрашивающий образец, согласующийся с локализацией ER (A и B), небольшое подмножество клеток, как представляется, колокализует успокаирин и PS2 в пунктирных внутриядерных агрегатах (C). (D). Аналогичное окрашивание клеток HeLa, котрансфицированных диализным тирепирином и петлевым / COOH-удаленным PS2, обнаруживает пятнистые агрегаты (см. Стрелки) PS2 (красный), которые исключают каримин (зеленый). Бар, 5 мкм.

Аффинная хроматография и коиммунопреципитация являются дополнительными доказательствами связывания между каримином и PS2. (A) Иммуноблот экспрессирующих PS2 лизатов клеток HeLa (L), которые были очищены аффинностью (AP) по сравнению с GST-сефарозой или GST / капсирин-сефарозой, зондированной козьим анти-PS2. Трансфицированный PS2 лизат (1), нетрансфицированная аффинность лизата, очищенная над GST-сефарозой (2), трансфицированная PS2 аффинность лизата, очищенная над GST-сефарозой (3), и трансфицированная PS2 аффинность лизата, очищенная над GST / капирин-сефарозой (4), показаны , Стрелка указывает полосу PS2, которая появляется в три раза более интенсивной в дорожке 4, чем на дорожке 3. (B) Флюорография миристоилированных белков, иммунопреципитированных кроличьим антисатурином (дорожки 1 и 4), кроличьи анти-PS2 (дорожки 2 и 5 ), или прелиммунную сыворотку кролика (дорожки 3 и 6) из C-myc-капиринина и PS2-котрансфецированных клеток HeLa, инкубированных в течение 24 ч с 3H-миристиновой кислотой. Показаны супернатанты (S) и иммунопреципитаты (IP). Стрелки указывают более выраженную миристоилированную полосу спокойного ряда в дорожках 4 и 5 по сравнению с контрольной дорожкой 6.

Иммунофлуоресцентное окрашивание CytoDEATH указывает на то, что избыточная экспрессия PS2 и успокаирин увеличивает апоптоз клеток HeLa. (A) Примерное поле четырех ячеек показывает, что две из трех клеток, сверхэкспрессирующие PS2, являются апоптотическими в соответствии с положительным окрашиванием и конденсированными ядрами CytoDEATH. (B) Аналогичным образом, поле примера из восьми клеток показывает, что обе клетки, которые сверхэкспрессируют успокаирин, также проявляют апоптоз. (C) 10 × поле клеток каритирина и PS2, прошедших трансплантацию через 16 часов. Полные клетки в поле обозначены окрашиванием DAPI, экспрессирующие клетки помечены антителом против PS2 (окрашивание для присутствия PS2 и кауритина в котрансфицированных клетках показало близкое соотношение 1: 1 между сверхэкспрессией этих двух белков) и апоптоз клетки детектируют с помощью антитела против цитокератина 18 CytoDEATH. Обратите внимание на наличие> 30 апоптотических клеток, которые также окрашиваются положительно для экспрессии PS2. (D) 10 × поле консинаринов и PS2 cotransfected клеток через 40 часов. Обратите внимание на уменьшение общего количества клеток и более низкий процент клеток, экспрессирующих PS2, в этот более поздний момент времени. (E) 10 × поле контролируемых нейрофиламент-трансфицированных клеток через 40 часов. Обратите внимание, что даже в этот более поздний момент времени остается высокий процент антинейрофиламентных положительных клеток, тогда как в отличие от него может быть обнаружена только одна апоптотическая клетка CytoDEATH.

Количественная оценка гибели клеток из-за избыточной экспрессии PS2 и успокаирин. Плавающие клетки из повторяющихся пластинок клеток HeLa, трансфицированных в общей сложности 15 мкг ДНК, содержащего контрольный вектор, увеличивали количество успокогорина, увеличивающихся количеств PS2, или как успокаирин, так и PS2, собирали через 48 часов. Количество плавающих ячеек на блюдо, превышающее фоновые количества фокусов трансфекции, отображается с указанием стандартных ошибок.

Комментариев нет.

Добавить комментарий

Ваш e-mail не будет опубликован. Обязательные поля помечены *