Нажмите "Enter", чтобы перейти к контенту

Удаление комплексной ДНК вируса гепатита B с использованием CRISPR-Cas9

Removal of Integrated Hepatitis B Virus DNA Using CRISPR-Cas9
Источник: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5360708/

Под редакцией: Слободан Паесслер, Медицинский филиал Техасского университета, США

Пересмотрены: Qiao Fei, Медицинский университет Южной Каролины, США; ShiXing Tang, Южный медицинский университет, Китай; Гуанпин Тай, Эдинбургский университет, Великобритания

† Эти авторы внесли одинаковый вклад в эту работу.

Наличие ковалентно замкнутой кольцевой ДНК (cccDNA) вируса гепатита B (HBV) и постоянная интеграция ДНК HBV в геном хозяина придает риск вирусной реактивации и гепатоцеллюлярной карциномы. Только нуклеозидные / нуклеотидные аналоги практически не имеют возможности устранить репликативные шаблоны HBV, состоящие из cccDNA или интегрированной ДНК HBV. В последнее время технология CRISPR / Cas9 широко применяется в качестве перспективного инструмента для редактирования генома, и было показано, что HBV-специфические системы CRISPR-Cas9 эффективно опосредуют разрушение cccDNA HBV. Однако интегрированные фрагменты ДНК HBV считаются важными проанкогенными свойствами и служат важным шаблоном для репликации и экспрессии вируса в стабильной линии клеток HBV. В этом исследовании мы полностью вырезали полный фрагмент ДНК HBV длиной 3175 п.о. и разрушали CSCDNA HBV в стабильной линии клеток HBV. В линии клеток, эксципированной HBV, внутриклеточная клетка HBV внутри клетки, супернатантная ДНК HBV, HBsAg и HBeAg оставалась ниже отрицательных критических значений более 10 месяцев. Кроме того, в целом секвенирование генома мы анализировали внецелевые эффекты и исключали клеточное заражение. Впервые инфекция HBV полностью уничтожена в стабильной линии клеток HBV. Эти данные показывают, что система CRISPR-Cas9 является потенциально мощным инструментом, способным стимулировать радикальное или «стерильное» лечение HBV.

Хронический гепатит B (CHB) является основной проблемой общественного здравоохранения во всем мире, с 350-400 миллионами хронических вирусов HBV (вирус гепатита B) (Seo and Yano, 2014). Инфекция HBV приводит к 0,5-1 миллионам смертельных случаев в год из-за цирроза печени, гепатоцеллюлярной карциномы и печеночной недостаточности (Kao and Chen, 2002; Roberts and Gores, 2005). Ковалентно замкнутая кольцевая ДНК (cccDNA) HBV очень стабильна у пациентов с ХГБ и служит в качестве матрицы для вирусной мРНК и синтеза догеномной РНК (Moraleda et al., 1997; Dandri et al., 2000; Gish et al., 2015; Го и Го, 2015 год, Нассал, 2015 год). Интеграция ДНК HBV в геном хозяина может привести к изменениям генома хозяина, что приводит к изменениям в генах, связанных с пролиферацией, дифференцировкой и выживаемостью клеток (Bonilla Guerrero and Roberts, 2005; Feitelson and Lee, 2007; Jiang S. et al. ., 2012; Jiang Z. et al., 2012; Sung et al., 2012; Xu et al., 2014). Интеграция ДНК HBV также является важным фактором гепатокарциногенеза (Bréchot, 2004; Sung et al., 2012; Tarocchi et al., 2014; Xu et al., 2014). Нынешние анти-HBV-обработки с нуклеозидными / нуклеотидными аналогами (NA) или интерфероном не вылечивают CHB, а рецидивы распространены (Bang and Kim, 2014). Хотя NAs могут ингибировать вирусную обратную транскриптазу и подавлять репликацию HBV, эти лекарственные средства сами по себе не имеют или не обладают способностью устранять репликативные шаблоны HBV, содержащие cccDNA (Moraleda et al., 1997; Dandri et al., 2000) или интегрированную ДНК HBV (Zucman-Rossi и Laurent-Puig, 2007). Учитывая недостатки текущих терапевтических вариантов, необходимо подходить к CHB принципиально другим способом (Shaw et al., 2006; Sharon and Chu, 2008).

Недавно был разработан новый инструмент для редактирования генома CRISPR-Cas9, основанный на кластеризованных регулярных коротких палиндромных повторах бактериальной иммунной системы (CRISPR) (Qi et al., 2013). Синтез цинковых пальцевых нуклеаз (ZFNs) и транскрипционных активатор-эффекторных нуклеаз (TALENs) изучался для их способности специально разрушать геномы HBV in vitro и in vivo (Cradick et al., 2010; Bloom et al., 2013; Chen et al., 2014). Однако, по сравнению с ZFN и TALEN, систему CRISPR / Cas9 можно более легко перепрограммировать и доставлять как in vitro, так и in vivo для расщепления практически любой последовательности ДНК путем простого перепроектирования направляющих РНК (gRNAs), который, как полагают, является перспективным геномом (Qi et al., 2013; Ran et al., 2013; Zhang et al., 2014). Используя CRISPR-Cas9, Hu et al. полностью вырезали всю длину интегрированной провирусной ДНК ВИЧ в стабильной линии моноклональных клеток ВИЧ (Hu et al., 2014). В этих исследованиях HBV-специфичные системы CRISPR-Cas9 эффективно опосредули разрушение гена в шаблонах HBV в векторах экспрессии (Lin et al., 2014; Liu et al., 2015) и HBV cccDNA (Seeger and Sohn, 2014; Kennedy et al. , 2015; Zhen et al., 2015a) как in vitro, так и in vivo. Однако ни одно из этих исследований не продемонстрировало удаление полноразмерной интегрированной ДНК HBV и субгеномных интегрированных фрагментов ДНК HBV в стабильной линии клеток HBV (Lin et al., 2014; Seeger and Sohn, 2014; Kennedy et al., 2015; Liu et al., 2015; Zhen et al., 2015a). Эти недостатки в значительной степени ограничивали перспективу разработки фундаментального терапевтического метода ликвидации вируса через CRISPR-Cas9. В нескольких исследованиях было показано, что удаление интегрированной ДНК HBV из генома хозяина является необходимой мерой для восстановления стабильности хромосомы и лечения HCC-связанных HCC (Peng et al., 2015; Ramanan et al., 2015; Wang et al. , 2015 год). В новаторском исследовании Karimova et al. разрушали интегрированную ДНК HBV, используя интегрированную репортерную последовательность HBV в клеточных линиях HeLa и HEK293 (Karimova et al., 2015). В клетках, инфицированных HBV, существование множества различных форм эписомальной ДНК HBV (Tuttleman et al., 1986) и множественных интегрированных сайтов HBV в разных хромосомах (Matsubara and Tokino, 1990) сделало громоздким специфическое усиление полной длины интегрированных ДНК-сайтов HBV в стабильной линии клеток HBV с использованием Alu- / LM-PCR. Кроме того, ограничения коротких чтений, сгенерированных секвенированием следующего поколения (NGS), означали, что сайты интеграции ДНК HBV можно было вывести только из чтения с парным концом, содержащего как человеческие, так и вирусные последовательности (Hai et al., 2014). В предыдущем исследовании мы установили стабильную линию клеток HBV, HepG2.A64 (CCTCC C 201163), используя штаммы HBV генотипа C (GenBank: HQ638218.1), выделенные из пациентов с гепатитом B (Wei-ming et al., 2014). По сравнению с HepG2.2.15, эта клеточная линия могла продуцировать больше антигенов, вирионов и HBV cccDNA, и ее легче культивировать и трансфектировать. HBV, трансфецированный в клетках HepG2.A64, содержал энтекавир-устойчивые мутации, которые уже использовались в исследованиях резистентности к лекарственным средствам (Liu et al., 2016). Более того, мы использовали CRISPR-Cas9 для разрушения ксДНК HBV и ингибирования репликации вируса в этой клеточной линии в нашем предыдущем исследовании (Li et al., 2016). В этом исследовании не только HBV cccDNA, мы также удалили всю длину интегрированной ДНК HBV, а это означает, что мы достигли «стерильной» эрадикации инфекции HBV в этой стабильной линии клеток HBV.

Вектор двойной экспрессии Cas9 / gRNA pSpCas9 (BB) -2A-Puro (PX459) был подарком от Feng Zhang (Addgene plasmid # 48139) и был сконструирован в соответствии с ранее описанным протоколом (Ran et al., 2013). Используя инструмент прогнозирования gRNA (http://crispr.mit.edu/), пять потенциальных целевых последовательностей были получены из генома HBV (номер доступа GenBank HQ638218). Эти protospacers были впоследствии вставлены в векторы двойного выражения под контролем промотора U6. Плазмиды очищали с использованием набора EndoFree Plasmid Maxi Kit (Qiagen, Германия).

Все клетки поддерживали в модифицированной среде Дульбекко Eagle, дополненной 10% фетальной телячьей сывороткой при 37 ° C и 5% CO2. Линия моноклональных клеток HepG2.A64 (CCTCC C 201163) была установлена ​​из клеток HepG2, трансфецированных плазмидой HBV pTriexHBV1.1, содержащей 1,1 копии ДНК HBV (GenBank: HQ638218.1) (Wei-ming et al., 2014). Эта линия моноклональных клеток устойчиво продуцирует ДНК HBsAg, HBeAg и HBV. В общей сложности 2 × 106 клеток А64 высевали на 10 см пластины за 24 ч до трансфекции. Взаимовыраженные векторы Cas9 / gRNA трансфицировали в клетки A64 с использованием Lipofectamine LTX (Life Technologies, США). Пуромицин (1 мкг / мкл) использовали для повышения эффективности трансфекции (рисунок S1). Через 72 ч после трансфекции трансфицированные клетки высевали на 24-луночные планшеты (~ 4 × 104 клеток на лунку) для последующего анализа. Для субклонирования стабильные клоны субкультивировали после трансфекции и подвергали удалению пуромицина методом предельного разведения в 96-луночных планшетах, а субклоны, полученные из отдельных клеток, поддерживали для дальнейших исследований.

Геномную область, окружающую целевые области А и В, амплифицировали с помощью ПЦР; специфические праймеры были разработаны с праймером-премьером 5.0 (таблица S1). Все продукты ПЦР были проверены секвенированием Сэнгера и подвергнуты процессу повторного отжига для индукции образования гетеродуплекса. После повторного отжига продукты обрабатывали T7EI (New England Biolabs, США) при 37 ° C в течение 30 минут и анализировали с использованием 3% агарозных гелей. Гели визуализировали с использованием системы гелеобразования (Bio-Rad, US).

HBsAg и HBeAg измеряли в супернатантах клеток, используя систему ARCHITECT i2000 SR (Abbott, US); данные были зарегистрированы в МЕ / мл для HBsAg и S / CO для HBeAg. Супернатанты клеточной культуры экстрагировали и тестировали на присутствие ДНК HBV в ПЦР в реальном времени. Для количественного определения СКВК HBV циркулярную дуплексную ДНК подвергали АТФ-зависимой ДНКазе PlasmidSafe (Epicenter, US), которая имеет низкую активность в отношении кДНК HBV, dsDNA и ssDNA. Затем проводили амплификацию кругового круга (RCA) для избирательной амплификации кольцевой ДНК. На основе продуктов RCA HBV cccDNA амплифицировали и количественно определяли ПЦР в реальном времени TaqMan с использованием специфических cccDNA-селективных праймеров и зонда, нацеленного на область зазора между DR1 и DR2 генома HBV (Zhong et al., 2011). Для обнаружения геномной ДНК-инфекции использовались наборы праймеров, которые амплифицировали ДНК HBV S или контрольные клеточные геномные последовательности, расположенные в гене A1AT (таблица S1). Для количественного определения количества клеток специфические праймеры для β-актина человека использовали для ПЦР в реальном времени.

Геномную ДНК выделяли методом экстракции цетилтриметиламмонийбромидом (CTAB). Образцы ДНК и библиотеки геномной ДНК были подготовлены на объекте NGS в компании Biomarker Technologies. Все библиотеки были секвенированы с 150-битными сообщениями с парным концом в двух ячейках потока Illumina Rapid Run с использованием инструмента HiSeq X 10 (Illumina). Демультиплексированные данные чтения из секвенированных библиотек были отправлены в компанию Biomarker Technologies для анализа биоинформатики. Вкратце, сырые чтения были сопоставлены с геномом человека (hg19), используя BWA. Инструмент для анализа геномного анализа (GATK, версия 2.8.1) использовался для удаления повторяющихся чтений, локального выравнивания, базовой калибровки качества и индивидуального вызова.

Для статистического анализа t-тест Стьюдента выполнялся с использованием программного пакета SAS. P <0,05 считалось значительным. Шкалы ошибок представляют собой SEM по меньшей мере из трех независимых экспериментов.

Мы использовали стабильную линию клеток HBV HepG2.A64 (CCTCC C 201163, далее именуемую «A64») в качестве модели ячейки. Полная длина интегрированной ДНК HBV в этой клеточной линии зависела от инородного промотора (промотора β-актина цМВ-цыплят) вместо вирусных промоторов, что позволило амплифицировать полноразмерную интегрированную по репликации интегрированную ДНК HBV с использованием специфического праймера ( P1), расположенный в зоне внешнего промотора (фиг. 1A). Чтобы гарантировать, что продукты ПЦР праймеров (P1 и P2) были интегрированной ДНК HBV, а не фрагментом на pTriexHBV1.1, мы использовали плазмидную безопасную АТФ-зависимую ДНКазу (PSAD) для извлечения кольцевой дуплексной ДНК. HBV-специфические праймеры (HBSF & R) и геном-специфические праймеры (A1ATF & R) использовали в качестве положительного и отрицательного контролей, соответственно, для оценки влияния кольцевой дуплексной ДНК на экстракцию. Праймер P1 и ген-специфический праймер P3 HBV S не амплифицировали кольцевую дуплексную ДНК (фиг. 1C, D), что указывает на отсутствие кругового pTriexHBV1.1 в стабильной линии клеток A64 HBV и что праймер P1 представляет собой интегрированный HBV ДНК-специфический праймер. Затем мы выполнили ПЦР на большие расстояния, используя геномную ДНК A64 со встроенными ДНК-специфическими праймерами HBV (P1 и P2) с комплектом PCR Phusion High-Fidelity (NEB, US), следуя протоколу производителя. Последовательность продуктов ПЦР выявила фрагмент ДНК размером 4049 п.п., представляющий интегрированную ДНК HBV с длиной волны 3 362 п.о. (1,1 экз.), А также фланкирующую последовательность, полученную на основе pTriexHBV1.1 с 687 п.о. (рисунок 1B). Интегрированная ДНК HBV объемом 3,362 п.о. содержала цельный геном HBV с длиной волны 3,173 п.о. и повторную последовательность 189 п.о. в области ядра HBV. Чтобы удалить полноразмерную интегрированную ДНК HBV, мы использовали одну gRNA, нацеленную на две области повторения интегрированной ДНК HBV, которая, как ожидается, была бы более эффективной в трансфекции и имела бы более низкий потенциал нецелевого назначения, чем использование двух gRNAs (фиг. 1A ). По результатам онлайн-прогноза эффективности (Hsu et al., 2013; Mali et al., 2013) мы идентифицировали пять целевых гРНК с меньшим количеством побочных эффектов на геном хозяина (таблица S2) и построили соответствующие системы CRISPR-Cas9.

Анализ интегрированной ДНК HBV в стабильной линии клеток HBV A64. (A) Интегрированная ДНК HBV в стабильной клеточной линии HBV A64 и целевых сайтах gRNA в области повторения копии генома 1.1 HBV. (B) ДНК-фрагмент размером 4049 п.п., представляющий интегрированную ДНК HBV с длиной волны 3,362 п.о. (1,1 экз.), А также фланкирующую последовательность, полученную из pTriexHBV1.1 с 687 п.о., эффективно амплифицировали из клеточной геномной ДНК с использованием интегрированных HBV-специфических праймеров P1 и P2 , (C) ПЦР-анализ с использованием наборов праймеров S-гена A1AT и HBV, проведенных на общей геномной ДНК и кольцевой дуплексной ДНК для оценки эффекта экстракции на кольцевой дуплексной ДНК. (D) ПЦР-анализ интегрированной ДНК HBV или кольцевой дуплексной ДНК, выделенной из клеток с использованием наборов праймеров P1 / P3 и S-гена. Используя P1 и праймер P3 основной области HBV, ампликоны S-гена HBV были предсказаны как 542- и 572-bp, соответственно. Праймеры P1 / P3 не амплифицировали кольцевую дуплексную ДНК.

Чтобы оценить способность генерировать кажущееся расщепление на обоих концах интегрированной ДНК HBV, мы провели анализ, чувствительный к рассогласованию T7-эндонуклеазы I (T7EI) (Ran et al., 2013) после трансфекции пяти гРНК в клеточную линию A64 (рисунок 2А). Все системы вводили двунитевые разрывы (DSB) на оба конца интегрированной ДНК HBV, но gRNA-69 была наиболее эффективной системой (рис. 2A). Затем, чтобы определить эффективность нокаута гРНК в клетках А64, мы использовали набор реагентов ARCHITECT HBsAg и HBeAg для определения количества HBeAg и HBsAg в супернатантах клеточной культуры в течение 16 последовательных дней после трансфекции. На 9-й день после трансфекции по сравнению с таковой в группе, свободной от gRNA, концентрации HBeAg были снижены на 83,13 ± 0,14% в группе, обработанной gRNA-91, 80,53 ± 2,43% в группе, обработанной gRNA-69, 70,71 ± 2,09% в группе, обработанной gRNA-62, и 76,50 ± 0,27% в группе, обработанной gRNA-60. Концентрации HBsAg были снижены на 87,38 ± 1,56% в группе, обработанной gRNA-91, 86,49 ± 1,79% в группе, обработанной gRNA-69, 80,07 ± 1,01% в группе, обработанной gRNA-62, и 82,55 ± 0,78% в gRNA-60. Концентрации ДНК HBV были снижены на 91,72 ± 1,55% в группе, обработанной gRNA-91, 89,21 ± 2,72% в группе, обработанной gRNA-69, 80,30 ± 1,30% в группе, обработанной gRNA-62, и 86,95 ± 1,93% в обработанная gRNA-60 группа. Следует отметить, что подавление ДНК HBsAg и HBV было несколько выше, чем у HBeAg. В течение 16 последовательных дней после трансфекции концентрации HBV-ДНК, HBeAg и HBsAg в супернатантах культуры были низкими в группах gRNA-91, gRNA-69, gRNA-62 и gRNA-60 (фиг. 2B, D) по сравнению с таковыми в группа gRNA-empty (рисунок 2C). Ни ДНК HBV, ни антигены HBV не были снижены в клетках, трансфицированных gRNA-65. Более того, при 10 и 14-дневной посттрансфекции вся группа показала снижение при подавлении ДНК HBeAg и HBV. Это явление ожидалось из-за потерь клеток при изменении среды.

Ингибирование как экспрессии антигена HBV, так и репликации HBV с помощью CRISPR-Cas9 в клетках A64 после трансфекции. (A) ДНК, экстрагированную из клеток A64, трансфецированных gRNA-91, gRNA-69, gRNA-65, gRNA-62 и gRNA-60, анализировали с помощью анализа T7EI. Показаны предсказанные размеры необрезанных и разрезанных полос. (B-D) Ингибирование HBsAg, ДНК HBV и HBeAg в супернатантах клеточной культуры в указанные моменты времени после трансфекции клеток A64 с помощью gRNA-91, gRNA-69, gRNA-65, gRNA-62 и gRNA-60.

Мы ожидали, что экспрессия gRNAs в ячейках A64 приведет к удалению всего генотипа HBV с длиной 3,173 п.о. между целевыми сайтами A и B. В результате анализа ПЦР на большие расстояния был обнаружен один субклон HepG2.A64-69-7 (A64, трансфецированный gRNA-69, далее называемый «69-7»), который содержал полное удаление всего интегрированного 3,173-bp Геном HBV (рисунок 3A). Фрагмент 873-bp, представляющий предсказанный сегмент, полученный из его фланкирующей области, был амплифицирован (рис. 3A), предполагая, что g9-69 позволил Cas9 вытеснить полноразмерный интегрированный сегмент гена HBV. Анализ последовательности показал, что фрагмент 873-bp включал 687-bp из интегрированной последовательности фланкирования, основанной на pTriexHBV1.1, и 186-парную последовательность HBV-повторного ядра с делецией 3-bp на целевом сайте gRNA-69, который был как ожидается, будет вызван расщеплением и восстановлением с помощью gRNA-69 (рисунок 3B).

CRISPR-Cas9 / gRNA-69 эффективно удалял интегрированный геном HBV из стабильной линии клеток HBV. (A) Анализ длительностей ампликона ПЦР с использованием пары праймеров (P1 и P2), нацеленных на интегрированную последовательность фланков HBV, выявил устранение полноразмерного интегрированного генома HBV (3,173-bp), оставив один фрагмент (прогнозируемый сегмент 873 п.о. из его фланкирующая область). (B) Диаграмма, показывающая удаление полноразмерного интегрированного генома HBV. Оставшийся фрагмент включал ожидаемый 687-bp из интегрированной последовательности фланков HBV и 186-парной последовательности повторяющихся сердечников HBV. (C) Последовательность Sanger оставшегося фрагмента (873-bp), показывающая фланкирующую последовательность HBV (маленькие буквы, 687-bp) и частичные последовательности (189-3 = 186-bp) интегрированной области B повторения HBV (зеленый) и повторить область A (красный) с 3-bp-удалением вокруг сайта ориентации gRNA-69 (выделено желтым цветом). Устранение полноразмерного интегрированного генома HBV указывается зачеркиванием. (D, E). Количество ДНК HBeAg, HBsAg и HBV в супернатантах клеточной культуры и CSCDNA HBV в группе, обработанной gRNA-пустым (K-15) и обработанной gRNA-69 группой (69-7), в течение более 300 последовательных дней , Результаты теста HBsAg и HBeAg в группе, обработанной gRNA-69 (69-7), всегда находились под отрицательным порогом (0,05 МЕ / мл для HBsAg и 1 S / CO для HBeAg), а количество ДНК HBV и HBV cccDNA в супернатантах всегда были необнаружимыми (<500 МЕ / мл для qPCR) в группе, обработанной gRNA-69 (69-7). Все вирусные маркеры в группе, обработанной gRNA-пустом (K-15), оставались на высоком уровне.

Затем мы провели количественный анализ HBsAg и HBeAg в супернатанте (рис. S1A, B) и в реальном времени ПЦР-анализ ДНК супернатанта HBV и HBV cccDNA (фиг. S1C, D). ДНК HBV в супернатанте из группы, обработанной gRNA-пул (субклон K-15), имела концентрацию 775,033 ± 29,868 МЕ / мл на 10 день после непрерывной культивирования, тогда как концентрация ДНК HBV в супернатанте из gRNA -69 (субклона 69-7) составляла 420 ± 278 МЕ / мл. HBV cccDNA в субклоне 69-7 не определялась qPCR (<500 копий / 106 клеток), тогда как HKV cccDNA в субклоне K-15 имела концентрацию 11807,834 ± 3,431,702 копии / 106 клеток (фиг. S1C, D). Кроме того, количество HBsAg и HBeAg в супернатанте из субклона 69-7 всегда находилось ниже отрицательного порога (0,05 МЕ / мл для HBsAg и 1 S / CO для HBeAg) в течение 10 последовательных дней, тогда как количество HBsAg и HBeAg в супернатант из субклона K-15 быстро увеличивался (рис. S1A, B). Затем, чтобы проверить, можно ли восстановить это разрешение HBV, мы провели долгосрочные наблюдения над субклонами 69-7 и K-15. В отличие от высоких уровней HBeAg и HBsAg в супернатанте из субклона K-15 количество ДНК HBeAg, HBsAg и HBV в супернатанте из субклона 69-7 оставалось ниже отрицательных критических значений в течение 300 последовательных дней; Кроме того, CSCDNA HBV не определялся в субклоне 69-7. Напротив, все эти вирусные маркеры оставались высокими в субклоне K-15 в течение 300 последовательных дней (рис. 3D, E).

Для оценки возможных внецелевых эффектов CRISPR-Cas9 и комплексных субгеномных фрагментов ДНК HBV в исходной HBV-содержащей клеточной линии (A64) и линии с вырезанной HBV клеточной линией (69-7) проводили секвенирование целых геномов (WGS) , Средний охват составил 71 раз в A64 и 67 раз в 69-7. В целом, с геномами человека (GRCh37 / hg19) в качестве контрольных последовательностей, мы идентифицировали 4 981 628 SNP, 914 579 индейцев и 24 344 SV в клетках A64 и 3834414 SNP, 771 687 индивидуумов и 16 719 SV в 69-7 клетках с использованием GATK, v.2.8. 1. Затем мы провели анализ ± 500-б.п., фланкирующих каждый индекс против предсказанных внереализационных сайтов gRNA-69 (таблица S3). В общей сложности мы выявили 6 индексов в 50 потенциальных нецелевых регионах (таблица 1), в то время как четыре индивида были идентифицированы в двух клеточных линиях, и только после того, как трансфекция gRNA-69 была отличной от двух индексов, это говорит о том, что gRNA-69 не имеет значительных вне цели. Более того, после сравнения SNP и индексов между клетками HepG2.A64.69-7 и HepG2.A64 мы обнаружили, что 1,175,423 SNP и 154,931 индейка присутствовали только в стабильной линии клеток HBV, а не в линии клеток, вырезанных HBV; 28 209 SNP и 12 039 индивидуумов присутствовали только в линии клеток, эксципированных HBV, но не в стабильной линии клеток HBV; В обоих образцах произошло 3 806 205 SNP и 759 648 индивидуумов. Таким образом, это означает, что вырезанная HBV клетка HepG2.A64.69-7 пропустила миллионы мутаций по сравнению со стабильной клеточной линией HBV HepG2.A64.

Подробная информация о шести названных инделях вблизи gRNA-69 предсказала внецелевые сайты в A64 и 69-7 клетках.

В качестве доказательства того, что вырезанный HBV моноклин 69-7 не существовал в очень небольшом количестве в качестве загрязнителей в стабильной линии A64 клеток HBV перед обработкой gRNA-69, мы обнаружили специфическую остаточную последовательность расщепления gRNA-69 / Cas9 (рис. 4), который подтвердил, что этот моноклон был получен gRNA-69 / Cas9. Секвенирование Sanger продуктов ПЦР, содержащих сайт эксцизии (фиг. 3C), показало, что после полного извлечения ДНК HBV с помощью gRNA-69 / Cas9 и восстановления не гомологичного концевого соединения (NHEJ) три нуклеотида «GAA» были удалены в gRNA -69 сайт расщепления, расположенный в области HBV C. Таким образом, мы обыскали две последовательности в 20 п.п. (CCCGTATAAATTTGGAGCTT и CCGTATAAAGAATTTGGAGC), которые могли отличить исходную и вырезанную ДНК в данных необработанного секвенирования (охват 60 ×) двух образцов. Результаты показали, что до трансфекции gRNA-69 / Cas9 мы не смогли найти остаточную последовательность с делецией «GAA» в стабильной линии клеток HBV A64, тогда как 11 считываний, содержащих остаточную последовательность с делецией «GAA», были обнаружены в 69-7. Эта остаточная последовательность с делецией «ГАА» в области нацеливания gRNA-69 не только указывала, что линия клеток, эксципированная HBV, была установлена ​​gRNA-69 / Cas9, она также подтвердила, что этот моноклон не был зараженным клоном в клетке A64 линия.

Sanger последовательности целевого региона gRNA-69 / Cas9 как в линии с вырезанной HBV-линией 69-7 (верхняя половина), так и в двух концах интегрированной полноразмерной ДНК HBV в стабильной линии клеток A64 (нижняя половина) HBV. Специфическую остаточную последовательность с трехнуклеотидной делецией «ГАА» в области расщепления gRNA-69 / Cas9 в вырезанной HBV клеточной линии 69-7 использовали для выделения ее из стабильной линии клеток HBV. Дополнительное делегирование «GAA» было отмечено красной линией в стабильной линии клеток HBV A64.

CRISPR-Cas9 представляет собой потенциальное средство для радикального лечения хронических вирусных инфекций, потому что эта система была продемонстрирована с целью разрушения СКВД HBV с благоприятными эффектами (Seeger and Sohn, 2014; Kennedy et al., 2015; Zhen et al., 2015a). Seeger et al. продемонстрировал, что использование CRISPR / Cas9 в настоящее время является лучшим методом функциональной инактивации ксДНК HBV (Seeger and Sohn, 2016). Инфекция HBV может индуцировать включение фрагмента ДНК HBV в геном хозяина, который наблюдался в ~ 80% случаев гепатокарциногенеза, вызванного HBV (Bréchot, 2004; Hai et al., 2014). Интегрированная ДНК HBV может приводить к аберрантной регуляции экспрессии гена хозяина (Jiang S. et al., 2012; Jiang Z. et al., 2012; Sung et al., 2012; Xu et al., 2014) и более высокой геномной нестабильности ( Cha and Dematteo, 2005). Многие события интеграции HBV происходили вблизи или внутри хрупких сайтов и других повторяющихся областей, таких как TERT, FN1, MLL4, ROCK1, CCNE1, SENP5 (Jiang Z. et al., 2012; Sung et al., 2012; Hai et al., 2014), последовательности Alu и микросателлиты, которые склонны к развитию и прогрессированию опухоли (Feitelson and Lee, 2007). Gounder et al. продемонстрировал, что снижение риска ГЦК не связано с серологическим анализом HBsAg, и предположил, что он, вероятно, связан с наличием HKV-cccDNA и интегрированной ДНК HBV (Gounder et al., 2016). Здесь, в качестве доказательства концепции, мы использовали систему CRISPR-Cas9 для искоренения инфекции HBV и устранения стойкого генома HBV, включая полноразмерную интегрированную ДНК HBV и HSCV cccDNA, в стабильной линии клеток HBV. Эти данные свидетельствуют о том, что CRISPR-Cas9 может не только обеспечить мощный путь к радикальному или «стерильному» лечению HBV, но также обеспечить средство для блокирования канцерогенеза путем элиминации ксДНК HBV и интегрированной ДНК HBV.

Используя гРНК, нацеленные на область ядра HBV, уровень ДНК HBsAg и HBV снижался наравне с уровнем HBeAg (рис. 2B-D). В этом случае он рассматривался как глобальное сокращение cccDNA (Seeger and Sohn, 2014; Kennedy et al., 2015; Zhen et al., 2015b) для быстрой эффективности расщепления CccDNA HBV, в результате чего был достигнут высокий процент линейных ДНК который не восстанавливается, а скорее разрушается (Dong et al., 2015). Однако ингибирующее действие на гены, непосредственно нацеленные на гРНК, было сильнее, чем влияние на другие антигены HBV в предыдущих исследованиях (Lin et al., 2014; Kennedy et al., 2015). Поскольку функциональная полноразмерная интегрированная ДНК HBV также является репликационным корнем в модели HBV-трансгенных клеток (Sells et al., 1987), и эти четыре эффективных гРНК нацеливают оба конца полноразмерной интегрированной ДНК HBV, мы полагали, что это более тщательный клиренс экспрессии HBV был вызван не только глобальным сокращением cccDNA, но и удалением полноразмерной интегрированной ДНК HBV. Другой возможной причиной этого общего снижения было то, что область, на которую мы нацелились, которая содержала вирусный энхансер, ген X и ген ядра (Sung et al., 2012), имеет важное значение для репликации HBV или даже интеграции (Zoulim and Locarnini, 2009) , Поскольку конкретные механизмы репликации и интеграции HBV остаются спорными, мы ожидаем, что этот регион станет областью внимания для будущих исследований.

В моноклоне стабильной линии 69-7 клеток HBV был вырезан полноразмерный интегрированный геном HBV. Насколько нам известно, впервые заражение HBV в стабильной линии клеток HBV было полностью и полностью удалено с использованием CRISPR-Cas9. Сначала мы стремились оценить внецелевой эффект gRNA-69. Неожиданно, после секвенирования всего генома, мы идентифицировали 4,981,628 SNP в клетках HepG2.A64 и только 3834,414 SNP были обнаружены в вырезанной HBV линии клеток 69-7. Мы обнаружили, что после удаления HBV 1 175 423 SNPs в HepG2.A64 отсутствовали. Возможно, есть две возможности объяснить это открытие. Во-первых, эти избыточные SNP могут быть связаны с ограниченным охватом WGS. Во-вторых, как показали многие исследования, белки HBV, такие как HBx, HBsAg и белки ядра, могут влиять на восстановление ДНК (т. Е. NER (Jaitovich-Groisman et al., 2001; Lieber, 2010), BER (van de Klundert et al. ., 2012) или ATR (Rakotomalala et al., 2008; Wang et al., 2008)], это могло бы усугубить повреждение ДНК, препятствуя активации контрольной точки, способствуя прогрессированию клеточного цикла и в конечном итоге приводя к генетическим аберрациям. Мы предполагаем, что те недостающие SNP могли быть устранены восстановленным механизмом восстановления ДНК хозяина. Однако специфические механизмы интеграции HBV и патогенеза HBV остаются спорными, и это предложение по-прежнему нуждается в дальнейших исследованиях.

Кроме того, поскольку мы установили только один субклон с вырезом HBV без каких-либо маркеров репликации HBV и отсутствовали обильные SNP, существует вероятность того, что этот выбранный нами HBV субклон является только клеточной линией HepG2, загрязненной HepG2.A64. Чтобы исключить эту возможность, мы использовали результаты WGS с определенной остаточной последовательностью расщепления gRNA-69 / Cas9 для оценки загрязняющего вещества. Результаты показали, что вычитанный HBV моноклон 69-7 не существовал как загрязняющие вещества в стабильной линии клеток HBV A64 до трансфекции, и он был получен gRNA-69 / Cas9. В отличие от предыдущих исследований с использованием CRISPR-Cas9 для разрушения HBV, мы не только разрушили cccDNA HBV, но и охватили полноразмерную интегрированную ДНК HBV в стабильной линии клеток HBV. В линии 69-7 с вырезанной HBV клеточной линией, HBV cccDNA, супернатантная ДНК HBV, HBsAg или HBsAg не может быть обнаружена в течение 10 последовательных месяцев. Это показало, что как только корень репликации HBV в стабильной линии клеток HBV был искоренен, а инфекция HBV постоянно обнаруживалась без какой-либо обработки. В качестве разработки следующего поколения технологий секвенирования мы могли бы определить местонахождение интегрированных фрагментов ДНК HBV. Разработанный онлайн-инструмент прогнозирования gRNA может быть использован для разработки gRNAs с меньшим эффектом вне цели. Кроме того, в последние годы Adeno-Associated Virus Vectors (AAV) привлекли большое внимание в качестве системы доставки генов для лечения заболеваний человека, вызванных потерей гена или мутацией. Преимущества схемы доставки AAV включают его низкую токсичность и устойчивую экспрессию генов, которые могут распространяться до 12 месяцев после однократного введения. Эти свойства означают, что полное искоренение инфекции HBV у клинических пациентов с ХГБ будет достигнуто в ближайшем будущем.

HL, CS, YS, HS и SQ задумали исследование. HL, SW и CS культивируемых клеток и изолированной геномной ДНК. CS, HL, YH, HBL, YT и LY и проанализировали данные WGS. QL, PL, YL, ML, JZ, CY, XY, LJ, JX, LW, RH и DX — общие регенты и материалы. Все авторы прочитали и утвердили окончательную рукопись.

Эта работа была поддержана грантами Национального фонда естественных наук Китая (81371854), Пекинского научного фонда природы (7162145) и Инновационного фонда AMMS (2015CXJJ26).

Авторы заявляют, что исследование проводилось в отсутствие каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

Мы благодарим Junfeng Li, Dayang Zou, Zhihui Xu и Qi Li за обсуждения и реактивы. Мы также благодарим Исследовательский центр для отказа печени, Пекинский 302-й госпиталь за техническую поддержку.

Дополнительный материал для этой статьи можно найти в Интернете по адресу: http://journal.frontiersin.org/article/10.3389/fcimb.2017.00091/full#supplementary-material

Щелкните здесь для получения дополнительных данных.

вирус гепатита В

нуклеозидные / нуклеотидные аналоги

ковалентно замкнутая кольцевая ДНК

сгруппированные регулярно пересекаются короткий палиндромный повтор

направляющая РНК

protospacer смежный мотив

двунитевые перерывы

поверхностный антиген гепатита В

вставка или удаление

стандартное отклонение

Не гомологичное соединение конца

плазмидная безопасная АТФ-зависимая ДНКаза

усиление скользящего круга.

Комментариев нет.

Добавить комментарий

Ваш e-mail не будет опубликован. Обязательные поля помечены *