Нажмите "Enter", чтобы перейти к контенту

Оценка мутанта G145R вируса гепатита B как незначительного штамма при передаче от матери ребенку

Evaluation of the G145R Mutant of the Hepatitis B Virus as a Minor Strain in Mother-to-Child Transmission
Источник: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5094722/

Конкурирующие интересы: авторы заявили, что конкурирующих интересов не существует.

Концептуализация: HK.

Формальный анализ: HK.

Получение финансирования: HK IA.

Расследование: AI TF.

Методология: HK.

Администрирование проекта: HK AI TF.

Ресурсы: AI SU TT TS YK TF.

Письмо — оригинальная черновик: HK.

Написание — просмотр и редактирование: AI TF.

Роль мутанта вируса гепатита В (HBV) G145R с одним изменением аминокислоты 145 поверхностного белка в качестве незначительной популяции остается неизвестной при передаче от матери к ребенку. Малый штамм, а также основной штамм мутанта G145R оценивали в трех когортах с использованием фиксированной ПЦР на основе зонда на основе нуклеиновой кислоты. Прорывная когорта состояла из детей, которые родились у матерей-носителей HBV и стали носителями HBV, несмотря на иммунопрофилактику (n = 25). Контрольная когорта состояла из носителей HBV, у которых не было истории получения вакцины против гепатита B, иммуноглобулина гепатита B или антивирусной терапии (n = 126). Беременная когорта включала беременных женщин с хронической инфекцией ВГВ (n = 31). В прорывной когорте 6 показали положительные результаты ПЦР (майор, 2, минор, 4). В контрольной когорте 13 показали положительные результаты ПЦР (майор, 0, минор, 13). HBeAg-положительные пациенты были склонны к тому, чтобы мутант G145R был незначительным. Глубокое секвенирование проводили в общей сложности 32 детей (ПЦР положительный, n = 13, отрицательный, n = 19). В когорте прорыва частота мутанта G145R варьировалась от 0,54% до 6,58%. В контрольной когорте частота мутанта G145R варьировалась от 0,42% до 4,1%. Из 31 беременных женщин 4 показали положительные результаты ПЦР (майор, n = 0, минор, n = 4). Все беременные женщины были положительными для HBeAg и показали высокую вирусную нагрузку. Были оценены три ребенка, родившиеся у 3 беременных женщин с мутантом G145R. После завершения иммунопрофилактики 2 ребенка стали отрицательными для HBsAg. Оставшийся ребенок стал отрицательным для HBsAg после первой дозы HB-вакцины. G145R был обнаружен у одной четверти детей с поражением иммунопрофилактики. Однако предсуществование мутанта G145R в качестве незначительной популяции у беременных женщин не всегда вызывает прорывную инфекцию у младенцев.

Все соответствующие данные содержатся в документе и его файлах вспомогательной информации.

Хотя вакцина против гепатита B (HB), которая предотвращает передачу вируса гепатита B (HBV), была введена в плановые программы иммунизации в 183 странах к 2013 году [1], инфекция HBV остается основной проблемой глобального здравоохранения. По данным Всемирной организации здравоохранения, около 240 миллионов человек страдают от хронической инфекции HBV [1]. Люди, инфицированные хронической инфекцией HBV, имеют высокий риск развития цирроза печени и гепатоцеллюлярной карциномы. HBV передается от человека к человеку с помощью крови или жидкостей организма. Передача от матери к ребенку (ПМР) является одним из основных путей передачи, особенно в Восточной Азии. Для предотвращения передачи от матери ребенку для всех новорожденных вводится серия из трех доз вакцины против HB. В странах с промежуточным доходом и в странах с высоким доходом серия из трех доз вакцины против HB плюс иммуноглобулин гепатита В (HBIG) в сочетании с универсальной программой скрининга по беременности и родам осуществляется новорожденным детям, рожденным от матерей-носителей HBV. Сообщалось, что уровень защиты ПМР с вакциной HB плюс HBIG и только вакцина составляет 94% и 75% соответственно [2]. Хотя иммунопрофилактика с комбинацией HB-вакцины и HBIG является высокоэффективной для профилактики ПМР, от 5 до 10% младенцев, рожденных от HBeAg / HBsAg-положительных матерей, заражаются, несмотря на адекватную иммунопрофилактику [3-7]. Помимо ненадлежащей иммунизации, считается, что высокий уровень виремии матери является основной причиной отказа иммунопрофилактики [5, 6, 8-12]. В дополнение к материнской высокой вирусной нагрузке мутанты-побеги вакцин (VEM) могут играть решающую роль в иммунопрофилактической недостаточности в ПМР [13-17]. В эпоху универсальной вакцинации контроль над ВЭМ является одной из нерешенных проблем в деле искоренения ВГВ. VEM редко обнаруживаются у матерей-носителей HBV, поэтому у младенцев влияют MTCT из-за появления VEM [14, 15, 18-22]. Предполагается, что VEM являются второстепенными вариантами, которые выбраны под давлением из-за HB-вакцины и / или HBIG; поэтому эти штаммы становятся преобладающими в вирусной популяции и способствуют провалу иммунопрофилактики [14, 15]. Таким образом, оценка ВЭМ как второстепенных штаммов незаменима для выяснения механизма отказа иммунопрофилактики в ПМР. Среди VEM мутант G145R с единственной мутацией аминокислоты 145 поверхностного белка HBV, который расположен в «детерминантной области» (aa124-147), хорошо известен как наиболее вирулентный мутант в прорывных инфекциях [13, 15, 17]. Однако трудно обнаружить незначительную деформацию G145R у носителей HBV посредством секвенирования Sanger и обычную ПЦР в реальном времени. Заблокированная нуклеиновая кислота (LNA) представляет собой аналог нуклеиновой кислоты, содержащий метиленовый мост, который соединяет 2′-кислород рибозы с 4′-углеродом [23]. Введение LNA в олигомер ДНК улучшает сродство к гибридизации для комплементарных последовательностей, а зонд на основе LNA демонстрирует сильную дискриминационную способность рассогласования [24-26]. В этом исследовании мутант G145R как незначительный штамм, а также крупный штамм был обнаружен у детей с хроническим поражением HBV из-за прорывной инфекции с использованием ПЦР в режиме реального времени на основе LNA. Более того, последовательность области поверхности HBV также оценивалась с использованием глубокого секвенирования. Наконец, было проведено проспективное исследование для выяснения того, может ли отказ иммунопрофилактики у младенцев, родившихся у матерей-носителей HBV, с мутантом G145R, существующим как незначительная популяция.

С 2007 по 2015 год в этом исследовании были включены пациенты с хронической инфекцией HBV, которые посетили отделение педиатрии восточной больницы Иокогамы. Пациенты, у которых была история получения антивирусного лечения, таких как интерферон и нуклеотиды (t) -идеоиды (NA), были исключены. Более того, пациенты, которые были положительны для антител к вирусу гепатита С (HCV) и те, у кого была другая потенциальная причина хронических заболеваний печени (аутоиммунный гепатит, первичный склерозирующий холангит, болезнь Вильсона и безалкогольная жирная болезнь печени), также были исключены из исследования , Поскольку распространенность анти-HDV чрезвычайно низка (0,6%) в Японии [27], анти-HDV не измерялся в этом исследовании.

Кроме того, в этом исследовании были зачислены беременные женщины, которые были положительными для HBsAg при всеобщем скрининге на фоне второго периода беременности во втором триместре беременности в Отделе гинекологии и акушерства восточной больницы Иокогамы в период с 2007 по 2014 год. Все беременные женщины были отрицательными для вирусов против вируса гепатита C, вируса иммунодефицита человека и антител к типу 1-го типа вируса Т-клеточного лейкоза. Образцы сыворотки от HBsAg-положительных беременных женщин для этого исследования были собраны в третьем триместре беременности. Согласно протоколу восточной больницы Иокогамы, все младенцы, рожденные от HBsAg-положительных матерей, получали HBIG (200 МЕ, сушеный глобулин HB-Nichiyaku, Nihon Pharmaceutical Co. Ltd, Токио, Япония) в течение 12 часов после рождения и 3 дозы вакцины против HB (5 мкг, Bimmugen, Chemo-Sero-терапевтический исследовательский институт, Кумамото, Япония) в течение 1 недели после рождения и через 1 месяц и 5 месяцев после рождения. Сыворотку HBsAg и анти-HB измеряли у младенцев, рожденных от матерей-носителей HBV через 6 месяцев после рождения. Когда младенец был отрицательным для сывороточного HBsAg через 6 месяцев после рождения, профилактика ПМР считалась успешной.

Серологические вирусные маркеры гепатита В (HBsAg, HBeAg, анти-HBe и анти-HB) тестировали с использованием иммуноферментного анализа хемилюминесценции (EIA) (Lumipulse, FUJIREBO INC, Tokyo, Japan). Письменное информированное согласие было получено от всех родителей или законных опекунов. Это исследование было одобрено этическим комитетом больницы Восточного Иокогамы и Медицинского центра Университета Тохо (№ 2014059) и выполнено в соответствии с этическими принципами Хельсинкской декларации 1975 года.

ДНК HBV экстрагировали из 200 мкл сыворотки с использованием набора QIAamp DNA Blood Mini (QIAGEN, Hilden, Germany). Выделенную ДНК растворяли в 100 мкл буфера для элюирования. Поверхностные области генома HBV амплифицировали вложенной ПЦР с использованием двух пар праймеров, которые охватывали определенную область, которая была расположена между аминокислотами 124 и 147, как описано ранее [28]. Анализ прямого секвенирования проводили с использованием продукта ПЦР второго цикла (размер продукта: 432 п.о.). Для проверки ПЦР на основе LNA на основе зонда в реальном времени, типа мутантного типа дикого типа и G145R (положение нуклеотидов при 587: G → A) продукты ПЦР поверхности (432 п.о.) очищали и клонировали в вектор pCR4 TOPO (Invitrogen, Carlsbad, CA) и трансформировали в ТОП 10 бактерий One Shot Escherichia coli (Invitrogen). Рекомбинантную плазмидную ДНК очищали с использованием QuickLyse Miniprep (QIAGEN) и определяли концентрацию ДНК HBV с использованием спектрофотометра. Позиции нуклеотидов обозначали на основе нуклеотидных последовательностей из генотипа C (GenBank / EMBL, номер доступа AB300361). Уровни ДНК HBV в сыворотке без дискриминации между типами дикого типа и мутантов определяли с использованием теста ДНК COBAS TaqMan HBV DNA (Roche Diagnostics, Tokyo, Japan). Генотипирование HBV определяли с помощью анализа PCR-Invader [29]

Два набора парных праймеров, используемых для ПЦР в реальном времени, были следующими: вперед 1: CCATGCAAGACCTGCA (nt 512-527), обратный 1: GATGATGGGATGGGAATACA (nt 599-618); (размер ампликона: 111 п.о.), вперед 2: CTCTTGTTGCTGTACAAAACC (nt 559-579), обратное 2: AGGCCCACTCCCATAG (nt 638-653); (ампликон размером 99 б.п.). Для ПЦР в реальном времени были использованы следующие зонды на основе LNA (nt 582-591), предназначенные для различения мутанта G145R (положение нуклеотидов при 587: G → A) и дикого типа: Probe-G (последовательность дикого типа) ; 5′-FAM-CGGACGGAAA-IBFQ-3 ‘, Probe-A (последовательность мутантного типа); 5’-HEX-CGGACAGAAA-IBFQ-3 ‘(Комплексные технологии ДНК, Коралвилль, Айова). LNA-нуклеотиды выделены жирным и подчеркнутым буквами. ПЦР проводили в 25 мкл реакционной смеси, содержащей 12,5 мкл основной смеси TaqMan Universal PCR (Applied Biosystems, Foster City, CA) с 0,2 мкМ праймерами, 0,1 мкМ зондами и 5 мкл экстрагированной ДНК. Программа ПЦР состояла из начальной инкубации перед циклом при 50 ° С в течение 2 мин и 95 ° С в течение 10 мин с последующим 40 циклами 95 ° С в течение 15 с и 60 ° С в течение 1 мин. ПЦР-анализ проводили в MX3000P (Agilent Technologies, Santa Clara, CA), и результаты анализировали с помощью программного обеспечения MxPro (версия 3.0). Нижний предел обнаружения составлял> 1000 копий / мл. Все анализы проводили в трех повторностях с отрицательными контрольными образцами. ДНК дикого типа и G145R-мутантного типа, выделенную из сыворотки, определяли количественно в соответствии с рекомбинантными регуляторами дикого типа плазмиды, а мутантный тип G145R (положение нуклеотида при 587: G → A) контролировал соответственно.

Поверхностную область генома HBV амплифицировали (432 п.о.) с помощью вложенной ПЦР, как описано ранее [28]. Внешние праймеры были объединены с несколькими идентификаторами и 454 конкретными адаптерами. Все образцы амплифицировали с помощью корректурного фермента (фермент высокой достоверности, ДНК-полимеразы PrimeSTAR MAX, TaKaRa Bio) в ПЦР. ПЦР-ампликоны очищали с использованием AMPure XP (Beckman Coulter, Danvers, MA) и количественно определяли с использованием MulTiNA (Shimazu, Kyoto, Japan). Первый раунд ПЦР проводили в 35 циклах (денатурация при 98 ° С в течение 10 с, отжиг при 55 ° С в течение 5 с и удлинение при 72 ° С в течение 30 с), а второй раунд ПЦР выполняли в 25 циклах при тех же условиях, что и в первом раунде. ПЦР-ампликоны каждого пациента объединяли и подвергали ультра-глубокой пиросеквенированию, проводимой с младшим секвенсором Roche GS. Последовательные чтения были выровнены с эталонной последовательностью HBV генотипа HBV C (номер доступа GENBank / EMBL AB300361) с использованием инструмента выравнивания BWA (0.7.6) (https://sourceforge.net/projects/bio-bwa/files). Анализ глубины чтения и подсчета базы был отображен с использованием GATK (https://www.broadinstitute.org/gatk/download). Рекомбинантный плазмидный клон HBV с известной последовательностью амплифицировали в трех повторностях, и проводили ультра-глубокое упорядочение для проверки технических ошибок. Средний охват трех контрольных экспериментов составил 6 757 (диапазон от 5,803 до 8,438). Скорость технических ошибок составляла от 0,20% до 0,24% (несоответствия) и от 0,15% до 0,39% (вставки / удаления). Таким образом, точность ультра-глубокого секвенирования в этой платформе для обнаружения вирусных мутаций низкого уровня считалась более 0,4%. Более того, 10 или более счетчиков нуклеотидной мутации считались действительными в предотвращении технической ошибки.

Однозначные тесты ассоциации для категориальных характеристик пациента выполнялись с помощью теста хи-квадрат Пирсона, если бы каждый из клеток в ячейке был не менее 5 и в то же время с точным тестом Фишера. Для непрерывных переменных использовался критерий ранговой суммы Манна-Уитни-Вилкоксона. Для многовариантных тестов ассоциации использовалась логистическая регрессия. Для всех статистических обобщений и анализов использовалось программное обеспечение Stata MP (версия 14.1, StataCorp LP, College Station, TX). Значение р 0,05 или менее считалось статистически значимым для всех испытаний.

В этом исследовании было зарегистрировано сто пятьдесят один пациент (M / F = 64/87, возраст: средний 15 лет) с хронической инфекцией HBV. Из 151 пациента 119 были включены в наше предыдущее исследование [28]. Субъекты были разделены на две когорты. Одним из них была контрольная когорта, включающая пациентов, у которых не было истории приема HB-вакцин или HBIG. Другая была когорта прорыва, включающая пациентов, родившихся у матерей-носителей HBV, у которых была прорывная инфекция, несмотря на иммунопрофилактику серией из трех доз вакцины против HB плюс HBIG. Из 151 пациента, 126 (M / F = 53/73, возраст: медиана 17 лет) были классифицированы как контрольная когорта. Остальные 25 пациентов (M / F = 11/14, возраст: медиана 5 лет) были классифицированы как прорывная когорта. Характеристики 126 пациентов, принадлежащих к контрольной когорте, приведены в таблице 1. Из этих 126 пациентов 75 (60%) были положительными для HBeAg, а подавляющее большинство (87%) показало HBV-генотип C. Хотя примерно половина (54 %) субъектов заразились через ПМР, 45 (36%) были инфицированы с помощью неизвестных передач источника. Характеристики 25 пациентов, которые принадлежали к прорывной когорте, показаны в таблице 2. Эти пациенты были моложе контрольных пациентов. Из этих 25 пациентов 22 (88%) были положительными для HBeAg, а средний уровень ДНК HBV в сыворотке составлял 8,5 log копий / мл.

* Генотип C против не-генотипа C

** Передача от матери к ребенку против передачи от матери к ребенку

Прямое секвенирование проводилось у 126 пациентов (контрольная когорта) и у 25 пациентов с прорывной инфекцией (прорывной когорты). Ни у одного из пациентов, принадлежащих к контрольной когорте, не было доказательств мутанта G145R. Однако из 25 пациентов, принадлежащих к прорывной когорте, у 2 (8%) был мутант G145R (GGA → AGA), а у одного (4%) был мутант G145K (GGA → AAA).

Для оценки специфичности зонда, основанного на LNA, использовали ДНК-рекомбинантную плазмидную ДНК типа дикого типа и G145R (нуклеотидное положение при 587: G → A) для ПЦР в реальном времени на основе LNA. Поскольку высокий уровень вирусной ДНК вызывал ложные положительные результаты в нашем предыдущем исследовании [28], мы первоначально оценивали специфичность зондов LNA с использованием высоких уровней плазмидной ДНК. Когда ДНК плазмиды дикого типа (2 × 1011 копий / мл) применяли к ПЦР в реальном времени, мутант G145R был необнаружимым. Аналогичным образом, когда плазмидную ДНК мутантного типа G145R (5 × 1010 копий / мл) применяли в ПЦР в реальном времени, дикий тип также не определялся. Хотя специфичность ПЦР на основе ДНК на основе LNA оценивалась на разных уровнях ДНК плазмиды в диапазоне от 1011 копий / мл до 103 копий / мл, зонды LNA не показали ни ложных отрицательных результатов, ни ложноположительных результатов. Более того, мы подтвердили, что ПЦР в реальном времени на основе LNA может обнаруживать 1000 копий / мл или более как в ДНК плазмиды типа дикого типа, так и в G145R. Затем мы оценили способность распознавания LNA-основанного зонда между плазмидной ДНК дикого типа и G145R в смеси мутантной ДНК дикого типа и G145R. Мутантные плазмиды дикого типа и G145R были смешаны в 25-литровой ПЦР-смеси следующим образом: (A) дикий: мутант = 2: 1, дикий тип [2 × 108 копий / мл] и мутантный тип [1 × 108 копий / мл] смешивали, (B) дикий: мутант = 20: 1, дикого типа [2 × 108 копий / мл] и мутантного типа [1 × 107 копий / мл] смешивали, (C) дикого : мутант = 200: 1, дикого типа [2 × 108 копий / мл] и мутантного типа [1 × 106 копий / мл] были смешаны и (D) дикие: мутанты = 2000: 1, тип [2 × 108 копий / мл] и мутантный тип [1 × 105 копий / мл] были смешаны. Зонд на основе LNA мог детектировать ДНК плазмиды мутантного типа как незначительную популяцию в большинстве плазмидных ДНК дикого типа (дикий: мутант = 2: 1, 20: 1 и 200: 1). Однако, когда отношение мутант / дикий составляло 1: 2000 (0,05%), этот зонд на основе LNA не обнаруживал мутантную плазмидную ДНК как незначительную популяцию в большинстве плазмидных ДНК дикого типа. Эти данные свидетельствуют о том, что более низкое ограничение отношения мутантов / диких было 1/200 (0,5%).

Из 126 пациентов в контрольной когорте 13 (10,3%) показали положительные результаты для ПЦР в реальном времени на основе МНК (таблица 1). У всех 13 пациентов был мутант G145R в качестве младшего населения. В контрольной когорте наблюдались пара братьев и сестер (№ 143 и 144 в таблице 3) и пара матери и ребенка (№ 107 и 108 в таблице 3). В таблице 1 показаны прогностические факторы для обнаружения мутанта G145R. Возраст, пол, уровень ДНК HBV, HBeAg, генотип HBV (генотип C) и маршрут передачи (MTCT) оценивались для связи с обнаружением G145R. Одномерный анализ показал, что положительность HBeAg тесно связана с обнаружением мутанта G145R (p = 0,05). Однако многомерный анализ показал, что положительность HBeAg не была достоверно связана с обнаружением мутанта G145R (p = 0,12).

* ПЦР-клонирование было выполнено в нашем предыдущем исследовании (ref.No.28).

** Частота мутаций не считалась действительной. А ТАКЖЕ; не выполнено

В отличие от контрольной когорты 6 (24%) из 25 пациентов в прорывной когорте показали положительные результаты для ПЦР в реальном времени на основе МНК (таблица 2). Из этих 6 пациентов 2 был мутантом G145R в качестве основного штамма, что соответствовало результатам прямого секвенирования. Остальные 4 пациента имели мутант G145R в качестве незначительного штамма. Положительная скорость прорывной когорты была примерно в 2 раза выше, чем у контрольной когорты. Хотя отказ иммунопрофилактики был связан с обнаружением мутанта G145R, не было существенной разницы в положительной скорости от ПЦР в реальном времени между двумя когортами (значение OR = 2,74, 95% ДИ: 0,93-8,10, P = 0,06). Одномерный анализ показал, что не было прогностического фактора для обнаружения G145R в прорывной когорте (таблица 2).

Характеристики пациентов, которые показали положительные результаты для ПЦР в реальном времени на основе МНК, показаны в таблице 3. В нашем предыдущем исследовании присутствие мутанта G145R оценивали путем клонирования продукта ПЦР [28]. Из 19 пациентов с положительными результатами для ПЦР в реальном времени на основе МНК в этом исследовании 10 (прорывная когорта, 1, контрольная когорта, 9) оценивали путем клонирования продукта ПЦР в нашем предыдущем исследовании. Из этих 10 пациентов 7 (прорывная когорта, 1, контрольная когорта; 6) уже были подтверждены наличием мутанта G145R в качестве второстепенной формы в предыдущем исследовании [28]. Однако оставшиеся 3 пациента были отрицательными для мутанта G145R на основе клонирования и секвенирования ПЦР-продуктов в нашем предыдущем исследовании. Эти данные свидетельствуют о том, что ПЦР в реальном времени на основе МНК превосходит метод клонирования при обнаружении мутанта G145R и может различать мутант G145R, существующий как низкий процент избыточной вирусной популяции дикого типа.

Количественные определения ДНК дикого типа и мутантной ДНК G145R были выполнены у 19 пациентов, которые показали положительные результаты для ПЦР в реальном времени на основе МНК. Отношение G145R мутантной ДНК к ДНК дикого типа (мутантное / дикое отношение) показано в таблице 3. Из двух пациентов, у которых был мутант G145G в качестве преобладающего штамма (пациенты № 52 и 136), один был отрицательным для дикого , а другой показал соотношение мутантов / диких более 100%. Остальные 17 пациентов имели мутант G145R в качестве незначительной популяции, а соотношение мутантов / диких составляло от 2% до 50%. Как показано в таблице 3, отношение мутантов / диких, вычисленное на основе ПЦР в реальном времени на основе МНК, соответствовало мутантно-дикому соотношению, вычисленному по методу клонирования.

Было две задачи, когда мы выполняли глубокую последовательность. Одним из них было подтверждение существования мутанта G145R как незначительное напряжение. Другим было оценить связь между другими ВЭМ как незначительными штаммами и прорывными инфекциями в ПМР. Глубокое секвенирование проводилось у всех 25 пациентов, которые принадлежали к прорывной когорте, и 7 пациентов, принадлежащих к контрольной когорте, которые были положительными для ПЦР в реальном времени на основе МНК, но у которых мутант G145R не был подтвержден клонированием продукта ПЦР. Среднее покрытие на образец составляло 8 768 прочтений (диапазон: от 344 до 18 523). Из 25 пациентов в прорывной когорте 6 показали, что частота мутации G145R (положение нуклеотида при 587: G → A) составляет 0,4% или более (таблица 3); все эти пациенты показали положительные результаты для ПЦР в режиме реального времени на основе МНК. Частота мутации G145R варьировалась от 0,54% до 6,58% у 4 пациентов, принадлежащих к прорывной когорте с мутантом G145R, в качестве незначительного штамма. Из 7 пациентов, принадлежащих к контрольной когорте, частота мутации G145R составляла 0,4% или более во всех, кроме одного. Частота G145R колебалась от 0,42% до 4,10%. У одного пациента, который был положительным для ПЦР в реальном времени на основе МНК, частота мутации G145R составляла 0,25%, что считалось недействительным. В отличие от ПЦР-положительных пациентов на основе LNA на основе LNA частота мутации G145R варьировалась от 0% до 0,0007% у 18 из 19 пациентов, которые были отрицательными для ПЦР в реальном времени. Поскольку у оставшегося пациента был мутант G145K (GGA → AAA) в качестве основного штамма, что было подтверждено прямым секвенированием, частота изменения G-A на nt.587 составляла 98,6%. Эти данные показали, что ПЦР в реальном времени на основе МНК может точно определить мутант G145R как незначительную популяцию. Мы ретроспективно оценили 4 из 6 матерей-носителей HBV, чьи дети были положительными для ПЦР в реальном времени на основе МНК в прохождении когорты (основной штамм G145R, № 52 и № 136, незначительная деформация, № 35 и № 139 ). Из 4 матерей-носителей HBV одна (мать № 136) показала положительный результат для ПЦР в режиме реального времени на основе МНК. Мутант G145R также не обнаруживался у остальных 3 матерей путем глубокого секвенирования. Более того, глубокая последовательность не могла обнаружить мутант G145K у матери, чей ребенок был инфицирован G145K как основная популяция. Частота мутации путем глубокого секвенирования была в 10 раз ниже, чем в методе клонирования и в ПЦР в реальном времени на основе МНК.

Исходя из результатов глубокого секвенирования, мы оценили частоту изменений аминокислот, включая основные и второстепенные популяции (частота> 0,4% и количество мутаций> 10) в области «а». Как показано в таблице 4, тридцать два пациента, которые были оценены методом глубокого секвенирования, были разделены на 4 группы: (A) прорыв с LNA отрицательным; n = 18, (B) прорыв с положительным LNA; n = 4, (C) контроль с положительным LNA; n = 7 и (D) прорыв с крупностью G145R или G145K; n = 3. Частота изменений аминокислот в области «a» детерминант на пациента составляла 0,5, 1,8, 3,3 и 5,3 в группах A, B, C и D соответственно. Появление мутанта G145R показало положительную связь с аминокислотными мутациями в области «а» -детерминанта. Наибольшая частота изменений аминокислот наблюдалась у детей с мутантом G145R / K в качестве основной популяции. Эти данные свидетельствуют о том, что сильное иммунологическое давление, влияющее на всю «а» детерминантную область, необходимо для получения мутанта G145R / K как основной популяции. Распределение аминокислотных мутаций в области «а» детерминанта показано на рисунке 1. В прорывной когорте мутант T / I126S показал вторую самую высокую частоту. Однако мутант T / I126S не обнаруживался в прорывной когорте с мутантом G145R / K в качестве основной популяции. Напротив, мутант T / I126S был обнаружен у 4 (22%) из 18 пациентов, которые были отрицательными для ПЦР в реальном времени на основе МНК в прохождении когорты. Глубокое секвенирование показало, что проксимальные мутации (положение аминокислот, 143 и 144) G145R были более обнаружимыми у пациентов с положительной реакцией на L14 положительно, чем у пациентов с LNA-отрицательным G145R. Эти данные свидетельствуют о том, что мутация G145R, как правило, сопровождается проксимальными мутациями, индуцированными иммунологическим давлением хозяина.

В одной коробке указывается один пациент. Ярко-белая коробка указывает на изменение аминокислоты, которое существует как незначительная популяция. Серая цветная коробка указывает на изменение аминокислоты, которое существует как преобладающая популяция.

В период с 2007 по 2014 год в исследование было включено 31 беременная женщина (возраст: 21-39 лет, средний 32 года, положительный HBeAg, n = 14, уровни ДНК HBV: медиана 4,4 log копий / мл). Из 31 беременных женщин 4 (12,9%) показали положительные результаты для ПЦР в реальном времени на основе МНК, и у всех из них был мутант G145R как незначительная популяция. Прогностические факторы G145R у беременных женщин показаны в таблице 5. Все 4 беременные женщины с мутантом G145R были положительными для HBeAg, инфицированных генотипом C и показали высокую вирусную нагрузку (7,8 log копии / мл или более) до Доставка. Хотя HBeAg-положительный статус показал тесную связь с мутантом G145R, одномерный анализ показал, что между HBeA-положительным статусом и обнаружением мутанта G145R (p = 0,07) не было достоверной связи. Результаты новорожденных, рожденных от HBV-носителей с G145R, показаны в таблице 6. Соотношение ДНК G145R / дикого HBV-ДНК варьировалось от 1,5% до 60%, а частота мутации G145R, оцененная по глубине, составляла от 1,5 до 23,8% , Однако одна беременная женщина вышла из этого исследования до родов. Из оставшихся 3 беременных женщин у одного был 3-летний ребенок, который был инфицирован G145R в качестве основной формы, несмотря на иммунопрофилактику (№ 136 в таблице 3). У трех беременных женщин родилось трое младенцев, и ни один из них не подвергся кесаревому сечению. Через месяц после завершения иммунопрофилактики 2 ребенка стали отрицательными для HBsAg и были положительными для анти-HB (136 мМЕ / мл и 925,9 мМЕ / мл). Более того, они также показали отрицательные результаты для независимой от генотипа ПЦР в реальном времени [30]. Оставшийся ребенок стал отрицательным для HBsAg и независимой от генотипа ПЦР в реальном времени после первой дозы HB-вакцины, а затем отказался от этого исследования. Эти данные свидетельствуют о том, что предсуществование мутанта G145R как незначительного штамма у беременных матерей не всегда вызывало прорывную инфекцию у детей.

* Отказ от неонатальной иммунопрофилактики произошел у первого ребенка матери (первый ребенок, когорта № 136)

** Младенец бросил мать после рождения.

Поскольку VEM редко обнаруживаются секвенированием Sanger у матерей, чьи дети страдают от прорывной инфекции, есть две гипотезы, которые могли бы объяснить механизм возникновения VEM в MTCT [31-33]. Один из них заключается в том, что ВЭМ, ранее существовавшие в небольших популяциях у матерей до родов, были выбраны в качестве преобладающих штаммов под иммунологическим давлением, индуцированным иммунопрофилактикой. Другая — мутация de novo, которая естественным образом происходит во время активной репликации HBV, включающей стадию обратной транскрипции, подверженной ошибкам, после того, как младенец инфицирован HBV [34, 35]. Предыдущее исследование, проведенное в Великобритании, показало, что VEM были обнаружены в сыворотке антенатальных матерей в 2 случаях неудачной послеродовой иммунопрофилактики с использованием системы амплификации тугоплавких мутаций (ARMS) [36]. Однако это предыдущее исследование было ретроспективным исследованием и не показало вирусной нагрузки VEM и не обнаружило мутанта G145R. В отличие от предыдущего исследования, настоящее исследование показало, что иммунопрофилактика серией из трех доз вакцины против HB плюс HBIG может предотвратить прорывную инфекцию у детей, рожденных беременными женщинами, инфицированными мутантом G145R, существующим как незначительная популяция. В дополнение к мутанту G145R эти матери показали очень высокий уровень сывороточной ДНК HBV (7,8 log копий / мл или более). Исходя из результатов количественной ПЦР в реальном времени и глубокого секвенирования, популяция с мутантом G145R варьировалась от 1% до 60% от общей численности беременных матерей. Таким образом, кровь у матерей содержала не менее 6 копий локуса / мл мутанта G145R, что представляет собой высокую вирусную нагрузку. Материнская вирусная нагрузка хорошо известна как наиболее важный вклад в прорывную инфекцию в ПМР [7, 10, 37]. До того, как это исследование было проведено, мы предположили, что уровни ДНК ВЭБ в ВГВ также могут быть одним из наиболее влиятельных факторов для прорывной инфекции. Фактически, хотя у 3 матерей были высокие уровни ДНК HBV мутанта G145R, которые, как считается, увеличивают риск прорывной инфекции, выбор ранее существовавшего мутанта G145R не наблюдался у их детей после рождения. Поэтому это исследование не подтвердило «существовавшую теорию». Более того, наша ретроспективная оценка матерей, чьи дети стали носителями HBV, несмотря на иммунопрофилактику, не полностью поддерживала «существовавшую теорию». Мутант G145R был обнаружен у 13% беременных женщин в этом исследовании, и эта частота была практически идентична той, которая была обнаружена в контрольной группе. В Японии вакцины против HB не были введены в рутинную программу вакцинации. Поэтому частота ВЭМ, по-видимому, оставалась стабильной на протяжении многих лет. Таким образом, предполагается, что примерно 10% младенцев, рожденных от носителей HBV, были подвергнуты воздействию мутанта G145R, существующего как незначительное напряжение в течение длительного времени. Тем не менее, частота отказа иммунопрофилактики в Японии составляет от 2% до 5% [38]. Принимая во внимание эти обстоятельства, мутант G145R как незначительная популяция не всегда способствует возникновению прорывной инфекции. Хорошо известно, что HBV является лимфотропным, а также гепатотропным. Предыдущие исследования показали, что мутант G145R часто обнаруживается в лейкоцитах периферической крови у пациентов с HBsAg-положительным и отрицательным [39, 40]. Более того, сохраняющиеся лимфоузлы HBV способствуют оккультной инфекции HBV. При специфическом гуморальном давлении против HBs разделение HBV в лимфоцитах и ​​мутация G145R-побега выгодны для сохранения HVV и выживания. Тем не менее, в настоящем исследовании не проводилось исследование лимфомы периферической крови лейкоцитов. Исследование лейкоцитов периферической крови может послужить еще одним ключом к выяснению механизма прорывной инфекции в ПМР.

Чтобы обнаружить незначительные варианты среди преобладающего штамма дикого типа, в этом исследовании использовалась ПЦР в реальном времени на основе LNA. Предел дискриминации ПЦР в реальном времени на основе МНК был 0,5% от всей вирусной популяции, но нижний предел обнаружения ПЦР в реальном времени составил> 1000 копий / мл. Этот метод прост, коммерчески доступен и намного дешевле, чем глубокая последовательность. Аналогичным образом, различные специальные методы, такие как ARMS, комбинация ПЦР в реальном времени с анализом кривой плавления, анализы цепной лигазной цепи, предельная клонирование ПЦР-разведения и комбинация ПЦР в реальном времени с мелкими связующими зондами и нуклеиновыми кислотами, имеют были использованы для обнаружения мелких вариантов в гетерогенной популяции [33, 36, 41-43]. Пределы дискриминации для этих методов заключаются в следующем: ARMS — всего 5%; сочетание ПЦР в реальном времени с анализом кривой плавления, как мало 5%; (gLCR), от 1% до 5%; ограничение клонирования клонирования ПЦР, 0,1%; и комбинация ПЦР в реальном времени с небольшим зондирующим зондом и нуклеиновой кислотой 0,01%. ПЦР в режиме реального времени на основе ЛС сопоставима с этими методами с точки зрения предела дискриминации. Кроме того, мы сравнили соотношение мутантов / диких ДНК G145R, количественно определяемое с помощью ПЦР в реальном времени на основе LNA, с частотой мутации G145R, обнаруженной глубоким секвенированием. Глубокое секвенирование обнаружило мутант G145R, который был обнаружен с помощью ПЦР в реальном времени на основе LNA в каждом пациенте, кроме одного. Эти данные свидетельствуют о том, что оба метода имеют одинаковую чувствительность к мутанту G145R как второстепенную популяцию среди преобладающей популяции дикого типа. Однако расчетная частота мутанта G145R была значительно ниже при глубоком секвенировании, чем в ПЦР в реальном времени на основе LNA. У нас нет достаточных данных, чтобы определить, какой метод является более точным для измерения доли мелких и крупных штаммов. Используя анализ gLCR, отношение мутантной ДНК G145R к ДНК дикого типа варьировалось от приблизительно 3% до 74% в сыворотке от различных носителей HBV [42]. Хотя используемый метод ПЦР был иным, отношение ДНК дикой / мутантной ДНК в нашем анализе показало аналогичный уровень, как в предыдущем исследовании. Ни анализ gLCR, ни ПЦР в реальном времени на основе LNA не показали отношения мутантной ДНК G145R к ДНК дикого типа менее 1%. Точность количественного определения зависит от отношения мутантной ДНК G145R к ДНК дикого типа. Поскольку отношение достигало предела обнаружения (дикий: мутант = 200: 1), ПЦР в реальном времени на основе МНК не могла точно определить уровень ДНК мутантной G145R (данные не показаны). Это открытие подчеркивает расхождение в частоте мутанта G145R между ПЦР в реальном времени на основе МНК и глубоким секвенированием.

Глубокое упорядочение показало, что самая высокая частота изменений аминокислот, включая незначительные популяции в «детерминантной области», наблюдалась у пациентов, у которых в качестве преобладающего штамма был мутант G145R или G145K. Самая низкая частота наблюдалась у пациентов, у которых не было мутанта G145R в качестве незначительной популяции. Эти данные показали, что появление мутанта G145R сопровождалось другими изменениями аминокислот в области «а». Поскольку изменения аминокислот считаются отражением иммунологического давления, этот вывод поддерживает иммунологическое давление, необходимое для индукции появления ВЭМ. Анти-HB представляют собой мощный иммунологический фактор для борьбы с инфекцией HBV. Из 3 пациентов, у которых был мутант G145R в качестве основной популяции, HBsAg и анти-HBs сосуществовали в 2. Исследование, проведенное в Франции, показало, что сосуществование HBsAg и анти-HB связано с увеличением «a» вариации детерминанты в пациентов с хронической инфекцией HBV [44]. Результаты настоящего исследования показывают, что сосуществование HBsAg и анти-HBs является сильным предиктором появления VEM в качестве преобладающей популяции в ПМР.

За исключением сосуществования HBsAg и анти-HBs, предсказатели присутствия мутанта G145R остаются неизвестными. Мутация поверхностного гена HBV зависит от нескольких факторов, таких как возраст, прогрессирование заболевания, статус HBeAg и генотип HBV [45-48]. В контрольной когорте этого исследования пациенты с HBeAg-положительным были склонны к тому, что мутант G145R был незначительным. В дополнение к контрольной когорте все 4 беременных матери, которые были положительными для ПЦР в реальном времени на основе МНК, также были положительными для HBeAg. Однако эти наблюдения несовместимы с предыдущим исследованием, в котором показано, что присутствие анти-HBe положительно связано с количеством встречающихся в природе аминокислотных мутаций в области «а» -рецептора [49]. Другое исследование показало, что частота мутаций аминокислот в области поверхности HBV у пациентов с низкой вирусной нагрузкой была намного выше, чем у пациентов с высокой вирусной нагрузкой [50]. Поскольку показатели сывороточной аланинаминотрансферазы (ALT) были нормальными или пограничными, и была высокая вирусная нагрузка у всех пациентов, которые были положительными для ПЦР в реальном времени на основе МНК, они считаются иммуно-толерантными фазами [ 51]. На этом этапе HBV является высокорепликативным, но иммунный ответ хозяина является толерантным к HBV. Поэтому иммунологическое давление для индуцирования мутаций аминокислот / нуклеотидов, по-видимому, не происходит. Хотя в предыдущих исследованиях были проанализированы вирусные последовательности с использованием секвенирования Сэнгера, этот метод не может выявлять незначительные популяции, которые составляют менее 20% от общей численности населения [52, 53]. Дальнейшие исследования необходимы для подтверждения связи между HBeAg-положительным статусом и мутантом G145R с помощью чувствительных систем обнаружения или глубокой последовательности. В предыдущем исследовании был обнаружен мутант G145R как незначительная популяция (22,66%) с использованием ультра-глубокого пиросеквенирования у беременной женщины с высокой вирусной нагрузкой (7,83 л / мл) [54]. Кроме того, лечение ламивудином в течение третьего триместра уменьшало популяцию мутантов G145R до 0,9% через 2 недели после родов (ДНК HBV, 5,37 МЕ / мл), а прорывная инфекция никогда не возникала у младенцев. Недавние клинические рекомендации рекомендовали, чтобы беременные женщины с высокой вирусной нагрузкой (> 200 000 МЕ / мл или> 106 log копий / мл) и HBeAg должны лечиться НС, чтобы снизить риск отказа иммунопрофилактики в ПМР [7, 10, 37, 55 , 56]. Если HBeAg-положительный статус значительно связан с мутантом G145R у беременных матерей, эти рекомендации также будут эффективны в снижении прорывных инфекций, вызванных мутацией G145R.

В заключение, частота мутанта G145R как незначительного, так и основного штамма была примерно у четверти у детей, которые были инфицированы из-за отказа иммунопрофилактики. HBeAg-положительные пациенты без истории вакцинации HB, HBIG или противовирусного лечения имели склонность к мутанту G145R как второстепенную популяцию, но положительность HBeAg не проявляла значительной связи с обнаружением мутанта G145R как незначительной популяции. Хотя мутант G145R как незначительное популяция обнаружен у беременных женщин, которые были HBeAg-положительными и имели высокую вирусную нагрузку, ни один из младенцев, рожденных от матерей, инфицированных мутацией G145R, не обнаружил прорывной инфекции. Таким образом, предсуществование мутации G145R как незначительной популяции у матерей не всегда приводит к потере иммунопрофилактики после рождения. Тем не менее, лечение NA для беременных женщин-переносчиков HBV, основанных на HBeAg-положительном статусе и уровне ДНК HBV, должно поощряться для снижения риска прорывной инфекции.

Показан предел для обнаружения мутантной ДНК G145R в смеси избыточной ДНК дикого типа. Отношение ДНК дикого типа к мутантной ДНК G145R дикое: мутант = 2: 1. ДНК-мутантный тип G145R отличался от ДНК дикого типа.

(TIF)

Щелкните здесь для получения дополнительных данных.

Показан предел для обнаружения мутантной ДНК G145R в смеси избыточной ДНК дикого типа. Отношение ДНК дикого типа к мутантной ДНК G145R дикое: мутант = 20: 1. ДНК-мутантный тип G145R отличался от ДНК дикого типа.

(TIF)

Щелкните здесь для получения дополнительных данных.

Показан предел для обнаружения мутантной ДНК G145R в смеси избыточной ДНК дикого типа. Отношение ДНК дикого типа к мутантной ДНК G145R дикое: мутант = 200: 1. ДНК-мутантный тип G145R отличался от ДНК дикого типа.

(TIF)

Щелкните здесь для получения дополнительных данных.

Показан предел для обнаружения мутантной ДНК G145R в смеси избыточной ДНК дикого типа. Отношение ДНК дикого типа к мутантной ДНК G145R дикое: мутант = 2000: 1. Зонд на основе LNA не мог обнаружить мутант G145R в смеси с отношением 2000: 1.

(TIF)

Щелкните здесь для получения дополнительных данных.

вирус гепатита В

от матери к ребенку-передачи

мутанты с выделением вакцины

иммуноглобулин гепатита В

запертая нуклеиновая кислота

нуклеотиды (t) ide

усилительная огнеупорная мутационная система

анализ реакции цепной лигазы

Комментариев нет.

Добавить комментарий

Ваш e-mail не будет опубликован. Обязательные поля помечены *