Нажмите "Enter", чтобы перейти к контенту

Сывороточный протеин усиливает нормальные воспалительные реакции во время заживления кожной раны у крыс с диабетом

Whey protein enhances normal inflammatory responses during cutaneous wound healing in diabetic rats
Источник: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3254143/

Длительное заживление ран — это осложнение диабета, которое способствует смертности. Нарушение заживления ран происходит из-за чрезмерного производства реактивных кислорода (ROS). Сывороточный белок (WP) способен уменьшить кислородные радикалы и увеличить уровни антиоксидантного глутатиона. Таким образом, цель этого исследования заключалась в том, чтобы определить, может ли диетическое добавление с WP повышать нормальные воспалительные реакции во время заживления ран у крыс с диабетом. Животных назначали в рандомизированную контрольную группу (WN), рандомизированную диабетическую группу (WD) и рандомизированную диабетическую группу, устно дополненную сывороточным белком (WDWP) в дозе 100 мг / кг массы тела.

Было обнаружено, что сывороточный белок значительно снижает уровни малонового диальдегида (MDA), оксида азота (NO) и ROS. Значительное восстановление уровня глутатиона наблюдалось у крыс WDWP. Во время ранней стадии заживления ран IL-1β, TNF-α, IL-6, IL-4 и инфильтрация нейтрофилов были значительно уменьшены у мышей WD. Было установлено, что WP-добавка восстанавливает уровни этих воспалительных маркеров до уровней, наблюдаемых у контрольных животных. Кроме того, время, необходимое для заживления ран, значительно увеличилось у крыс с диабетом. Было установлено, что WP значительно уменьшает время, необходимое для заживления ран у крыс WDWP.

В заключение, диетические добавки с WP усиливают нормальные воспалительные реакции во время заживления ран у диабетических мышей путем восстановления уровней окислительного стресса и воспалительных цитокинов.

Способность животных восстанавливать раны имеет решающее значение для выживания после травмы [1]. Множество клеточных событий, таких как пролиферация клеток, миграция клеток, сужение и деградация и синтез внеклеточного матрикса, должны произойти для достижения закрытия раны и регенерации поврежденной дермы [2]. Эти события зависят от временной экспрессии и активации различных белков, таких как факторы роста, цитокины и матриксные металлопротеиназы [3].

Лечение ран начинается воспалительной фазой, за которой следует фаза пролиферации, в частности, пролиферация фибробластов и эндотелиальных клеток. Последняя фаза включает в себя производство и реорганизацию внеклеточного матрикса, что приводит к восстановлению или регенерации. Воспалительная фаза приводит к набору лейкоцитов, которые производят факторы роста и удаляют обломки из раны [4-7]. Процесс заживления требует взаимодействия между воспалительными клетками и биохимическими медиаторами, что стимулируется рядом митогенов и хемотаксических факторов [4].

Генерация кислородных радикалов обычно уравновешивается наличием адекватной эндогенной антиоксидантной защиты [8]. Окислительный стресс был связан с патологией сахарного диабета [9,10], заболеванием, отмеченным длительным воспалительным периодом, который увеличивает время, необходимое для выздоровления. Нарушение заживления ран происходит вследствие чрезмерного производства ROS. Идентификация пищевых белков, которые улучшают восстановление кожи при диабете, может способствовать разработке новых терапевтических стратегий. Многие исследования подтвердили роль глутатиона, который повышается с помощью диетического WP, в качестве мощного антиоксиданта [11,12]. WP способен уменьшить влияние кислородных радикалов и перекисного окисления липидов за счет увеличения активности антиоксиданта глутатиона, тем самым стимулируя эпителизацию и пролиферацию фибробластов, а также увеличивая секрецию как про-, так и поствоспалительных цитокинов. Было установлено, что WP значительно подавляет уровни гидропероксида и ROS в лейкоцитах, печени и кожных тканях у мышей путем восстановления антиоксидантного глутатиона [13].

Кроме того, WP содержит все существенные и незаменимые аминокислоты и является хорошим источником глутамина и аминокислот с разветвленной цепью, которые необходимы для роста клеток [14]. Связанные с цепочкой аминокислоты лейцин, изолейцин и валин способствуют заживлению костей, кожи и мышечных тканей. Аминокислотный пролин помогает в производстве коллагена, тем самым заживляя хрящ и укрепляющие суставы, сухожилия и сердечную мышцу [15].

Мы предположили, что заживление ран у диабетических животных может быть улучшено путем дополнения их рациона WP. Данные нашей предыдущей работы показывают, что WP увеличивает способность недиабетических животных лечить раны [16]. Кроме того, наше недавнее исследование [13] выявило потенциальные эффекты WP на иммунные процессы, включая регуляцию многих цитокинов. Мы также обнаружили, что способность мононуклеарных клеток периферической крови (РВМС) пролиферировать в ответ на стимуляцию различными антигенами была значительно увеличена в группе, обработанной WP [17].

Нарушение заживления ран при диабете происходит вследствие чрезмерного производства ROS. Как известно, WP приводит к уменьшению кислородных радикалов и увеличению уровней антиоксидантного глутатиона. Таким образом, мы стремились ускорить процесс заживления ран, используя диетическое дополнение сывороточного белка в модели стрептозотоцин-диабетической крысы. В этом исследовании были проанализированы внешние показатели размера раны с течением времени, окислительный стресс и воспалительные маркеры для оценки влияния сывороточного белка на этот жизненно важный процесс.

Время, необходимое для лечения ран у крыс с диабетом, было продлено. Интересно, что результаты показали, что время, затрачиваемое на заживление ран, значительно сократилось у крыс WDWP по сравнению с диабетическими крысами. Все раненые диабетические животные, которых кормили сывороточный белок, достигли полного выздоровления к 8-му дню. В течение 8 дней после ранения 100% ранений WDWP и WN показали полное закрытие, тогда как только 20% WD-ранок показали полное закрытие D12 (таблица 1) , Кроме того, 30% крыс-диабетиков не выдержали 10-й день.

Процент животных, которые достигли полного заживления ран на 6-й день (D6), 8-й день (D8) и 10-й день (D10) у недиабетических нормальных крыс (WN), диабетических крыс (WD) и крыс с диабетом, дополненных сывороточным белком (WDWP ) и смертность в этих группах по D10

На 2-й день существенных различий между различными группами крыс не наблюдалось. Однако на третий день было ясно, что скорость закрытия раны у животных WD была значительно задержана из-за влияния диабета на воспалительную стадию заживления. Было обнаружено, что WP значительно (P <0,05) ускоряет скорость укрытия у крыс диабета (WDWP) в 2,5 раза больше, чем у диабетических крыс (WD) на 3-й и 6-й день, а скорость закрытия у крыс WDWP также была значительно выше чем контрольные крысы на 3-й день (рис. 1А).

Скорость закрытия ран у недиабетических нормальных крыс (WN), диабетических крыс (WD) и диабетических крыс, дополненных сывороточным белком (WDWP). A: Скорость закрытия ран с интервалом в два дня, показывающая влияние сывороточного белка на заживление ран у крыс WDWP, которые регистрировали значительно более высокую скорость закрытия, чем у диабетических крыс. B: Внешняя фотография, показывающая раны в разных группах на D2 и D3. Сокращение раны очевидно у животных WDWP в D3. Никаких видимых изменений не произошло при диабетических ранах на D3. Размер раны рассчитывали путем определения площади раны каждый день по сравнению с площадью стандартного квадрата.

Кроме того, сокращение раны было очевидным в ранах группы WDWP на 3-й день и в ран крыс контрольных крыс на 5-й день. Однако в группе диабетической раны до 10-го дня не наблюдалось сокращения раны, и сокращение было низким в две крысы. Таким образом, скорость закрытия раны в сыворотке, дополненной диабетической группой, была значительно выше, чем у диабетической группы (например, на рисунке 1B).

Поскольку окислительная стабильность жизненно необходима для нормального заживления ран, мы контролировали окислительный стресс у крыс WN, WD и WDWP. Как и ожидалось, все окислительные маркеры были значительно увеличены у диабетических крыс. Значительное ингибирование (P <0,05) окислительных параметров наблюдалось у крыс WDWP. Статистический анализ показал, что группа крыс, дополненная WP, показала значительное снижение уровня MDA по сравнению с контрольными мышами. Мы также наблюдали значительное подавление как NO, так и ROS в группе WDWP. Интересно, что глутатион был значительно восстановлен (P <0,05) у крыс WDWP (рис. 2), почти достиг уровня, наблюдаемого у контрольных животных.

Окислительный стресс у недиабетических нормальных крыс (WN), диабетических крыс (WD) и диабетических крыс, дополненных сывороточным белком (WDWP). MDA, NO и общий глутатион измеряли в тканях печени, тогда как ROS оценивали в ткани кожи. Все окислительные маркеры были значительно увеличены у диабетических крыс. Сывороточный протеин восстанавливал уровни этих маркеров у крыс WDWP до уровней, близких к уровням контрольных крыс, и значительно увеличивал уровни глутатиона.

Активированные тканевые макрофаги выделяют три цитокины (IL-1β, TNF- и IL-6), которые индуцируют многие локализованные и системные изменения, наблюдаемые в острой фазе воспалительного ответа. Таким образом, провоспалительные цитокины IL-1β и TNF-α измеряли для определения их ролей на стадии воспаления процесса заживления ран. Уровень IL-1β достиг максимума в 6 ч как у контрольных крыс WN, так и у крыс WDWP (рис. 3A), но низкие уровни IL-1β наблюдались у крыс WD до 24 часов. Более того, уровень IL-1b в WD-группе был значительно ниже уровней IL-1β у контрольных или WDWP-крыс. Примечательно, что структура уровней TNF-α была аналогична структуре IL-1β во всех группах (рисунок 3B). Уровень TNF-α был значительно ниже у крыс WD по сравнению с контрольными крысами WDWP.

A, B: оценка ELISA как уровней IL-1β, так и TNF-α через 6 ч и 24 ч у раненых недиабетических нормальных крыс (WN), раненых диабетических крыс (WD) и раненых диабетических крыс, дополненных сывороточным белком (WDWP) , C, D: экспрессия гена белков IL-6 (6 ч) и IL-4 (24 ч) в трех группах, демонстрирующих заметный эффект белка сыворотки на оба цитокина после ранения.

В начале воспалительной стадии ИЛ-6 секретируется макрофагами локально и системно и вызывает много изменений, в том числе изменения в сосудистой проницаемости [18]. Поэтому мы исследовали уровни IL-6 через 6 ч после ранения. Уровень IL-6 был значительно повышен у крыс, дополненных WP (WDWP), по сравнению с диабетической группой (WD) (рисунок 3C).

Цитокины, полученные из макрофага, такие как IL-4, ответственны за формирование ткани. Поэтому мы обнаружили IL-4 через 24 часа после ранения. Результаты показали, что уровни IL-4 снижались у диабетических крыс. Мы обнаружили, что сывороточный белок значительно повышал уровни IL-4 у диабетических крыс (WDWP), которые были примерно в два раза выше уровня диабетических животных (WD), как показано на рисунке 3D.

Гистологические участки раненой кожи показали, что пролиферация и миграция эпидермальных клеток и кожная реорганизация постепенно улучшались и были завершены к 8-му дню у животных WDWP. Однако фазы заживления ран были отложены и нарушены у пациентов с ВД, а миграция эпидермальных клеток лишь частично покрывала область раны. Кроме того, волосяные фолликулы, которые отражают дермальное сокращение, редко наблюдались в дерме (рис. 4А).

A: Репрезентативные фотографии из вертикальных участков ран на ранах из разных групп через 6 часов (H & E × 40), 24 часа (H & E × 40, второй ряд, H & E × 400, третий ряд) и в конце эксперимента (H & E × 40). Во втором ряду этих разделов показано более высокое увеличение ран, пораженных большим количеством воспалительных клеток, особенно нейтрофилов, у крыс WN и WDWP. Небольшое количество воспалительных клеток показано в разделе от крыс WD (стрелка головы). B: Инфильтрация нейтрофилов в местах ранения у недиабетических нормальных крыс (WN), диабетических крыс (WD) и диабетических крыс, дополненных сывороточным белком (WDWP). Для каждого исследованного участка давали оценку между 0 (без инфильтрации) и 10 (инфильтрация нейтрофилов в большинстве районов) для инфильтрации нейтрофилов.

На ранних стадиях воспалительного ответа преобладающим типом клеток, который проникает в ткань, являются нейтрофилы. Инфильтрация нейтрофилов достигает первых 6 часов [18]. Инфильтрация нейтрофилов была значительно снижена у крыс с диабетом по сравнению с контрольными и крысами WDWP через 6 и 24 ч после ранения. Таким образом, диабет приводит к количественному снижению уровня инфильтрации нейтрофилов в участок раны до 24 ч после ранения. С другой стороны, уровень инфильтрации нейтрофилов восстанавливался до контрольных уровней крыс WDWP (рисунок 4B). В совокупности эти данные показывают, что ранний воспалительный ответ резко ослабляется у крыс WD, и что добавление крыс WDWP с помощью WP эффективно восстанавливает признаки раннего воспалительного ответа на уровни, наблюдаемые у контрольных мышей.

Ускорение заживления ран при диабете является целью большого количества исследований. В результате чрезмерной ROS нарушенная ранняя воспалительная фаза заживления характеризует диабетические раны [19]. В этом исследовании мы продемонстрировали, что раневое укорочение значительно сокращается у крыс с диабетом, дополненных WP, в кожной модели заживления ран. Более того, наши данные наглядно продемонстрировали, что добавка WP для диабетических животных снижает окислительный стресс и восстанавливает маркеры воспалительной реакции на уровни, сходные с контрольными животными.

Окислительный стресс возникает из-за дисбаланса между производством ROS и защитой клеточными антиоксидантами [20]. Во время воспалительной фазы выделение кислородных радикалов нейтрофилами и макрофагами вызывает повреждение тканей [21]. Мы обнаружили, что уровни MDA, NO и ROS были повышены у крыс с диабетом и что WP восстановил окислительные маркеры у крыс WDWP. Предыдущие исследования показали, что РП играет активную роль в переносе железа [22], в цитотоксической защите нейтрофилов [23] и в очистке свободных радикалов [24]. Действительно, значительное увеличение глутатиона наблюдалось у крыс, дополненных WP, в этом исследовании. Было показано, что WP является мощным индуктором глутатиона. Способность цистеина повышать уровни глутатиона больше, когда он поставляется в сыворотке, а не в виде свободного цистеина [25].

Таким образом, WP способен уменьшить влияние кислородных радикалов и перекисного окисления липидов путем увеличения антиоксидантного глутатиона и, таким образом, стимулировать ранние нормальные воспалительные события процесса заживления. Соответственно, WP имеет потенциальную роль в стимулировании характерных воспалительных цитокинов. WP восстановил высокие уровни IL-1β, TNF-α у крыс с диабетом, дополненных WP (WDWP). IL-1β, TNF-α модулируют экспрессию хемокинов и молекул адгезии, необходимых для вербовки воспалительных клеток в место повреждения [26, 27]. Значительное увеличение инфильтрации нейтрофилов в места раны наблюдалось у крыс WDWP и контрольных крыс, сравниваемых у диабетических крыс. Эти данные также свидетельствуют о том, что WP ингибирует ROS и другие окислительные маркеры и повышает инфильтрацию нейтрофилов во время ранней воспалительной реакции у крыс WDWP. Ранее мы обнаружили, что хемотаксис in vitro в В-клетках, Т-клетках и дендритных клетках, полученных из костного мозга, к CCL-21 и CXCL-12 был значительно увеличен у обработанных WP-мышей [17].

Нейтрофилы являются основными производителями многочисленных цитокинов, которые служат одними из самых ранних сигналов для активации кератиноцитов и фибробластов, тем самым инициируя пролиферативные и ремоделирующие фазы заживления ран [28,29]. Нейтрофилы являются первыми воспалительными клетками для проникновения на место раны и играют ключевую роль на ранней стадии воспаления заживления ран, очищая бактерии и фагоцитируя клеточный мусор [30]. Было обнаружено, что белок бычьей сыворотки представляет собой нормальные нейтрофилы человеческой крови путем усиления хемотаксиса, фагоцитоза, окислительного всплеска и дегрануляции [31].

Pradhan et al. [32] обнаружили, что экспрессия IL-6, IL-8, CXCR1, CXCR2 и GP-130 после травмы значительно ниже при диабетических ранах по сравнению с недиабетическими ранами. Было установлено, что WP стимулирует накопление IL-1β, IL-8, IL-6, макрофагального воспалительного белка (MIP) -1α, MIP-1β и TNF-α [31]. Аналогично, мы обнаружили, что WP стимулировал более высокие уровни IL-6 у крыс WDWP, чем диабетические крысы.

У диабетических крыс перекисное окисление липидов мембран клеток и органелл, нарушение внутриклеточного матрикса и изменение важных белковых ферментативных процессов вызывает повреждение тканей [21]. Повреждение ткани ухудшает рост и пролиферацию эндотелиальных клеток кератиноцитов, фибробластов и метаболизма коллагена [33,34], что, в свою очередь, может ухудшить процесс заживления (задержка образования грануляционной ткани, снижение коллагена и организация ткани) [35]. Мы обнаружили плохую повторную эпителизацию и кожную структуру на участках кожи крыс WD. С другой стороны, стимулирование ранних нормальных воспалительных событий процесса заживления с помощью WP значительно индуцировало нормальную повторную эпителизацию и пролиферацию фибробластов. Этот результат был подтвержден улучшением гистологической архитектуры раненой кожи у крыс WDWP по сравнению с крысами WD (рисунок 4A). Кроме того, WP значительно повысил уровень IL-4 в WDWP по сравнению с крысами WD. IL-4 представляет собой цитокин, полученный из макрофагов, который отвечает за формирование ткани (продуцирование коллагена в фибробластах) [36]. Таким образом, существует положительная корреляция между увеличением IL-4 и нормальной реконструкцией дермы у крыс WDWP.

Сокращение характеризуется центростремительным движением раневой кромки к центру раны. Сокращение раны начинается через 4-5 дней после травмы [37]. В нашем исследовании сокращение раны было очевидным в ранах WDWP при D3 и в ранах контрольных крыс при D5 по сравнению с D10 у диабетических крыс. Считается, что как миофибробласты, так и фибробласты ответственны за этот процесс [38,39]. WP содержит все аминокислоты, включая глутамин и аминокислоты с разветвленной цепью, которые необходимы для роста клеток [14]. Таким образом, помимо питания глутатиона и соответствующих незаменимых аминокислот, сывороточный белок усиливал последние стадии заживления ран, такие как восстановление тканей и ремоделирование у крыс с диабетом. Эти данные ясно объяснили высокую скорость закрытия раны и нормальную эпителизацию заживления ран у крыс WDWP.

В совокупности результаты этой работы подтверждают гипотезу о том, что окислительная стабильность, индуцированная у диабетических крыс WP, способствует ускоренному заживлению ран и иммунной стимуляции, наблюдаемой у крыс WDWP. NFkB необходим для индукции провоспалительных цитокинов, таких как IL-1β, TNF- и IL-6 [40]. Хотя мы не рассматривали это в настоящем исследовании, окислительная стабильность, индуцированная WP, может опосредовать активацию NFkB, что приводит к активации воспалительного каскада и стимуляции заживления ран, что приводит к более быстрой скорости закрытия раны у крыс WDWP.

Наши результаты объясняют значительное восстановление воспалительных маркеров у крыс с диабетом, обработанным сывороткой. В текущем исследовании показано, что РР индуцирует раннюю воспалительную реакцию заживления кожных ран, модулируя воспалительный ответ и окислительный стресс. В настоящее время нет данных об использовании WP для лечения нарушений заживления ран при диабете. Это исследование может дать критическое понимание будущих стратегий вмешательства в области питания, направленных на улучшение раннего заживления ран у людей с диабетом. Эта стратегия покажет, оказывает ли этот РП значительное клиническое воздействие. Поэтому потенциальную роль сывороточного белка в лечении диабетических ран необходимо интенсивно исследовать в будущих исследованиях, ориентированных на результаты, ориентированные на пациента.

Молоко верблюда было получено из трех пород (Majaheem, Maghateer и sofr) верблюда из региона Найдж в Саудовской Аравии. Молоко обезжиривали центрифугированием при 5000 г в течение 20 мин с использованием центрифуги IEC Model K [Бостон, США]. Обезжиренное молоко подкисляли до рН 4,3, используя 1 М HCl. Осажденный казеин удаляли центрифугированием и супернатант, содержащий сывороточный белок, насыщали сульфатом аммония (70% насыщения) и инкубировали в течение ночи при 4 ° С. Осажденный сывороточный белок собирали центрифугированием и диализовали против дистиллированной воды в течение 48 ч при 4 ° С с использованием мембраны Spectra / Pro® MWCO 6000-8000 Da. Полученные диализаты лиофилизировали с использованием Unitop 600SL, компании Virtis, Gardiner, New York 12525 USA и выдерживали при -20 ° C до использования. Диализат, содержащий неденатурированные сывороточные белки, лиофилизировали и охлаждали до использования.

Взрослые самцы крыс весом 120-150 г были получены в Фармацевтическом университете, Университете короля Сауда, Саудовской Аравии и размещены в клетках из нержавеющей стали (5 животных / клетка) в условиях отсутствия патогенов. Все процедуры на животных проводились в соответствии со стандартами, изложенными в руководящих принципах по уходу и использованию подопытных животных Комитетом по контролю над контролем и наблюдением за животными (CPCSEA) и Национальным институтом здоровья (NIH) , Протокол исследования был одобрен Комитетом по этике животных отдела зоологии, Колледж науки, Университет короля Сауда. Животных выдерживали при 18-22 ° С в 12:12 ч светло-темном цикле и снабжали пищей и водой ad libitum.

Животных назначали по трем группам: 1) первая группа оставалась в качестве ранней недиабетической (WN) контрольной группы и получала забуференный фосфатом физиологический раствор, 2) вторая группа была раненый диабетической группой (WD) с учетом забуференного фосфатом физиологического раствора , 3) третья группа была раненый диабетической группой, устно дополненной сывороточным белком (WDWP) в дозе 100 мг / кг массы тела в течение 15 дней предварительного ранения и 15 дней после ранения. Семь животных из каждой группы умерщвляли при умеренной анестезии диэтиловым эфиром через 6 часов, через 24 часа после ранения и в конце эксперимента.

Диабетические группы интраперитонеально вводили стрептозотоцином (65 мг / кг) для индуцирования диабета [41]. Стрептозотоцин-инъецированные животные проявляли массивную глюкозурию и гипергликемию в течение 5 дней после инъекции. Диабет был подтвержден у крыс путем измерения уровня глюкозы в крови натощак (200-250 мг / дл) перед использованием в этом эксперименте.

Крыс подвергали анестезии изофлюраном, а заднюю часть крысы выбривали и стерилизуют с использованием спиртового тампона. Модель биопсии раны, использованная в этом эксперименте, была описана ранее [42] с небольшой модификацией. Сбритую кожу сжимали и складывали, и рану пробивали через всю толщину сложенной кожи, чтобы образовать прямоугольник размером 2 × 5 мм ниже лопаток каждой крысы.

Процедура измерения закрытия раны была ранее описана Lim et al. [19]. Раны от отдельных крыс ежедневно фотографировались в цифровой форме. Стандартный растровый эквивалент по размеру к начальной области раны был нарисован рядом с раной и использовался в качестве эталона. Размер раны рассчитывали путем определения площади раны каждый день по сравнению с площадью стандартного прямоугольника. Закрытие раны выражали как отношение начального размера раны к области раны (каждый день после ранения). Более высокое соотношение указывает на более быстрое закрытие раны.

Два образца крови были немедленно собраны. Первый образец использовался для анализа сыворотки. Плазму выделяли из второго образца с использованием ЭДТА (этилендиаминтетрауксусной кислоты) в качестве антикоагулянта. Образцы плазмы и сыворотки отделяли для анализа путем центрифугирования крови в течение 15 минут при 3000 об / мин.

Анализ глутатиона (GSH) проводили на ткани, как описано ранее [43]. Печень удаляли и осторожно промывали в физиологическом растворе. Были зафиксированы свежие веса органов, и органы были заморожены до использования. Готовят 10% (мас. / Об.) Гомогената каждой замороженной ткани и супернатант используют в ферментативных анализах. Концентрации глутатиона измеряли добавлением 100 мкл супернатанта к 400 мкл PBS (содержащего 200 мМ монохлорбензола (MCB) и 2 U / мл глутатион-S-трансферазы (на 100 мкл)]. Концентрации глутатиона затем определяли путем измерения абсорбции реакции через 1 мин при 340 нм с использованием ультрафиолетового видимого спектрометра (Ultrospec 2000, Pharmacia Biotech). Стандарты глутатиона измерялись одновременно с получением стандартной кривой, которая использовалась для расчета концентраций GSH в образцах. Результаты были выражены в виде мкг GSH / г ткани. Статистические сопоставления деятельности GSH между контрольными группами и обработками в каждом случае выполнялись с использованием статистической программы Minitab, как подробно описано ниже.

Оксид азота анализировали, как описано Oliveira et al. [44]. Равномерны объемы сульфаниламида (1,5% в 5% H3PO4) и дигидрохлорида нафтилэтилендиамина (0,1% в H2O). Равный объем рабочего реагента смешивали с 0,1 мл каждого супернатанта в печени и инкубировали в течение 15 мин при комнатной температуре. Поглощение измеряли при 540 нм. Концентрацию нитритов рассчитывали по стандартной кривой NaNO3, и данные выражали как миллимолярный нитрит.

Переокисление эндогенных липидов в гомогенатах печени оценивали спектрофотометрически по методу, описанному Охавой и др. [45], и экспрессировали в наномолях малонового диальдегида (MDA) на миллилитр гомогената (нмоль / мл). Аликвоту 0,5 мл полученного супернатанта встряхивали с 2,5 мл 20% трихлоруксусной кислоты (TCA). К полученной смеси добавляли 1 мл 0,67% тиобарбитуровой кислоты (ТБА) и образцы встряхивали и инкубировали в течение 30 мин на кипящей водяной бане с последующим быстрым охлаждением на льду в течение 5 мин. После охлаждения добавляли 4 мл н-бутилового спирта и образцы хорошо встряхивали. Полученную смесь затем центрифугировали при 16000 g в течение 5 мин. Полученный слой н-бутилового спирта переносили в отдельную пробирку, и содержание MDA определяли спектрофотометрически при 535 нм с использованием УФ-видимого спектрометра (Ultrospec 2000, Pharmacia Biotech).

Уровни ROS определяли с использованием диацетата 2,7-дихлордифторсекрецина (H2DCF-DA) (Beyotime Institute of Biotechnology, Haimen, China). Супернатант из гомогенатов кожи непосредственно обрабатывали 10 мкМ H2DCF-DA, растворенным в 1 мл PBS при 37 ° С в течение 20 мин. Интенсивность флуоресценции контролировали с использованием длины волны возбуждения 488 нм и длины волны излучения 530 нм.

Сера тестировали на IL-1β и TNF-α с помощью ELISA в соответствии с инструкциями производителя соответствующих наборов иммуноанализа крыс (BioSource International Inc., США). Оптические плотности (OD) измеряли при 405 нм. Пределы обнаружения были установлены в соответствии с логарифмическим корреляционным коэффициентом стандартной кривой.

Общая РНК была выделена из тканей, используемых в этом исследовании, и мРНК очищали с использованием набора Ферментас. КДНК подвергали обратной транскрипции с использованием набора для экстракции кДНК Oligo-dT (Promega). кДНК получали с использованием набора для вычитания кДНК для ПЦР-select ™ (Clontech, Heidelberg, Germany) в соответствии с изготовителем с использованием нескольких модификаций.

кДНК для ПЦР была получена из тканей с помощью ОТ-ПЦР с использованием праймеров 5′-ATGGGTCTCAGCCCCCACCT-3’and5 ‘
— CAAGTATTTCCCTCGTAGGA -3’aS прямой и обратный праймеры, соответственно, для IL-4 и 5′-CAAGAGACTTCCAGCCAGTTGC -3’AND 5’-TAGCCACTCCTTCTGTGACTCT-3 ‘для IL-6. Используя кДНК ткани крысы в ​​качестве матрицы. ПЦР-амплификацию проводили с использованием PTC-100 ™ (MJ, США.). Реакция ПЦР использовала следующую программу: реакционную смесь инкубировали при 95 ° С в течение 10 мин, денатурировали в течение 1 мин при 95 ° С, отжигали в течение 30 с при оптимальной температуре (54 ° С для IL-4 и 49 ° С для IL-6) и удлиняли при 72 ° С в течение 2 мин. Программу повторяли в течение 32 циклов и затем инкубировали при 72 ° С в течение 10 минут для окончательного удлинения. Результаты анализировали электрофорезом в агарозном геле.

Гистологический препарат тканей раны был ранее описан Друри и Валлингтоном [46]. Крыс подвергали эвтаназии передозировкой изофлюрана, и образцы тканей собирали с мест раны для изучения проникновения нейтрофилов в область раны. Раны удаляли с четырех крыс из каждой группы лечения через 6 ч, 24 ч и в конце периода исследования после ранения, разрезая квадратную область, охватывающую весь участок раны. Собранные ткани немедленно хранили в 10% -ном растворе формальдегида в фосфатно-масляном физиологическом растворе, промывали в PBS, обезвоживали последовательно спиртовыми разведениями и вставляли в парафин. Секции микротома разрезали по вертикали через участок раны и приклеивали к слайдам перед окрашиванием гематоксилином и эозином. Были сделаны снимки участков в ране, и изображения были оцифрованы с использованием Adobe Photoshop (Adobe Systems, Mountain View, CA). Инфильтрацию нейтрофилов оценивали согласно Dommels et al. [47]. Для каждого исследованного участка назначался рейтинг между 0 (без инфильтрации) и 10 (нейтрофилы, участвующие в большинстве районов) для воспалительных инфильтраций, особенно нейтрофилов. Разделы из по меньшей мере пяти крыс были тщательно исследованы для инфильтрации нейтрофилов на месте раны.

Статистический анализ проводился с использованием программного обеспечения MINITAB (MINITAB, State College, PA, версия 13.1, 2002). Данные из экспериментов были сначала проверены на нормальность с использованием теста Андерсона Дарлинга и для дисперсии гомогенности до любого дальнейшего статистического анализа. Данные обычно распределялись, а дисперсии были однородными; таким образом, однонаправленный ANOVA использовался для определения общих эффектов лечения, сопровождаемых индивидуальным сравнением, с использованием сравнения Pairwise от Tukey. Результаты выражаются как средние ± стандартные отклонения (SD). P-значения> 0,05 считались статистически несущественными, а значения Р <0,05 считались статистически значимыми.

IL-1β: интерлейкин-1b; IL-6: интерлейкин-6; GP: глутатион; MDA: Malondialdehyde; NO: оксид азота; ROS: реактивные виды кислорода; РВМС: периферические мононуклеарные клетки крови; TNF-α: Фактор некроза опухоли альфа; WN: раненый недиабетический; WD: Раненная диабетическая группа; WDWP: Раненная диабетическая группа, устно дополненная сывороточным белком.

Авторы заявляют, что у них нет конкурирующих интересов.

Он разработал исследование, описал гистологические изменения, подготовил цифры, составил рукопись и провел статистический анализ. AS отвечал за модель животных и гистологические исследования. AAS отвечал за анализ ПЦР. AM отвечал за добычу и подготовку WP. Все авторы прочитали и утвердили окончательную рукопись.

Эта работа была поддержана Национальным планом науки и технологий (НПСТ), финансируемым Костромским городом Абдул-Азиза за науку и технику (KACST), Эр-Рияд, KSA, по проекту № 10-BIO975-02. Авторы заявляют никакого конфликта интересов.

Комментариев нет.

Добавить комментарий

Ваш e-mail не будет опубликован. Обязательные поля помечены *