Нажмите "Enter", чтобы перейти к контенту

Повышенный апоптоз, возникающий из-за увеличения экспрессии мутации пресенилина-2, связанной с болезнью Альцгеймера (N141I)

Increased Apoptosis Arising from Increased Expression of the Alzheimer's Disease–associated Presenilin-2 Mutation (N141I)
Источник: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2139804/

Мутации в генах для пресенилина 1 и 2 (PS-1 и PS-2) были связаны с развитием ранней болезни Альцгеймера (AD). Поскольку ни нормальная функция ни пресенилина не известна, ни почему мутации вызывают заболевание, мы исследовали свойства дикого типа, усеченного и мутантного PS-2 после экспрессии в клетках HeLa. Хотя клетки HeLa сильно предрасположены к продолжению митоза, экспрессия вызванной PS-2 запрограммированной гибели клеток (апоптоз). Прямые доказательства апоптоза были получены двойным окрашиванием для терминальной терминации терминальной дезоксинуклеотидной трансферазы (TUNEL) и экспрессии PS-2 и с последующим обозначением PS-2 с зеленым флуоресцентным белком с течением времени. Анализ удаления показывает, что всего лишь 166 NH2-концевых остатков PS-2 достаточны для локализации эндоплазматического ретикулума (ER) и апоптоза. Кроме того, AD-ассоциированная мутантная PS-2 (N141I) более эффективно индуцировала клеточную гибель по сравнению с PS-2 дикого типа, несмотря на низкое накопление мутантного белка. Экспрессия пресенилинов в нескольких других клеточных линиях и трансгенных мышах сопровождалась быстрым расщеплением белка без индукции гибели клеток. Напротив, PS-2, экспрессируемый в клетках HeLa, не был расщеплен, и произошла клеточная смерть. Мы предполагаем, что полноразмерный, но не расщепленный PS-2 может быть важным в регуляции или индукции апоптоза.

Болезнь Альцгеймера (AD) 1 является нейродегенеративным расстройством, проявляющимся с увеличением заболеваемости стареющей популяцией. Клинически это характеризуется потерей памяти и снижением когнитивных функций. Семейные исследования, особенно в ранних случаях, указывают на молекулярную гетерогенность и связывают AD с мутациями по меньшей мере в трех генах: ген белка-предшественника β-амилоида (βAPP), расположенный на хромосоме 21 (для обзора см. Mullan and Crawford, 1993) и гены пресенилина 1 и 2 (PS-1 и PS-2 соответственно), расположенные на хромосоме 14 и 1 соответственно (Alzheimer’s Collaborative Group, 1995; Campion et al., 1995; Chapman et al., 1995; Cruts et al. ., 1995; Levy-Lahad et al., 1995a
, Б; Perez-Tur et al., 1995; Rogaev et al., 1995; Sherrington et al., 1995; Wasco et al., 1995; Boteva et al., 1996). Кроме того, имеются данные о том, что приобретение аллеля аполипопротеина E типа 4 (APOE-E4) на хромосоме 19 предрасполагает людей к раннему началу AD (Corder et al., 1993; Strittmatter and Roses, 1995).

Мутации в βAPP составляют ~ 5% семейных случаев (~19 семейств) с шестью различными одиночными или двойными missense мутациями, описанными до сих пор (обзор см. Haass et al., 1995; Van Broeckhoven, 1995). Большая доля семейных пациентов с АД (50-70% всех случаев> 50 семейств) имеет мутации в гене PS-1, который, как было показано, является горячей точкой для missense-мутаций, поскольку было выявлено более 35 различных мутаций до сих пор (обзор см. Cruts et al., 1996; Haass, 1997). Интересно, что возраст возникновения AD несколько коррелирует с расположением мутаций в кодирующих областях PS-1 (обзор см. Cruts et al., 1996). Меньшее число случаев AD связаны с мутациями в PS-2, поскольку в восьми семьях, главным образом из волжско-немецкого происхождения, описаны только две мутации missense (Levy-Lahad et al., 1995a
, Б; Rogaev et al., 1995), и последние данные показывают, что по крайней мере одна из этих мутаций является переменно проникающей (Sherrington et al., 1996).

PS-1 и PS-2 очень гомологичны путем сравнения последовательностей с самыми высокими степенями изменчивости, происходящими в амино- и карбоксил-концевых областях. Хотя функция этих белков неизвестна, они разделяют гомологию с двумя белками Caenorhabditis elegans. Пресенилины ~ 50% гомологичны Sel-12, который участвует в клеточной передаче сигналов рецепторами Notch, и они демонстрируют ограниченную гомологию SPE-4, которая функционирует в сперматогенезе (Levitan and Greenwald, 1995; Levy-Lahad et al. ., 1995; Sherrington et al., 1995). Свидетельства, свидетельствующие о том, что эти предполагаемые гомологи C. elegans действительно могут быть связаны с пресенилинами млекопитающих, — это кажущаяся способность вводить кДНК PS-1 и PS-2 человека для функционального спасения мутантов C. elegans Sel-12, дефектных в развитии вульвы и укладке яиц ( Levitan et al., 1996). Дополнительные свидетельства, свидетельствующие о вовлечении PS в развитие, — это недавние сообщения, свидетельствующие о нарушении молекулярного расщепления гена PS-1 вскоре после рождения с эмбрионами, которые обнаруживают дефекты центральной нервной системы, а также аномальное паттернирование осевого скелета и спинномозговых ганглиев (Shen et al., 1997). , Wong et al., 1997).

Оба гена пресенилина повсеместно экспрессируются с дифференциальным накоплением двух основных транскриптов мРНК (Li et al., 1995; Rogaev et al., 1995; Sherrington et al., 1995; Lee et al., 1996; Vito et al., 1996a
, Б). Иммунофлуоресцентное окрашивание пресенилинов, помеченных эпитопом, указывает на то, что белки локализованы в ER и Golgi, хотя были отмечены тонкие различия в локализации между PS-1 и PS-2 (Cook et al., 1996; Kovacs et al., 1996; Walter et al., 1996). Пресенилины представляют собой многопроходные трансмембранные белки, которые, как считается, топологически переплетаются через мембраны ER 6-8 раз с доменами NH2- и COOH-терминалов и большой «петлей», охватывающей предполагаемые шестой и седьмой трансмембранные домены (TMD) (по некоторым моделям ), содержащихся в цитоплазме (см. рис.1, Doan et al., 1996; Li and Greenwald, 1996; Lehmann et al., 1997). Недавние исследования экспрессии PS-1 у фибробластов и трансгенных мышей указывают на то, что PS-1 протеолитически расщепляется, поскольку 27-28-кД-NH2-концевые и 16-17-КД-СООН-концевые производные накапливаются в клеточных лизатах (Lee et al., 1996) Thinakaran et al., 1996). Сообщается также о аналогичном протеолитическом расщеплении PS-2 (Kim et al., 1997; Tomita et al., 1997). Функция протеолитического расщепления пресенилинов неизвестна.

Для изучения функции пресенилинов мы клонировали и выражали дикие, мутантные и удаленные формы PS-2 человека в клетках HeLa, клеточной линии человека, обычно резистентной к апоптозу. Наши исследования показывают, что сверхэкспрессия PS-2 в клетках HeLa влияет на морфологию ядра и вызывает гибель клеток. Кроме того, мы показываем, что 166 NH2-концевых остатков PS-2 достаточны для локализации ER и для индуцирования гибели клеток. Самое интересное, мы демонстрируем, что AD-ассоциированная мутация PS-2 (N141I) индуцирует увеличение гибели клеток HeLa клеток по сравнению с PS-2 дикого типа.

КДНК PS-2 была получена из библиотеки кДНК, готовой к магатону человеческого мозга (CLONTECH Laboratories, Inc., Palo Alto, CA) с помощью ПЦР-амплификации с использованием двух праймеров, 5′-концевого праймера (5’ATCGATAAGCTTCGCGAGTGTTCGTGGTGCTTCCAGAGGCA3), из которых 25 основания 3′-конца праймера были идентичны кодирующей цепочке шести оснований PS-2 человека перед стартовым кодоном АТГ и 3′-концевым праймером (5’GGAAGAATTCGTCGACGCAGCCTGTGGCACACCATGTCCC3), из которых 24 основания 3 ‘ конец были комплементарны последовательностям, расположенным сразу после стоп-кодона PS-2. Реакцию ПЦР проводили в соответствии с инструкциями производителя. Был получен крупный продукт ПЦР ~ 1,4-kbp, охватывающий всю кодирующую последовательность PS-2. Продукт ПЦР расщепляли EcoRI, так как этот сайт был сконструирован в 3’-концевой праймер, и полученный продукт ~ 1,4-kbp лигировали в плазмиду pBluescript KS (-), которая ранее расщеплялась EcoRV и EcoRI. Рекомбинантная плазмида была полностью секвенирована и, как было установлено, соответствует PS-2 человека без какой-либо из известных мутаций AD (Levy-Lahad et al., 1995a
; Rogaev et al., 1995).

Для экспрессии PS-2 в клетках человека полноразмерные PS-2 и четыре постепенно уменьшающиеся COOH-концевые делеции клонировали в экспрессирующий вектор pGEM, так что кДНК PS-2 помещали в соответствующую ориентацию для экспрессии из сильного цитомегаловируса ( CMV) (фиг.1). Экспрессионная плазмида pGEM CMV была построена из pCMV-NF-L (Lee et al., 1993; любезно предоставлена ​​доктором Майклом Ли, Университет Джона Хопкинса, Балтимор, штат Мэриленд), сначала уничтожив самый 5′-сайт EcoRI в вектор стандартными молекулярными методами. Затем продукт дважды расщепляли EagI, который расщеплял только 3 ‘промотора CMV в N-L 5′-нетранслируемых последовательностях (см. Monteiro et al., 1994) и HindIII, который расположен на 3’-конце NF -L-фрагмент (Lee et al., 1993). Затем посредством серии стадий клонирования фрагмент EagI-HindIII из pNF (+ La / head), содержащий последовательности ламина 5 ‘, 12 кодонов myc-последовательности и всю область NF-L 3’ (Monteiro et al., 1994) был введен в вектор экспрессии ЦМВ. Затем эту плазмиду дважды переваривали с помощью SacII, который был расположен 3 ‘сайта EagI в 5′-нетранслируемой последовательности ламина A вместе с SalI, который расщепл ет 5’ myc-последовательностей. Фрагменты PS-2, расщепленные SacII и SalI, впоследствии лигировали в этот вектор экспрессии CMV.

Для экспрессии полноразмерного PS-2, помеченного myc-эпитопом, кДНК PS-2 была амплифицирована ПЦР с помощью праймеров, которые вводили сайт SacII выше по течению от ATG и сайта SalI на 3′-конце, что устраняло стоп-кодон и слитый белок к myc-последовательности (описанный в Monteiro et al., 1994). 5′-концевой праймер, 5’ACGTACGTAACCGCGGGTTCGTGGTGCTTCCAG3 ‘, содержал сайт SacII, за которым последовали 17 оснований на его 3’-конце, которые были идентичны последовательности кодирующей цепи PS-2 со сходством начала 10 bp выше по течению от стартового кодона ATG , 3-концевой ПЦР-праймер 5’TATCGCTTAAGTCGACGATGTAGAGCTGATGGG3 ‘содержал 17 оснований, комплементарных последовательностям, расположенным непосредственно перед стоп-кодоном PS-2, и ему предшествовал сайт рестрикции SalI. ПЦР-продукт ~ 1,4 п.о.с дважды переваривали SacII и SalI и лигировали в вектор pGEM CMV (фиг.1
С).

Чтобы выразить полноразмерный PS-2 (кодирование 448 аминокислот [aa];
A), который не был отмечен myc, PS-2, клонированный в Bluescript и pPS-2 + Myc, каждый дважды переваривался NotI и EcoRI. NotI разрезает кодон 111 PS-2, тогда как сайт EcoRI расположен ниже по потоку от стоп-кодона в обеих плазмидах. 3′-концевой фрагмент PS-2, который был лишен myc-последовательностей и получен из вектора Bluescript, использовался для замены соответствующего myc-tagged фрагмента в pPS-2 + Myc.

Для создания конструкций PS-2 с постепенно более длинными удалениями COOH-терминалов ранее описанный 5′-праймер, содержащий сайт SacII, использовали в сочетании с 3′-праймерами, предназначенными для введения SalI-сайтов в ген PS-2, что позволило усеченным белкам myc помечен.

3′-праймер 5’TATCGCTTAAGTCGACCAGCACAGCCACGAGAT3 ‘, содержащий 17 оснований, гомологичных и комплементарных последовательностям перед кодоном 268, использовали для создания конструкции pPS-2 (268aa) + Myc, используя, по существу, ту же самую процедуру, которая была ранее описана для конструкции pPS-2- Мой с. Эта конструкция удаляется из 180 COOH-концевых остатков сразу 3 ‘шестого предполагаемого TMD, тем самым удаляя большую гидрофильную петлю и все COOH-концевые последовательности (фиг.1
D).

По аналогичной процедуре ПЦР 226 остатков от COOH-конца PS-2 удаляли с использованием 3′-праймера 5’TATCGCTTAAGTCGACCTTCCAGTGGATGCACA3 ‘, который содержал 17 оснований, гомологичных и комплементарных последовательностям перед кодоном 222. Полученная конструкция pPS-2 ( 222aa) + Myc удаляется из последовательностей PS-2, начиная с трех остатков после TMD 4 (фиг.1)
E).

Аналогично, праймер 5’TATCGCTTAAGTCGACCTTGATGCAGCGGTACT3, из которых последние 17 оснований были гомологичными и комплементарными последовательностям перед кодоном 166 PS-2, удалили 282 aa, начиная с шести остатков после TMD2 (фиг.1)
F).

Primer 5’ACGTACGTAAGTCGACGGAGTTGAGGAGGCGCT3 ‘, из которых последние 17 оснований были гомологичны и комплементарны последовательностям перед кодоном 138 PS-2, аналогичным образом использовали для удаления 310 COOH-концевых остатков PS-2, включая TMD2 (фиг.1)
Г).

Чтобы контролировать экспрессию PS-2 в живых клетках, PS-2 клонировали в вектор экспрессии pEGFP-C1 CLONTECH, таким образом, сплавляя PS-2 с концом COOH Aequorea victoria GFP. Для генерации этого клона использовали 5′-праймер 5’TCCGGACTCAGATCTCTCACATTCATGGCCTCT3 ‘, из которых последние 18 п.о. были идентичны последовательностям, начиная с кодона 2 PS-2, использовали в комбинации с 3′-праймером 5’TATCGCTTAAGTCGACGATGTAGAGCTGATGGG3′ (описано выше), к ПЦР амплифицировать клон PS-2 в Bluescript. Продукт ~ 1,4-kbp расщепляли BglII, который вводили 5’-концевым праймером и HindIII, который внутренне разрушал PS-2. Затем фрагмент ~1-kbp лигировали между сайтами BglII-HindIII pEGFP-C1. Рекомбинантный pGFP-PS-2 (Δ86), отсутствующий 86 COOH-концевых остатков PS-2, затем расщепляли HindIII и EcoRI, последний срезанный 3 ‘из первого. В сочетании PS-2 в Bluescript расщепляли теми же ферментами, а фрагмент, содержащий 3’-кодирующие последовательности PS-2, лигировали с фрагментом плазмиды pGFP-PS-2 (Δ86). Полученный рекомбинант дает pGFP-PS-2, соответствующий полноразмерному PS-2 (отсутствует только исходный метиониновый остаток), слитый в рамочный COOH-терминал GFP (фиг.1
ЧАС).

Была добавлена ​​еще одна гибридная конструкция GFP-PS-2, чтобы выразить мутацию PS-2 (Asn141Ile), ассоциированную с AD (Levy-Lahad et al., 1995a
; Rogaev et al., 1995). Кодинус аспарагина в положении 141 в PS-2 превращался в изолейцин с помощью двухступенчатого протокола амплификации ПЦР. На первой стадии 5′-часть PS-2 амплифицировали с использованием 5′-BglII-содержащего праймера, описанного выше, в сочетании с 3′-праймером 5’CGTAACGCGAATTCAGGAGGCGCTGGCCCACC3 ‘. Оставшийся сегмент PS-2 3 ‘амплифицировали с помощью 5′-праймера, 5’TCAAGCTTGAATTCCGTGCTGATCACCCTCATCATGATCA3′ и праймера 3’-конца PS-2, описанного первоначально. Оба продукта ПЦР разрезали с помощью EcoRI, который вводили новыми праймерами, а сегменты, связанные в рамке с GFP, получали pGFP-PS-2 (N141I) (фиг.1
Я). Этот и другие клоны, которые были созданы с помощью ПЦР, были секвенированы и были найдены для кодирования ожидаемых изменений.

Чтобы выразить полноразмерный PS-2, содержащий мутацию, связанную с AD, PS-2 (N141I), которая не была отмечена GFP и myc-последовательностями (фиг.1
B) фрагмент XmaI-HindIII из pPS-2, охватывающий кодон Asn у 141 PS-2 дикого типа, был заменен соответствующим фрагментом, содержащим мутацию из pGFP-PS-2 (N141I) с получением pPS-2 (N141I ) (Рисунок 1
Б).

Библиотеку кДНК мозга эмбриона человека (CLONTECH Laboratories, Inc.) подвергали скринингу с помощью гибридизации ДНК с субфрагментом EcoRV-EcoRI с концентрацией 1,5 кБа KV1.4 кДНК человеческого калиевого канала сердца (любезно предоставленным доктором М. Тамкуном, Университетом Вандербильта, Нэшвилл , TN). Один положительный клон, содержащий кДНК 3,023 п.о., был полностью секвенирован и имел открытую рамку считывания из 653 аминокислот, которая была гомологична калиевому каналу Kv1.4 (Tamkun et al., 1991). Через серию шагов клонирования кДНК вводили в модифицированную конструкцию экспрессии CMV, описанную выше, так что кДНК сливалась внутри кадра в кодоне 653 его открытой рамки считывания с тегом myc для выражения. Трансфекция этой конструкции в клетки HeLa и электрофизиологические записи с использованием метода клеточного клеточного клеща выявила классическую активацию и кинетику инактивации калиевого канала A-типа.

Три различные части PS-2, NH2-терминал, петля, охватывающая TMD 6 и 7, и COOH-концевые области (см. Фиг.1), были выражены как слитые белки GST в бактериях. Для экспрессии последовательностей NH2-терминалов PS-2 сегмент, кодирующий первые 86 остатков PS-2, был амплифицирован ПЦР с помощью 5′-праймера CGTACGTCGAATTCCCAATGCTCACATTCATGGC, который вводил EcoRI-сайт и пролин-кодон одну аминокислоту перед PS- 2 начальный кодон и 33 bp 3′-праймер, GCTGAGTACGCTCGAGCTTCGCTCCGTATTTGA, который вводил сайт XhoI после остатка 86. Аналогичным образом сегмент, кодирующий 120 аминокислот петлевой последовательности от остатка 270 до остатка 389, был амплифицирован ПЦР с помощью 5 ‘ праймера, CGCTTCTGGAATTCCCCAAAGGGCCTCTGAG, который вводил сайт EcoRI перед остатком 270 и 3’-праймер GCTGAGTACGCTCGAGCAGCGTGGTATTCCAGT, который вводил сайт XhoI после остатка 389.

Концевой сегмент COOH, кодирующий последние 39 остатков PS-2, амплифицировали с помощью 5′-праймера на 28 п.о. CGGTACGTGAATTCAAGAAGGCGCTGCC, который вводил сайт EcoRI перед остатком 410 и ранее описанный 3′-праймер, используемый для введения сайта SalI в конец полноразмерного PS2 для myc.

Целевые продукты PCR ~260-bp NH2 и 360 ППР и вектор Pharmacia pGST / His T1 (Pharmacia Biotech, Inc., Piscataway, NJ) были все расщеплены EcoRI и XhoI. Контрастный ПЦР-фрагмент размером ~ 120 п.о. разрезали с помощью EcoRI и SalI. Все фрагменты были лигированы в pGST / His T1 с вставкой COOH-терминала, разрушающей сайт XhoI. Эти лигации приводили к слиянию последовательностей PS-2 COOH-терминалов и в рамке с GST. Полученные рекомбинантные плазмиды трансформировали в бактерии CAG456 (Mercy et al., 1992) и выращивали в течение ночи при 30 o C в 30 мл стандартного бульона Luria, содержащего 50 мкг ампициллина на мл. Затем культуры разбавляли в 500 мл свежей среды и выращивали еще в течение 2 часов. Затем IPTG добавляли к 0,1 мМ, а культуры выращивали в течение 3-4 часов. Бактерии собирали центрифугированием в течение 30 мин при 3000 г и ресуспендировали в 1/10 об. Охлажденном 50 мМ Трис, pH 7,5, 10% -ном растворе сахарозы. Следующие шаги были сделаны на льду: лизоцим добавляли до 0,2 мг / мл и оставляли на 20 мин с периодическим перемешиванием, затем ЭДТА до 5 мМ, от НП-40 до 0,1% и саркозилом до 0,25%. После 10-минутной инкубации на льду лизированные бактерии обрабатывали ультразвуком и центрифугировали при 4 ° С в течение 30 мин при 30 000 г. Осадок удаляли и растворимые бактериальные белки инкубировали в течение 17 ч на качалке с набухшими и уравновешенными гранулами глутатион-агарозы (Sigma Chemical Co., St. Louis, MO). Суспензию центрифугировали при 3000 г в течение 5 мин, супернатант удаляли и осадок агарозы промывали в охлажденном PBS пять или шесть раз. Сгущающие белки GST элюировали в партии с четырьмя последовательными элюирования объема 10 мМ восстановленного глутатиона в 50 мМ Трис, рН 8. Элюированные фракции диализовали в 50 мМ Трис, рН 7,5, 10% сахарозы и 5 мМ ЭДТА. Очищенные белки и растворимые фракции вместе с растворимыми фракциями бактерий, индуцированных IPTG, кипятили в буфере Laemmli и разделяли SDS-PAGE. Очищенные фракции белка также использовались в экспериментах по блокированию антител.

Клетки HeLa выращивали в DME с добавлением 10% FBS (Monteiro and Mical, 1996). Экспоненциально растущие клетки трансфицировали 10-20 мкг плазмидных ДНК в виде осадка фосфата кальция (Graham and van der Eb, 1973).

Для иммунофлуоресцентной микроскопии клетки трансфицировали непосредственно на покровные стекла. В разное время после трансфекции покровные стекла фиксировали в 1% параформальдегиде на льду в течение 15 мин, а затем погружали в 70% -ный этанол -20 ° С в течение 20 мин или в течение ночи. Клетки на покровных стеклах регидратировали в PBS, блокировали в 0,8% BSA, окрашивали первичными и вторичными антителами и, наконец, окрашивали 1 мкг / мл 4’6-диамидино-2-фенилиндола (DAPI), как описано ранее (Monteiro et al. ., 1994). В качестве первичных антител использовали мышиное моноклональное антитело против myc 9E10 (Monteiro et al., 1994), козливое поликлональное антитело против PS-2, сгенерированное с использованием пептида 20 аа, соответствующего NH2-концевым последовательностям для PS-2 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), кроличьего поликлонального анти-GFP-антитела (CLONTECH Laboratories, Inc.), кролик-поликлональный антикреретинулин (StressGen, Victoria, Canada) и кроличьего поликлонального антиламина антитела, продуцированного против очищенных бактериально выраженных человеческий ламин C. Для экспериментов по конкуренции антитело-лиганд антитело козьего анти-PS-2, разведенное 1: 150, инкубировали в течение ночи с равными молярными количествами (~ 250 мкг) либо бактериально очищенного белка GST, либо GST-NH2-терминальный PS- 2 перед применением к трансфецированным покровным стеклам. В качестве вторичных антител использовались аффинно очищенные флуоресцеин- или родамин-конъюгированные кроличьи антимыши, кролик-коза, осел-анти-кролик, осел-анти-коза, козьи антимышиные и козье антитела к кролику (Jackson ImmunoResearch Laboratories, Inc. , West Grove, PA). Флуоресцентные окрашивающие и фазовые контрастные изображения клеток визуализировались на инвертированном микроскопе Zeiss Axiovert 135 (Thornwood, NY). Изображения были сняты либо на 35-мм профессиональном фильме TMAX 400 (Eastman Kodak Corp., Rochester, NY), либо с использованием системы Image Explorer II, включающей камеру Dage MTI CCD72 и захват кадров вместе с программным обеспечением IPLab Spectrum (Signal Analytics Corp., Вена, VA) на Power Macintosh (Apple Computer Co., Cupertino, CA).

Клетки HeLa, покрытые сетчатыми покровными стеклами (Eppendorf, Milwaukee, WI), трансфицировали GFP-экспрессирующими конструкциями и в разное время после трансфекции покровные стекла промывали стерильным PBS, а флуоресценцию GFP визуализировали с использованием набора FITC-фильтра 10 (Carl Zeiss , Inc.). Изображения флуоресценции и фазового контраста трансфицированных клеток в тех же сетчатых областях были захвачены 17, 41 и 65 ч после трансфекции с использованием камеры-исследователя изображения II. После анализа изображений PBS заменяли свежей средой DMEM, и покровные стекла быстро возвращали в инкубатор CO2.

В альтернативной процедуре гибель клеток определяли количественно путем подсчета числа плавающих клеток, которые накапливались через 20 и 44 ч после трансфекции. Для этого анализа клетки 1-1,5 × 105 HeLa, выращенные в чашках 100 мм, трансфицировали либо 15 или 20 мкг ДНК различных экспрессирующих конструкций PS-2. Через 20 ч после трансфекции среду собирали из каждого блюда, а в посуду добавляли свежую среду. Количество плавающих клеток в среде, полученной через 20 и 44 ч после трансфекции, подсчитывали с использованием гемацитометра. Число плавающих апоптотических клеток (из которых 50-60% не смогли исключить трипановый синий — не нетипичный для апоптозных клеток, так как потеря целостности мембраны происходит очень поздно во время апоптоза) и не включая митотические клетки (отличающиеся наличием метафазных пластинок) в трансфицированные PS-2 блюда были нормированы на количество найденных в ложно трансфицированных блюдах.

Клетки лизировали в 0,5% -ном буфере для лизиса SDS, содержащем ингибиторы протеазы (Monteiro and Mical, 1996), и некипящие лизаты анализировали на 8,5 и 10% гелях SDS-PAGE (Laemmli, 1970). Гели калибровали электрофорезом известных стандартов молекулярной массы; кроличьи мышцы миозина (205 кД), β-галактозидаза Escherichia coli (116 кД), фосфорилаза B кролика (97,4 кДа), бычий альбумин (66 кД), яичный альбумин (45 кД) и карбоангидраза (29 кД) (Sigma Chemical Co.). Фракционированные белки переносили на 0,1 мкм нитроцеллюлозные мембраны (Schleicher & Schuell, Keene, NH) путем электроблоттинга, а иммуноблоты обрабатывали, как описано ранее (Xiao and Monteiro, 1994).

Трансфектированные клетки анализировали на апоптоз с использованием набора обнаружения in situ Apop Tag (Oncor, Inc., Gaithersburg, MD), по существу, как описано изготовителем. Клетки HeLa, трансфецированные на покровные стекла, фиксировали в 1% параформальдегиде на льду в течение 15 мин, переносили в 0,5% Тритон в PBS в течение 3 мин и помещали в 70% этанол -20 ° С в течение 20 мин. Клетки на покровных стеклах регидратировали двумя инкубациями с PBS в течение 5 минут каждый, а затем переносили в увлажненную камеру и покрывали уравновешивающим буфером (комплект Oncor S7110) в течение 5 мин, после чего буфер заменяли терминальным дезоксинуклеотидным трансферазой фермента рабочей силы , Камеру, содержащую покровные стекла, помещали в инкубатор с температурой 37 ° С, и через 3,5 часа покровные стекла погружали в буфер для останова / промывки в течение 0,5 часа и промывали тремя изменениями PBS в течение 3 мин каждый. Рабочую силу антигидогенин-флуоресцеина применяли в течение 0,5 ч, и клетки снова промывали сначала 1% тритона в PBS в течение 3 мин и еще дважды в PBS в течение 5 мин каждый. Покровные стекла затем контрастировали с моноклональным антителом myc с последующим конъюгированием с родамином козьим антимышиным антителом, как описано выше.

Для исследования функции PS-2 полноразмерные PS-2 и прогрессирующие COOH-терминальные усечения, помеченные на их COOH-конце с myc-эпитопом и под контролем транскрипции промотора CMV (фиг.1), были экспрессированы в клетках HeLa с помощью переходных процессов трансфекции. Иммуноблот-анализ белковых лизатов, полученных из клеток, трансфецированных либо myc-tagged, либо невзвешенным полноразмерным PS-2, содержал иммунореактивные полосы ~50-54 кД при зондировании поликлональным антителом, специфичным для последовательностей NH2-терминального PS-2 (фиг.2
C, дорожки 2 и 4 соответственно), которые не были обнаружены в ложно-трансфицированных лизатах (фиг.2
C, дорожки 1 и 3). PS-2-антитело распознает слитые белки GST, содержащие NH2-терминальные, но не петлевые или COOH-концевые PS-2 последовательности (фиг.2, A и B). Удаление PS-2, в котором удалены остатки COOH-терминала 180, 226 и 282 (см. Фиг.1 и материалы и методы), мигрировали в виде дублетных полос в гелях SDS-PAGE (что видно при более коротком воздействии авторадиографов, данные не показаны) с кажущимися молекулярными размерами ~ 35-37, 33-35 и 31-33 кД соответственно (фиг.2)
C, дорожки 4-7). Помимо этих полос, более крупные иммунореактивные комплексы обычно наблюдались в трансфицированных PS-2 клетках, но не в клетках, подвергнутых трансплантации, и представляли собой димеры, тримеры и комплексы высших молекулярных масс белков PS-2 (фиг.2
C, дорожки 4-7, маленькие наконечники стрел). Мы не наблюдали какого-либо значительного протеолитического расщепления выраженных PS-2 продуктов, как было ранее сообщено (Kim et al., 1997; Tomita et al., 1997). Фактически, иммуноблот-анализы параллельного геля, зондированного с myc-антителом, который распознал конец COOH PS-2, содержали полосы, идентичные по размеру, с признаками антител против NH2-терминального PS-2, что указывает на полномасштабное накопление различных полипептидов PS-2 с присутствием как NH2-, так и СООН-концевых эпитопов (сравните фиг.2
C, дорожки 3-7, с фиг.2
D, полосы 1-5). Мик-реактивные полосы PS-2 четко отличались от эндогенных полос ~35 и 65 кДа, присутствующих во всех лизатах клеток HeLa (фиг.2
D, небольшая стрелка).

Иммунофлуоресцентное окрашивание клеток HeLa, временно трансфицированных полноразмерным myc-tagged PS-2 (pPS-2 + Myc), отображало ядерную оболочку и окрашивание ER при зондировании либо антителами против NH2-терминального PS-2, либо myc (фиг.3 , А и В). Фактически, была полная колокализация при двойном окрашивании двумя антителами, подтверждающая данные иммуноблота за отсутствие расщепления и отделение эпитопов NH2- и COOH-терминалов PS-2. Специфика этого двойного окрашивания была продемонстрирована путем предварительной инкубации NH2-концевого антитела PS-2 с очищенным слитым белком GST-PS-2 NH2 (показанным на фиг.2
A, дорожка 6), которая практически полностью прекратила окрашивание NH2-терминалов PS-2, но окрашивание Myc было сохранено (соответственно, фиг.3, C и D). Чтобы подтвердить, что PS-2 был локализован в ER, мы дважды окрашивали трансфицированные клетки для кальретинулина, кальций-связывающего белка, который локализуется в ER (Opas et al., 1991), и для PS-2 с использованием NH2-концевого антитела , Полноразмерные myc-tagged PS-2, а также три делеционные конструкции, в которых были удалены 180, 226 и 282 COOH-концевые остатки PS-2, показали колокализацию с калькретинулином (фиг.3, E-H и данные не показано). Напротив, конструкция pPS-2 (138aa) + Myc, удаленная из 310 COOH-концевых остатков, включая TMD2, не показала колокализацию с кальретинулином (фиг.3, I и J). Эти результаты показали, что 166 NH2-концевых остатков PS-2 достаточны для таргетирования ER. Поскольку pPS-2 (138aa) + Myc не правильно локализовался в ER, он не изучался дальше.

Очевидным следствием увеличения синтеза PS-2 в трансфицированных клетках HeLa было развитие аномальных ядерных морфологий. Изучение окрашивания PS-2, окрашивания ДНК и фазовых контрастных изображений клеток, экспрессирующих полноразмерный PS-2 + myc и три мутанта делеции PS-2 через 24 ч после трансфекции, ясно показало, что экспрессия PS-2 приводит к аномальному изменения формы ядер (рис.4, A-F и данные не показаны). Например, на фиг.4
A, две положительно окрашенные PS-2-трансфицированные клетки имеют конденсированные и усеченные ядра по сравнению с нетрансфицированными клетками в одном и том же поле. Интересно, что изменение ядерной морфологии, по-видимому, коррелировало с количеством белка PS-2, выраженным в результате различий в интенсивности окрашивания. Эти особенности последовательно наблюдались в клетках с сверхэкспрессией PS-2, но не в мак-трансфицированных контролях и клетках HeLa, трансфицированных кДНК ламина или калиевого канала (фиг.4, G-I). Поэтому явные изменения в ядерной морфологии были связаны не только с избыточной экспрессией белка, нацеленного на ядерную оболочку, как в случае с ламинами или трансмембранного белка, так как канал Kv1.4 имеет почти такое же количество трансмембранных доменов и имеет общая топология с общей топологией пресенилинов (см. рис.1).

Скорость, с которой явные изменения стали очевидными, зависела от конструкции: pPS-2 + Myc, pPS-2 (268aa) + Myc и pPS-2 (222aa) + Myc все вызывали более быстрые изменения, чем pPS-2 (166aa) + Myc-трансфицированные клетки. Это зависящее от времени изменение ядерной морфологии коррелировало с увеличением числа плавающих мертвых клеток в среде. Количественная оценка скорости гибели клеток, вызванной различными конструкциями PS-2 20 и 44 ч после трансфекции, показала, что клетки pPS-2 + Myc, pPS-2 (268aa) + Myc и pPS-2 (222aa) + Myc убивают аналогичные показатели (рис.5
А). Напротив, в клетках, трансфицированных PS-2 (166aa) + Myc, эта скорость снижалась ~ 70% через 20 ч после трансфекции, но через 44 часа она ускорялась и приближалась к другим конструкциям (рис.5
А).

Поразительные изменения, наблюдаемые в клетках, трансфицированных PS-2, напоминают ядерные и морфологические изменения, которые происходят во время запрограммированной гибели клеток или апоптоза (Wyllie, 1980; Earnshaw, 1995). Чтобы исследовать, действительно ли клетки действительно умирали от апоптоза, мы использовали анализ концевой дезоксинуклеотидной трансферазной метки (TUNEL) для идентификации апоптотических клеток. Клетки HeLa, трансфицированные pPS-2 (166aa) + Myc, предложили необычную возможность определить, могут ли предполагаемые умирающие клетки маркироваться TUNEL, поскольку они проявлялись и отображали морфологические признаки апоптоза в течение длительного периода времени, а экспрессируемые клетки, прилипшие к покровным до 40 ч после трансфекции. Напротив, мы не смогли клетки лейкоцитов TUNEL, трансфицированных полноразмерным PS-2, так как большая часть трансфецированных клеток была снята с покровных клеток на 18-24 ч после трансфекции, вероятно, из-за более быстрой смертности и множественного этапы стирки, используемые в анализе TUNEL.

На фиг.6, A-D показан типичный пример PS-2 (166aa) + Myc-трансфицированных клеток, в которых TUNEL-положительная маркировка (фиг.6
B) коррелирует с экспрессией PS-2 (фиг.6
А). Интересно отметить, что только сильно сконденсированные ядра округленных кустарниковых клеток, которые, похоже, отрываются от покровного стекла (видно на фазовом контрастном изображении;
D, наконечники стрел). Даже PS-2-позитивная клетка с несколькими уплотненными агрегатами ДНК, наблюдаемая окрашиванием DAPI (фиг.6
C), не был помечен TUNEL, что указывает на то, что это более ранняя стадия апоптоза, в ходе которой было создано несколько свободных ДНК 3′-концов или доступно для маркировки. В дополнение к расщеплению ДНК другой особенностью клеток, подвергающихся апоптозу, является коллапс ядерной оболочки и расщепление ламиновых белков (Kaufmann, 1989; Ucker et al., 1992; Oberhammer et al., 1994; Lazebnik et al., 1995; Rao et al., 1996). Поэтому мы исследовали целостность ядерной пластинки в pPS-2 (166aa + Myc-трансфицированные клетки с использованием антитела, специфичного для ламинов A / C (фиг.6, E-H). В клетках, экспрессирующих PS-2, ядерная пластинка действительно был разрушен, но был круглым и, по-видимому, нормальным в PS-2-отрицательных клетках. В некоторых клетках, экспрессирующих PS, ядерная пластинка была диффузной, что указывало на расщепление ядерных ламинов во время апоптоза.

Чтобы непосредственно наблюдать за временем пути апоптоза, мы сгенерировали слитые белки GFP, в которых PS-2 сливался в рамку с концом COOH GFP. Изучались две различные конструкции. Первым был pGFP-PS-2, в котором PS-2 дикого типа был связан с GFP. Второй был pGFP-PS-2 (N141I), содержащий AD-ассоциированную мутацию PS-2 у кодона 141, превращая аспарагин в изолейцин (Levy-Lahad et al., 1995a)
; Rogaev et al., 1995). Иммуноблот-анализ трансфицированных лизатов клеток HeLa показал, что слитые белки GFP-PS-2 мигрируют на SDS-PAGE в виде полипептидов ~80 кД (фиг.2
E), что соответствует слиянию 27 кД последовательностей GFP с 50-55 кД PS-2. Не было доказательств какого-либо протеолитического расщепления слитых белков. Кроме того, обе слитые белки GFP-PS-2 отображали классическую локализацию ER и ядерной оболочки при исследовании методом прямой флуоресцентной микроскопии (фиг.7, A и B), что указывает на то, что слияние GFP с PS-2 не заметно меняет нормальную локализацию ER образ PS-2.

Ячейки HeLa, выращенные на покровных покровных сетках, трансфицировали вектором GFP без какой-либо вставки или с конструкциями слияния GFP-PS-2, а эффекты на жизнеспособность клеток изучались с течением времени. Изображения клеток на разных покровных участках регистрировались через 17 ч после трансфекции, а те же самые области (идентифицированные по меток сетки на покровных стеклах) были пересмотрены через 41 и 65 ч после трансфекции (примеры таких полей показаны на фиг.7
Б). Количество флуоресцирующих клеток, наблюдавшихся через 41 и 65 ч после трансфекции, нормализовалось до количества клеток в течение 17 часов. Как показано на фиг.5
B, количество клеток, экспрессирующих GFP, увеличилось на ~ 15% после 41 ч и до 158% через 65 ч. Первоначальное увеличение на 41 час, вероятно, было вызвано либо делением клеток трансфицированных клеток (цикл клеток HeLa ~23 ч, Monteiro и Mical, 1996), и / или увеличение экспрессии GFP в клетках, ранее оцениваемых как неэкспрессоры. Меньшее увеличение в 65 часов, вероятно, связано с потерей кратковременной экспрессии GFP при длительном росте. Резко контрастируя, жизнеспособность клеток резко снижалась в клетках, экспрессирующих слитые белки GFP-PS-2. Через 41 ч после трансфекции жизнеспособность клеток уменьшилась до ~76% в клетках, экспрессирующих слитые белки PS-2 дикого типа, и уменьшилась еще до 33% на 65 ч. Аналогичное резкое снижение жизнеспособности клеток наблюдалось в клетках, экспрессирующих мутацию PS-2 (N141I) с жизнеспособностью, снижающейся до 74% в 41 час и 38% через 65 часов. В обоих случаях снижение жизнеспособности клеток коррелировало с появлением многочисленных округленных кустарниковых клеток в более поздние моменты времени, что согласуется с гибелью клеток апоптозом. Однако тщательное сравнение жизнеспособности клеток в шести группах независимых экспериментов и анализе более 2000 клеток не показало существенной разницы в скорости выживания клеток между слитыми белками дикого типа и мутантом PS-2 GFP в клетках HeLa (фиг.5
Б).

Временная потеря флуоресценции GFP могла быть результатом потери временной экспрессии или потери клеток из покровных тканей из-за смерти. Чтобы проверить эти и другие возможности, мы следили за отдельными GFP-экспрессирующими клетками в течение определенного периода времени. Типичный пример этого анализа показан на фиг.8, где, по-видимому, видно, что, по меньшей мере, три группы клеток, прикрепленных к метке сетки № 2 покровного стекла, выражают слитый белок GFP-PS-2 флуоресценцией при 22 час Через 50 ч эти же клетки, которые сохраняли некоторую остаточную флуоресценцию, были округлены и имели усохшие цитоплазмы, типичные для умирающих клеток.

Отсутствие заметной разницы в скорости выживания клеток между PS-2 дикого типа и мутацией, ассоциированной с AD, изучалось как гибридные белки GFP, могло быть результатом маскирования GFP-фрагмента или вмешательства в свойства PS-2. Таким образом, мутант дикого типа и AD PS-2 экспрессировали и изучали как белки нефузии в клетках HeLa путем переходной трансфекции эквивалентных количеств ДНК. Измерение мертвых плавающих клеток через 40 ч после трансфекции показало, что мутант убивает клетки в 1,84 раза быстрее, чем у PS-2 дикого типа (фиг.5
С). Поскольку клетки умирали с разной скоростью, было трудно нормализовать эффективность трансфекции с использованием несвязанных репортеров. Однако мутант может быть значительно более токсичным, чем было оценено в наших экспериментах, если менее мутантная ДНК была трансфецирована, поскольку иммуноблоттинг эквивалентных белков лизатов, полученных из параллельных наборов трансфекций через 20 ч после трансфекции, показал, что мутант должен быть выражен ~ 25%, что уровни белка дикого типа (рис.1
F).

Представленные здесь доказательства показывают, что принудительная экспрессия PS-2 в клетках HeLa сама по себе является достаточной для индуцирования апоптоза и что AD-ассоциированная мутация N141I индуцирует увеличение гибели клеток. Первоначально считалось, что PS-2 может ингибировать апоптоз, потому что COOH-концевой фрагмент мышиного PS-2, называемый ALG-3, спасет Т-клетки от вызванной рецептором запрограммированной гибели клеток (Vito et al., 1996a
). В последнее время причиной такого спасения является артефактное следствие экспрессии фрагмента PS-2, так что он действует в доминирующей негативной форме (Vito et al., 1996b
). Дальнейшие доказательства, подтверждающие участие PS-2 в апоптозе, были получены при экспрессии в клетках PC12 как дикого типа, так и мутантного PS-2 (N141I), которые были вызваны внешними стимулами для апоптоза (Deng et al., 1996; Wolozin et al., 1996). Экспрессия PS-2 ускоряла смерть в этих клетках, а мутант PS-2 (N141I) увеличивал апоптоз, но только в клетках, выращенных в определенных условиях культуры (Wolozin et al., 1996). Исследования PC12 показали лишь слабые доказательства апоптотического свойства PS-2, поскольку клетки были загрунтованы, чтобы подвергнуться апоптозу внешними агентами. Кроме того, клетки PC12 сбалансированы при самоубийственном решении и особенно восприимчивы к индукции апоптоза с помощью широкого спектра стимулов. Наши результаты, свидетельствующие об апоптотической индукции в клетках HeLa, дают убедительные и независимые доказательства апоптотического свойства PS-2, поскольку клетки HeLa обычно очень устойчивы к апоптозу.

Механизмы, с помощью которых избыточная экспрессия PS-2 приводит к гибели клеток апоптозом, не раскрываются нашими исследованиями. Хотя пресенилины повсеместно экспрессируются, PS-2 экспрессируется на значительно более низких уровнях, чем PS-1 (Rogaev et al., 1995; Sherrington et al., 1995; Li et al., 1995; Lee et al., 1996). Возможно, в нормальных клетках экспрессия одного или обоих пресенилинов модулируется другими факторами, которые регулируют приверженность пути смерти клеток. Предположительно, в переходных трансфекциях увеличение экспрессии PS-2 приводит к нарушению этой регуляции в пользу апоптотического пути.

Хотя PS-1 очень гомологичен PS-2, в клеточных линиях и трансгенных мышах, сверхэкспрессирующих PS-1, не было зарегистрировано повышенного апоптоза (Duff et al., 1996; Kovacs et al., 1996; Thinakaran et al., 1996) , Хотя простейшим объяснением является то, что PS-1 может функционировать по-разному от PS-2, другая возможность заключается в том, что трансгенные линии, сверхэкспрессирующие PS-1, могут вызывать компенсаторные изменения экспрессии антиапоптотических генов. Другая вероятная возможность заключается в том, что протеолитическое расщепление белков PS значительно изменяет их свойства. Большинство предшествующих отчетов показали избыточную экспрессию PS-белков в клеточных линиях и трансгенных мышах с целью получения в основном протеолитических продуктов. Однако в наших экспериментах мы не наблюдали значительного расщепления (<5-10%) экспрессированных белков PS-2, включая те, которые содержали полноразмерные PS-2 последовательности. Исходя из этих наблюдений, мы предлагаем, чтобы протеолитическое расщепление пресенилинов уменьшало апоптотические эффекты полноразмерных белков. Усечения PS менее токсичны, чем полноразмерные белки, поддерживаются более высокими уровнями усеченных белков, которые накапливаются с увеличением длины усечений COOH-терминалов (см. Рис. 2, C и D).

Связанная с AD мутация PS-2, превращающая аргинин в изолейцин в кодоне 141, вызывала увеличение апоптоза в клетках, сверхэкспрессирующих мутантный белок. Несмотря на накопление до более низких уровней белка, чем белок дикого типа, мутант более токсичен. Представленные здесь результаты удаления показали, что для апоптоза необходимы удерживание NH2-терминальных PS-2-последовательностей. Неудивительно, что слияние GFP с NH2-концом PS-2 маскирует эти различия.

Ясно, что если дифференциальный эффект убийства полноразмерного дикого типа и мутантного PS-2 имеет отношение к заболеванию, он должен проявляться в нейронах, которые подвержены риску в AD. Предположение о том, что апоптоз может быть вовлечен в AD, подтверждается увеличением накопления белка, стимулирующего смерть, Bax, а также увеличением доказательств фрагментации ядерной ДНК в случаях AD, но не в контроле (Su et al., 1997). Кроме того, недавние сообщения показывают, что мутации AD в βAPP также могут индуцировать апоптоз при экспрессии в нейронных клетках и что смерть опосредуется гетеротримерными гуанозинтрифосфатсвязывающими белками (G-белки, Yamatsuji et al., 1996). Интересно, что у пациентов с ФАД с мутациями в генах пресенилина и трансгенных мышах, экспрессирующих мутантные гены PS человека, повышенные уровни пептидов Aβ42-43 (Duff et al., 1996; Scheuner et al., 1996; Borchelt et al., 1996; Tomita et al. ., 1997), которые были документированы для индукции апоптоза (LaFerla et al., 1995). Очевидные последствия всего этого в том, что missense мутации в presenilins производят тонкие эффекты, которые увеличивают апоптоз в течение периода жизни нейронов.

Мы с благодарностью признаем помощь Weihong Zha и Meredith Hopkins в построении конструкций PS-2 Bluescript и pGFP-PS-2 (Δ86aa), соответственно. Мы благодарим доктора Энн Плуту и ​​доброжелательный рецензент журнала Journal of Cell Biology за проницательные комментарии к рукописи.

Эта работа была частично поддержана грантом Национального института по проблемам старения М. Дж. Монтейру.

Обращайтесь со всей корреспонденцией к Мервину Дж. Монтейру, к.т.н., Институту биотехнологии Университета штата Мэриленд, номер N352, 725 West Lombard Street, Балтимор, MD 21201. Тел .: (410) 706-8132. Факс: (410) 706-1732.

аминокислоты)

Болезнь Альцгеймера

ген белка-предшественника β-амилоида

вирус цитомегалии

4’6-диамидино-2-фенилиндол

глутатион-S-трансферазы

пресенилин 1 и 2

трансмембранный домен

Схематические чертежи конструкций экспрессии PS-2. Показана предполагаемая структура PS-2. Схема с соответствующим чертежом линии иллюстрирует PS-2 с восемью TMD (с номерами 1-8). NH2-, COOH-терминал и большие гидрофильные петлевые области присутствуют на цитоплазматической стороне ER-мембраны. (A-I) PS-2, используемые в этом исследовании. Показаны некоторые сайты рестрикции, используемые для клонирования. Транскрипция всех конструкций проводилась промотором CMV. Иллюстрируются конструкции, которые были отмечены с помощью myc- или GFP. Конструкции B и I содержат AD-ассоциированную мутацию PS-2 (N141I). Конструкция J представляет собой линейный рисунок кДНК калийного канала Kv1.4 человека, который использовался в качестве контроля, поскольку он аналогичен по топологии (схематично показан) PS-2.

Иммуноблот-анализ белков PS-2. (A и B) PS-2 NH2-концевые, петлевые и COOH-концевые последовательности экспрессировали в виде слитых белков GST и разделяли SDS-PAGE на 8,5% полиакриламидных гелях. Отделенные белки либо окрашивали синим кумасси (А), либо переносили на нитроцеллюлозные фильтры и иммуноблоттировали с помощью PS-2 NH2-концевого антитела (В). Дорожки 1-4 представляют собой цельные клеточные лизаты бактерий, индуцированные для экспрессии слитых белков GST добавлением IPTG, а полосы 5-8 представляют собой соответствующие очищенные слитые белки GST. Слитые белки GST, которые были выражены, следующие: полосы 1 и 5, только GST; полосы 2 и 6, GST-NH2-терминальный слитый белок; полосы 3 и 7, гибридный белок GST-петли; и дорожки 4 и 8, слитый белок GST-COOH. Стрелки указывают положение полноразмерных белков слияния GST. (C-F). Лизаты белков трансфицированных клеток HeLa, разделенных SDS-PAGE, на 8,5% гелей и иммуноблоттированные антителами, которые распознают трансфецированные белки. (C) Иммуноблот с анти-PS-2-специфическим антителом. Дорожки 1-7 представляют собой лизаты клеток, трансфицированных следующими конструкциями: Lanes 1 и 3, mock-transfected cells; полоса 2, pPS-2; дорожка 4, pPS-2 + Myc; дорожка 5, pPS-2 (268aa) + Myc; полоса 6, pPS-2 (222aa) + Myc; и дорожка 7, pPS-2 (166aa) + Myc. (D) Иммуноблот соответствующих лизатов, показанных на C с анти-myc антителом. Лизаты в дорожках 1-5 в D соответствуют лизатам в дорожках 3-7 в C. (E) Иммуноблот с анти-GFP-специфическим антителом. Дорожки 1-4 представляют собой белковые лизаты клеток, трансфицированных следующими конструкциями: Lane 1, mock-transfected cells (контроль); полоса 2, pGFP; полоса 3, pGFP-PS-2; и дорожка 4, pGFP-PS-2 (N141I). (F) Иммуноблот белков PS-2 без слияния с NH2-терминальным PS-2-антителом. Дорожки 1-3 представляют собой 100 мкг белковых лизатов клеток, трансфецированных эквивалентными количествами следующих неплазменных конструкций PS-2: Lane 1, mock-transfected; полоса 2, pPS-2 (дикого типа); и полоса 3, мутант pPS-2 (Asn141Ile). Показаны положения маркеров молекулярной массы белка. Полноразмерные PS-2-содержащие полипептидные полосы, наблюдаемые только в трансфицированных клеточных лизатах, отмечены большими наконечниками стрел. Маленькие наконечники стрел указывают положение более крупных комплексов PS-2.

Иммунофлуоресцентная локализация белков PS-2 в клетках HeLa. (A-D) клетки HeLa, временно трансфицированные PS-2 + Myc и окрашивали для экспрессии PS-2 с использованием антител, специфичных либо для конечного конца NH-2 (A и C) PS-2, либо для метки myc на конце COOH (B и D ). Антитело против PS-2 было предварительно инкубировано либо с очищенным GST-белком для белков A и B, либо с GST-NH2-терминальным слитым белком для C и D, чтобы продемонстрировать специфичность антитела против PS-2 NH2-конца. Двойное окрашивание трансфицированных клеток с предварительно инкубированными антителами PS-2 и анти-myc демонстрирует, что окрашивание отменяется только при инкубации с слитыми белками GST, содержащими NH2-терминальные PS-2 последовательности. Окрашивание как NH2-, так и COOH-концевых эпитопов показало полную колокализацию (сравните А и В), предполагая, что два эпитопа не диссоциированы (не протеолитически расщепляются и дифференцированы по локализу). (E-J) клетки HeLa, временно трансфицированные конструкциями pPS-2 + Myc (E и F), pPS-2 (166aa) + Myc (G и H) и pPS-2 (138aa) + Myc (I и J) и дважды окрашивали для PS-2 и кальретикулина. Левая и правая панели показывают те же клетки, которые окрашиваются дважды, либо для экспрессии PS-2, используя антитело против NH2-терминального PS-2 (E, G, и I), либо для эндогенного калькретинулина (F, H и J ). Обратите внимание на полную колокализацию окрашивания PS калретикулином в pPS-2 + Myc- и pPS-2 (166aa) + Myc-экспрессирующие клетки, но не с pPS-2 (138aa) + Myc-трансфицированными клетками. Бар, 10 мкм.

Сверхэкспрессия белков PS-2 в клетках HeLa приводит к явным изменениям в ядерной морфологии. Клетки HeLa трансфицировали pPS-2 + Myc (A-C), pPS-2 (268aa) + Myc (D-F) или pKv1.4 + Myc (G-I). (A, D и G). Анти-myc-окрашивание клеток через 24 ч после трансфекции. Центральными панелями являются соответствующие изображения ДНК клеток, выявленные окрашиванием DAPI, а правые панели — изображения фазового контраста одних и тех же клеток. Обратите внимание, что большинство клеток, экспрессирующих высокие уровни PS-2, имеют дрожжевые ядра. В некоторых из этих клеток ядра сильно конденсированы с округленными и усохшими цитоплазмами (наконечники стрел).

Количественное определение выживаемости клеток при трансфекции конструкций PS-2. (А) клетки HeLa трансфицировали 20 мкг эквивалентов ДНК pPS-2 + Myc, pPS-2 (268aa) + Myc, pPS-2 (222aa) + Myc или pPS-2 (166aa) + Myc или были ложно трансфицированы , а количество плавающих клеток, которые накапливались в среде, подсчитывалось через 20 и 44 ч после трансфекции. Линейный график показывает количество плавающих клеток (мертвых клеток) в четырех отдельных экспериментах по сравнению с тем, что наблюдается в контрольных мак-трансфицированных клетках. Средняя ошибка для четырех экспериментов составила ~ 10-15% и не включена для ясности представления. Обратите внимание, что клетки, трансфицированные ДНК pPS-2 (166aa) + Myc, отображали задержанную гибель клеток в течение 20 часов. (B) клетки HeLa трансфицировали либо pGFP, pGFP-PS-2, либо pGFP-PS-2 (N141I), и флуоресцентные изображения с теми же покровными областями были захвачены и подсчитаны 17, 41 и 65 ч после трансфекции. Количество флуоресцентных клеток, наблюдаемое в 41 и 65 ч, было нормировано на число, замеченное в 17 ч, в качестве средства измерения эффектов экспрессии конструкций GFP на жизнеспособность клеток. Гистограммы показывают средний процент жизнеспособности клеток в шести независимых трансфекциях с конструкциями GFP-PS-2 и GFP-PS-2 (Ans141Ile) и соответствующее среднее значение для трех трансфекций с конструкцией GFP. (C) клетки HeLa трансфицировали эквивалентной суммой плазмидной ДНК, экспрессирующей PS-2 дикого типа или PS-2, содержащие мутацию, ассоциированную с AD (N141I). Количество мертвых клеток подсчитывалось через 40 ч после трансфекции. Гистограмма показывает скорости гибели клеток в трех отдельных экспериментах с использованием 15 мкг плазмидной ДНК по сравнению с количеством мертвых клеток, обнаруженных в контрольно-контрольных клетках.

Корреляция апоптотических событий в клетках HeLa, экспрессирующих PS-2. Клетки HeLa трансфицировали конструкцией pPS-2 (166aa) + Myc и исследовали на апоптотические или морфологические изменения через 48 ч после трансфекции. Ряды панелей представляют собой те же клетки, окрашенные для белка PS-2 (A и E), маркировки TUNEL (B) или окрашивания ламинами (F); DAPI окрашивания ДНК (C и D) и фазовых контрастных изображений (D и H). Клетки, помеченные позицией для TUNEL, оказались округленными и усеченными фазовой контрастной микроскопией (наконечники стрел).

Флуоресцентные исследования экспрессии PS-2 в клетках HeLa с использованием GFP в качестве репортера. (A) Флуоресцентные и фазовые контрастные изображения живых клеток HeLa, трансфицированных pGFP-PS-2, показывающие слитый белок GFP-PS-2, локализованы в ER. Предположительно, нетрансфицированная клетка указана стрелкой. (B) HeLa-клетки трансфицировали либо GFP в отдельности (верхний ряд), GFP, слитый с PS-2 дикого типа (вторая строка), либо GFP, слитый с мутантом AD PS-2 (N141I) (нижняя строка). Флуоресцентные изображения клеток, экспрессирующих белки GFP на одной и той же области сетчатого покровного стекла, были захвачены через 17 и 65 ч после трансфекции. Обратите внимание, что количество флуоресцирующих клеток через 65 ч после трансфекции увеличивается в клетках, экспрессирующих только GFP, тогда как клетки, экспрессирующие две гибридные конструкции GFP-PS-2, демонстрируют резкое снижение флуоресценции.

Прямая демонстрация того, что избыточная экспрессия PS-2 в клетках HeLa вызывает гибель клеток. Клетки HeLa трансфицировали конструкцией слияния GFP-PS-2, а изображения отдельной группы трансфицированных клеток в области № 2 с покровным склеиванием фиксировали в разное время после трансфекции. Показаны флуоресцентные (левые) и фазовые контрастные изображения GFP той же области 22 покровного стекла и 50 ч после трансфекции. Следуя этой группе клеток, можно сделать вывод, что те же три клетки, экспрессирующие слитый белок GFP в 22 часа, округляли и умерли на 50 ч.

Комментариев нет.

Добавить комментарий

Ваш e-mail не будет опубликован. Обязательные поля помечены *