Нажмите "Enter", чтобы перейти к контенту

CRISPR / Cas9 расщепление вирусной ДНК эффективно подавляет вирус гепатита В

CRISPR/Cas9 cleavage of viral DNA efficiently suppresses hepatitis B virus
Источник: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4649911/

Эти авторы внесли одинаковый вклад в эту работу.

Текущий адрес: Институт печени, Медицинский центр Рабина, больница Бейлинсона и Медицинский факультет Саклера, Тель-Авивский университет, Тель-Авив, Израиль

Хроническая инфекция вирусом гепатита В (HBV) распространена, смертельна и редко излечивается из-за стойкости вирусной эписомальной ДНК (cccDNA) в инфицированных клетках. Недавно разработанные инструменты для создания генома могут предлагать возможность прямого расщепления вирусной ДНК, тем самым способствуя вирусному разминированию. Здесь мы показываем, что система CRISPR / Cas9 может специально нацеливать и расщеплять консервативные области в геноме HBV, что приводит к устойчивому подавлению экспрессии и репликации вирусных генов. При устойчивой экспрессии Cas9 и соответственно выбранных ориентированных РНК мы демонстрируем расщепление cccDNA на Cas9 и резкое снижение как cccDNA, так и других параметров экспрессии и репликации вирусных генов. Таким образом, мы показываем, что непосредственное нацеливание на вирусную эписомальную ДНК представляет собой новый терапевтический подход к контролю над вирусом и, возможно, к лечению пациентов.

Вирус гепатита B (HBV) хронически заражает более 250 миллионов человек во всем мире. У хронически инфицированных людей повышенный риск смертельных осложнений, включая цирроз, конечную стадию заболевания печени и гепатоцеллюлярную карциному, приводит к приблизительно 600 000 смертей в год1. HBV является членом семейства Hepadnaviridae, и его жизненный цикл включает как промежуточные продукты ДНК, так и РНК. Геном HBV существует в ядрах инфицированных гепатоцитов в виде двухцепочечных эпизодических ДНК с длиной волны 3.2kb, называемых ковалентно замкнутой кольцевой ДНК (cccDNA). cccDNA является ключевым компонентом жизненного цикла HBV, поскольку он является шаблоном для всех вирусных геномных и субгеномных транскриптов2. В настоящее время одобренная терапия HBV действует посттранскрипционно, чтобы ингибировать репликацию вируса и, таким образом, не нацеливает или исключает пул cccDNA, который проявляет исключительную стабильность и стойкость3. Следовательно, эти препараты часто нужно принимать на неопределенный срок, чтобы предотвратить вирусный отскок. Агенты, которые действуют непосредственно на вирусную ДНК для истощения этого резервуара, могут представлять собой более желательные и, возможно, лечебные терапевтические альтернативы4.

С этой целью целенаправленные нуклеазы могут обеспечить эффективный и конкретный способ повреждения генома HBV, избегая геномной ДНК хозяина567. Целевые нуклеазы катализируют образование двухцепочечных разрывов ДНК (DSB), что приводит к образованию мутагенных вставок и делеций (indels) с помощью подверженного ошибкам негомологичного концевого соединения (NHEJ) в целевом локусе ДНК. Недавно система II типа CRISPR-Cas из Streptococcus pyogenes SF370 была адаптирована как ДНК-нуклеаза, специфичная для последовательности РНК, для использования в клетках млекопитающих89. CRISPR / Cas9 и другие технологии разработки генома были использованы для разработки кандидатских терапевтических средств с помощью нацеливания генов, нокаута полезных генов-хозяев и мутации интегрированных вирусов10, и мы стремились продолжить изучение применения CRISPR / Cas9 для прямого нацеливания и расщепления HBV ковалентно замкнутую кольцевую ДНК. Мы предположили, что путем прямого нацеливания на геном HBV для расщепления с использованием CRISPR / Cas9 мы могли бы подавить HBV путем мутагенерации критических геномных элементов или снижения стабильности cccDNA и других вирусных промежуточных соединений путем повторной линеаризации круговых геномов (рис.1a).

Используя онлайн-инструмент CRISPR (http://www.genome-engineering.org/crispr/), мы создали 24 одноканальных РНК (sgRNAs), нацеленных на геном HBV (рис.1b, таблица S1). Целевые последовательности были выбраны для максимизации сохранения по вирусным генотипам (рис. S1) и минимизации гомологии с геномом человека. Исходя из этих критериев, мы разработали только направляющие, ориентированные на ядро, полимеразу и X ORF, но в S ORF также присутствуют многочисленные целевые сайты Cas9 (рис.1b). Чтобы оценить эффективность выбранных sgRNAs (фиг.1b) при нацеливании на HBV, мы совместно трансфецировали клеточную линию гепатомы HepG2 с HBV-экспрессирующей плазмидой и конструировали экспрессию Cas9 и отдельных gRNAs и измеряли продуцирование РНК HBV 3.5kb (кодирование предгеномную РНК (pgRNA), шаблон для обратной транскрипции), а также секрецию поверхностного антигена HBV (HBsAg) в среду, два надежных индикатора экспрессии и репликации вирусного гена (фиг.1c). sgRNAs 17 и 21 (sg17 и sg21) последовательно приводили к снижению уровней pgRNA и HBsAg (рис.1d, e). В то время как другие sgRNAs (sg14 и sg19) вызывали подобное снижение в pgRNA HBV, эти руководства не оказали столь большого влияния на секрецию HBsAg, как и sg17 и sg21. Этот источник этого несоответствия не совсем ясен, но может быть связан с нацеливанием на различные местоположения вдоль генома HBV, которые оказывают влияние на транскрипцию pgRNA, но не подавляют экспрессию HBsAg.

Учитывая их сильное влияние на оба измеряемых вирусных параметра, мы продолжили работу с sg17 и sg21, а также sg6 — идентифицировали из предыдущих экспериментальных экспериментов. Кроме того, для исследования эффекта мультиплексного нацеливания ДНК HBV для воздействия на несколько вирусных элементов мы совместно трансфецировали клетки HepG2 с помощью контрольной sgRNA, sg17, sg21 или комбинации sg17 / sg21. Комбинация двух направляющих РНК, нацеленных на HBV, привела к более сильному снижению РНК HBsAg и HBV 3.5kb по сравнению с однонаправленными РНК (рис. S2).

Затем мы попытались оценить антивирусный эффект Cas9 in vivo, чтобы гарантировать, что наши анти-HBV-конструкции функционируют надлежащим образом в первичных гепатоцитах. Для этого мы использовали мышечную модель HBV, где плазмиды HBV и Cas9 / sgRNA вводили в печень иммунодефицитных мышей (NRG) с помощью гидродинамической инъекции (ИРЧП) 11 (фиг.1f). В случае исследований доказательной концепции, подобных этому, мы стремимся минимизировать использование животных. Таким образом, полная батарея экспериментов in vivo, описанная ниже, была выполнена только с sg21 и мутированным контролем, хотя аналогичные результаты были воспроизведены с другими направляющими (данные не показаны). Животные, экспрессирующие Cas9 и sg21 в этой модели, демонстрировали прогрессирующее подавление экспрессии HBV по сравнению с контрольными экспрессиями Cas9 и мутантной sgRNA (sg21M, несовпадение 3 5 п.о.), что отразилось на уменьшении секреции HBsAg и 4-кратном уменьшении виремии на 4-й день после инъекции (фиг.1g, h).

Недавние исследования генотипов CRISPR, проведенные в геноме, показали, что устойчивая экспрессия Cas9 / sgRNA вызывает прогрессивно большее образование индели во времени в клетках млекопитающих12. Основываясь на этой информации и поощряясь нашими первоначальными результатами, мы оценили эффективность устойчивой экспрессии Cas9 / sgRNA в ингибировании HBV с использованием модели, которая более надежно повторяет компоненты жизненного цикла HBV. Для этих исследований мы использовали клеточную линию гепатобластомы HepG2.2.15, которая содержит как функциональную интегрированную форму HBV, так и cccDNA, и конститутивно производит инфекционные вирионы13 (рис. S3). Поскольку cccDNA не может быть достоверно квантифицирован или обнаружен в системах ко-трансфекции плазмиды или HDI, система HepG2.2.15 является более идеальной для исследования CRISPR / Cas9-опосредованного разрешения этих вирусных видов.

Мы трансдуцировали клетки HepG2.2.15 с помощью кодирующих Cas9-2A-Puro lentiviruses, кодирующих Cas9, и отдельные sgRNAs (sg6, sg17, sg21), выбранные на основе наших исходных результатов, и обработанные клетки пуромицином для отбора трансдуцированных клеток (фиг.2a). В качестве контролей клетки также были трансдуцированы конструкциями, содержащими sgRNAs, и дефицитным нуклеазой Cas9 (D10A / H840A; dCas9) для контроля за независимостью от нуклеазы эффектов Cas9 от вирусной пригодности или WT Cas9 с мутантными sgRNAs (gXM) для контроля последовательности сигналов -независимые эффекты. Cas9 / sgRNAs индуцировали устойчивое подавление высвобождения ДНК HBV (снижение на 77-95% по разным sgRNAs), секрецию HBeAg и продукцию вирусной мРНК (более 50%) (рис. S4). Затем мы проанализировали эффект опосредованного Cas9 расщепления на обилие неинтегрированных вирусных форм, состоящих в основном из cccDNA (см. Методы). Количественная ПЦР показала устойчивое снижение общей ДНК HBV и в cccDNA. Объединив данные из sg6, sg17 и sg21, сокращение cccDNA прогрессировало с 71 + / -7% снижения на 21 день до 92 + / -4% на 36 день после трансдукции (фиг.2b, c, данные для отдельных sgRNAs на рис. S5). Эти результаты были подтверждены прямым анализом низкомолекулярной ДНК из трансдуцированных клеток с помощью Саузерн-блоттинга (фиг.2d). cccDNA и ее депротеиновая релаксированная кольцевая форма (dpRC ДНК) предшественника были значительно истощены в клетках, трансформированных в Cas9 / sgRNA. Напротив, когда была проанализирована полная ДНК HBV, не было обнаружено существенного снижения уровней интегрированной ДНК HBV (рис. S6).

Затем мы провели исследование Surveyor на HBV, чтобы непосредственно определить, была ли расщеплена и восстановлена ​​вирусная ДНК с помощью ошибочного NHEJ, сходного с геномными мишенями CRISPR / Cas9. Интересно, что анализ тотальных форм ДНК HBV для формирования инделя, косвенная мера опосредованного Cas9 расщепления, показал значительную скорость мутагенеза (рис. 2е). Когда мы провели тот же анализ после истощения интегрированного геномного HBV, мы наблюдали более низкую скорость образования инделя (0% против 32%, 62% против 88% и 21% против 66% для направляющих sg21, sg17 и sg6 соответственно) (рис. . 2е внизу). Примечательно, однако, что этот метод анализа не может обнаружить опосредованное Cas9 расщепление cccDNA с последующей дегенерацией, опосредованной экзонуклеазой, из вновь образованных свободных концов ДНК (вместо повторной лигирования NHEJ) и может быть ограничен очень небольшим количеством эписомального HBV, оставшийся в поздние моменты времени (фиг.2d, рис. S4). В соответствии с высокими уровнями образования индели в основной ORF, нацеленной на sg17, иммуноокрашивание для основного белка HBV (HBc) выявило достоверное снижение уровней HBc в sg17-экспрессирующих клетках по сравнению с контролем (фиг.2f). Поскольку долгосрочное выражение Cas9 и направляющих РНК может приводить к отщеплению мишеней на сайтах с гомологией с целевой последовательностью, мы затем выполняли секвенирование следующего поколения на нескольких вычислительно прогнозируемых сайтах без цели для sg6, sg17 и sg21. В пределах чувствительности нашего анализа (<0,3% на основе глубины чтения) мы не обнаружили образования инделя на 8 внецелевых сайтах, которые мы исследовали после конститутивной экспрессии Cas9 и sgRNAs в течение более четырех недель (рис. S7a). Эта наблюдаемая специфичность может быть связана с большими различиями в последовательности между вирусной и человеческой геномной ДНК (рис. S7b-d). Эти обнадеживающие результаты по-прежнему не исключают возможности того, что некоторые антивирусные эффекты Cas9 в системе HepG2.2.15 происходят через мутации в интегрированной ДНК HBV, тем самым уменьшая пригодность и / или стойкость вирионов, полученных из мутированных локусов, а не воздействуя непосредственно на эписомальной ДНК. Поскольку интеграция ДНК HBV в геном человеческого хозяина не является частью канонического жизненного цикла HBV, мы затем оценили влияние таргетинга Cas9 в контексте инфекции HVV de novo, где эписомальная cccDNA служит единственной матрицей для экспрессии вирусного гена и репликации.

Чтобы оценить нашу стратегию анти-HBV CRISPR / Cas9 в условиях инфекции de novo, мы использовали клетки HepG2, сверхэкспрессирующие HCP-рецептор NTP (Hep-NTCP) 14, которые разрешают заражение HBV. Поскольку sg17 показал наивысшие уровни мутагенеза cccDNA в наших экспериментах HepG2.2.15, эти клетки трансдуцировали ленцивирусами Cas9 / sg17, Cas9 / sg17M или dCas9 / sg17, совместно культивировали с HBV-продуцирующими клетками HepG2.2.15 и выбирали с помощью пуромицина для избавления от не трансдуцированных Hep-NTCP и со-культивированных клеток HepG2.2.15 (рис. S8 слева). Альтернативно, клетки Hep-NTCP были выбраны с пуромицином после трансдукции и впоследствии инфицированы HBV-положительной сывороткой пациента (рис. S8 справа). Когда трансдуцированный Hep-NTCP был инфицирован вирусом, продуцированным клеточной культурой, Cas9 / sg17 значительно уменьшал продуктивную HBV-инфекцию, что отразилось на снижении секреции ДНК HBsAg и HBV, а также на уровни РНК и CccDNA на 3,5 кb по сравнению с контрольными (фиг. 2g); это было подтверждено заражением вирусом, полученным от пациента (рис. S9). В то время как дефицит нуклеазы Cas9 также уменьшал уровень вирусной 3,5 кб РНК в этой системе, этот вывод соответствует другим сообщениям о том, что связывание dCas9 может ингибировать транскрипцию в клетках млекопитающих15. Сюрвейерный анализ, проведенный с использованием ДНК из клеток, инфицированных de novo вирусом, полученным HepG2.2.15, подтвердил прямой опосредованный Cas9 мутагенез эпиморфной ДНК HBV (фиг.2h). Хотя некоторые мутагенезы также были обнаружены при использовании мутантного sg17M, это, скорее всего, было связано с низкоуровневым расщеплением с содержащими ДНК bulge-содержащими направляющими РНК16. Это открытие дает прямые доказательства того, что Cas9 способен ориентировать эписомальные формы вируса и оказывать анти-HBV-эффекты, непосредственно нацеливая cccDNA.

Несмотря на то, что в системах млекопитающих в основном не изучены, бактерии и археи используют ДНК-нуклеазы, специфичные для последовательности, для вмешательства в репликацию вируса17. Вдохновленный эволюционным происхождением CRISPR, мы стремились использовать противовирусную активность Cas9 для нацеливания ДНК HBV в клетках млекопитающих. Мы показываем, что нацеливание на несколько консервативных областей HBV с Cas9 приводит к устойчивому подавлению репликации вируса и прямого мутагенеза и истощению cccDNA. Хотя интегрированные формы ДНК HBV не были исчерпаны расщеплением Cas9, эти формы не должны способствовать вирусному отскоку in vivo18, а мутагенез, вызванный Cas9 этими последовательностями, тем не менее может повредить жизнеспособность вирусных белков, полученных из интеграторов. Уникальные преимущества системы CRISPR / Cas9 (такие как мультиплексированный таргетинг) представляют интерес для разработки антивирусных приложений, и действительно, совсем недавно в других группах были опубликованы примеры расщепления кабса HBV в нескольких модельных системах19202122. Наша работа обеспечивает продолжение за пределами этих дополнительных исследований путем демонстрации анти-HBV-эффектов sgRNAs, специально предназначенных для высококонсервативных областей HBV in vitro и in vivo, путем прямого подтверждения мутагенеза в cccDNA в модели вируса de novo HBV и расширения этого противовирусную активность к вирусу, полученному от пациента. Кроме того, наш вывод о том, что надлежащим образом выбранные вирус-нацеливающие sgRNAs могут избежать индуцирования расщепления вне мишени даже при устойчивой экспрессии Cas9 / sgRNA, усиливает случай выбора вирусных мишеней в качестве хороших кандидатов для терапевтического использования CRISPR / Cas923.

Интересно отметить, что в то время как Cas9 / sg17 был эффективен в подавлении инфекции и непосредственно расщеплении ядерной cccDNA, Cas9 / sg21 эффективно расщеплял только интегрированную, но не эписомальную ДНК, что приводило к отсутствию активности для Cas9 / sg21 в экспериментах по инфекции n novo (данные не показаны ). Причина этого неясна и требует дальнейшего изучения. Cas9 представляет собой большой многодоменный белок, и поэтому одна гипотеза состоит в том, что отдельные области генома HBV дифференциально доступны для Cas9 из-за плотно упакованной физической архитектуры cccDNA. Это подчеркивает важность использования моделей аутентичной cccDNA для исследования терапевтических применений целевых нуклеаз для HBV и предполагает, что для достижения значительного мутагенеза и истощения вирусной ДНК потребуется тщательный отбор целей и руководств. Кроме того, наше доказательство концептуальных экспериментов показывает, что мультиплексирующие sgRNAs могут генерировать более сильные противовирусные эффекты (рис. S2), предполагая, что эта стратегия может дополнительно максимизировать CRISPR-опосредованное ограничение компонентов жизненного цикла вируса, возможно, включая стабильность cccDNA.

Это исследование дает доказательство концепции, но клинический перевод систем CRISPR / Cas9 для лечения HBV потребует некоторых успехов в работе, описанной здесь. Во-первых, исчерпывающее профилирование возможных целевых сайтов Cas9 на cccDNA может выявить оптимальные целевые сайты на основе доступности cccDNA и свойств связывания sgRNA. Во-вторых, доставка конструкций Cas9 / sgRNA in vivo потребует использования клинически значимых векторов доставки, таких как AAV, что может потребовать дополнительных модификаций, таких как переход на меньшие ортологи Cas9 для сохранения размера упаковки30. Наконец, хотя мы не смогли найти доказательств нецелевого вырезания в нашей направленной последовательности, возможно, из-за низкой гомологии между вирусными и человеческими геномными мишенями Cas9, требуется обширное профилирование внецелевого эффекта генома.

Необычайная стойкость cccDNA в настоящее время является основным препятствием для лечения хронической инфекции HBV. Чтобы устранить вирус и предотвратить возможную повторную активацию, вероятно, необходимо устранить все или, по крайней мере, подавляющее большинство эписомальной ДНК из гепатоцитов посредством сочетания экзогенного лечения (представленного здесь) и иммунного опосредованного эндогенного зазора. CRISPR / Cas9-опосредованная терапия может взаимодействовать с применяемыми в настоящее время ингибиторами RT, которые должны блокировать образование новых молекул cccDNA путем повторного введения вновь синтезированных репликативных форм в ядро. Предлагаемые выше разработки представляют собой активную область исследований для групп, которые ищут способы более широкого использования CRISPR в терапевтической форме, что может ускорить прогресс в отношении анти-HBV-CRISPR-терапии.

Таким образом, эти результаты являются первым примером систем CRISPR / Cas9, непосредственно нацеленных на подлинный патогенный вирус с эписомальной ДНК, и демонстрируют потенциал антивирусной терапии, направленной на cccDNA, с использованием Cas9, что может представлять собой значительный шаг к лечению хронической инфекции HBV , Результаты, продемонстрированные здесь, также могут быть использованы для информирования о развитии терапии на основе CRISPR / Cas9 для других ДНК-вирусов, таких как герпесвирусы и папилломавирусы, которые используют эписомальную ДНК в качестве матрицы для их экспрессии и репликации генов.

Клетки HepG2 или HepG2.2.15 поддерживали в DMEM и 10% фетальной телячьей сыворотке (FCS), как описано ранее24. Для экспериментов по трансфекции использовали плазмиду 1,3xHBV, как описано ранее25. Вкратце, был продуцирован сверхтяжелый HBV-геном (adw-деформация) 4195bp, содержащий 5′-конец уникального сайта EcoRV (nt 1043, с учетом уникального сайта EcoRI в исходной конструкции HBV с 3,2kb как nt номер 1) и 3 «конец уникального сайта Taq1 (nt 2017). Этот фрагмент EcoRV-TaqI был вставлен между уникальными сайтами SmaI-AccI плазмиды pGEM-3Z, соответственно. Эта плазмида экспрессирует все продукты гена HBV и генерирует инфекционные вирионы, секретируемые средой. Трансфекцию проводили с использованием трансфекционного реагента TransIT-2020 (MIRUS) в соответствии с инструкциями производителя.

Собирали клеточные гранулы или среды и ДНК экстрагировали с использованием набора QIAamp DNA blood mini kit (QIAGEN, cat No 51104) или набора для откручивания вируса QIAamp Minielute (QIAGEN, кошка № 51104) соответственно. ДНК экстрагировали в соответствии с протоколом изготовителя, и конечный продукт элюировали в 60 мкл воды. 5ul был взят за QPCR. ПЦР для полной ДНК HBV с использованием универсального основного пигмента TaqMan® Universal PCR (Applied Bio systems, Cat No 4304437) и следующих праймеров и зондов: 5’CCGTCTGTGCCTTCTCATCTG3 ‘(смысл), 5’AGTCCAAGAGTCCTCTTATGTAAGACCTT3’ (anti sense), 5- / 56 -FAM / CCG TGT GCA / ZEN / CTT CGCTTC ACCTCT GC / 3IABkFQ / -3 (зонд). ПЦР проводили с использованием машины PCR Roche LightCycler®480. Количественное определение проводили в соответствии со стандартной кривой, составленной из плазмиды 2xHBV в диапазоне концентраций 109-101 копий.

Для экстракции и анализа cccDNA ДНК, экстрагированную из клеток, подвергали перевариванию ON с помощью плазмидной безопасной ДНКазы (Epicenter), как описано ранее14. После инактивации фермента при 70 ° С в течение 30 мин ДНК подвергали ПЦР в реальном времени с использованием SYBR® Premix Ex Taq (TaKaRa) в соответствии с ранее описанной методикой14 и с использованием специфических праймеров cccDNA, ранее описанных Glebe et al.26. Праймеры, используемые для амплификации cccDNA: 5’TGCACTTCGCTTCACCTF3 ‘(смысл) 5’ AGGGGCATTTGGTGGTC3 ‘(античувствительность). Для количественной оценки использовалась стандартная кривая, полученная из уменьшающихся концентраций 2xHBV-плазмиды. ПЦР проводили с использованием машины PCR Roche LightCycler®480.

Экстракт Херта выполняли, как описано ранее27. Около 60% конечного ДНК-экстракта, полученного из одной лунки 6-луночного планшета, использовали для Саузерн-блот-анализа.

Общий экстракт ДНК или Хирта проводили на 0,8% агарозном TAE-геле с последующей денатурацией и южным блоттингом на нейлоновой мембране Hybond N (Amersham). Вирусную ДНК детектировали гибридизацией с 32P случайным загрунтованным HBV-зондом с использованием набора для прайминга Prime-It II (Agilent Technologies, Cat No 300385). После инкубации и промывки мембрану визуализировали с помощью фосфора и затем подвергали воздействию пленки.

Общая РНК была выделена с помощью экстракции TRIZOL РНК / ДНК. После обработки ДНКазой РНК количественно определяли с использованием NanoDrop, и кДНК первой цепи синтезировали с использованием набора SuperScript® III RT (INVITROGEN). Количественную ПЦР для 3,5 кбРНК или общую РНК HBV проводили с помощью SYBR Green PCR master Mix (Applied Biosystems) и использовали специфические праймеры, описанные ранее14. В каждой реакции отрицательный контроль RT включался в норму переноса ДНК.

Клетки выращивали на позолоченных камерах (Lab-Tek, Rochester, NY), промывали PBS и затем фиксировали 4% параформальдегидом. Клетки снова промывали (3 раза PBS) и обрабатывали 100 мМ раствором глицина в PBS. После пермеабилизации 0,1% Triton X-100 в PBS и обработкой с помощью усилителя сигнала Image-iT ™ FX (Life Technologies). Клетки блокировали в PBS / 10% козьей сыворотке (Jackson Immunosearch) / 1% BSA. Окрашивание ядра HBV было достигнуто с использованием поликлонального кроличьего антитела против HBV-ядра (Dako, CA), разведенного 1: 1000 в PBS / 0,1% BSA (18 ч при 4 oC). В качестве вторичного антитела использовали козьим анти-кроликом, помеченными AlexaFluor594 (Life Technologies), разбавленным 1: 2000 в PBS / 0,1% BSA. Ядерное окрашивание было достигнуто с использованием DAPI. Приобретение изображений проводили в конфокальном микроскопе Zeiss, и анализ изображений проводили с использованием ImageJ (NIH, Bethesda, MD).

ELISA HBV e Antigen проводили с использованием набора для иммуноанализа Hibatitis B e Antigen (HBeAg) для иммуноанализа (Autobio Diagnostics Co, Cat No.CL0312-2) в соответствии с инструкциями производителя. Для обнаружения HBsAg 100-миллилитровую среду загружали на пластины ELISA, покрытые мышиными моноклональными антителами против HBsAg (Bio-Rad, GS HBsAg EIA 3.0, кат. 32591). ELISA проводили в соответствии с инструкциями производителя. Плиты считывали с использованием люминометра FLUOstar Omega (BMG LABTECH). Положительность HBsAg (отсечка) рассчитывалась как среднее из 3 отрицательных контролей + 0,07.

Мышам NRG инъецировали смесью 15 мкг 1,3xHBV плазмиды, 20 мкг экспрессирующей CRISPR плазмиды и 10 мкг экспрессирующей люциферазы плазмиды (для контроля эффективности экспрессии) с использованием метода гидродинамической доставки (HDD), как описано ранее11. Плазмиды растворяли в PBS в объеме, соответствующем 0,09 раз животного веса (в граммах), и смесь вводили через хвостовую вену через 7-9 сек. Чтобы проверить успешную инъекцию и экспрессию генов, животные визуализировались машиной IVIS в различные моменты времени после жесткого диска. Мышей размещали в аккредитованном AAALAC объекте, и все эксперименты проводились в соответствии с Руководством по уходу и использованию лабораторных животных. Все процедуры, изложенные в исследовании, были одобрены Институтом институционального ухода и использования животных Рокфеллера (IACUC).

293T были совместно трансфицированы векторами вектора sgRNA-Cas9-2A-Puro (фиг.2A) и лентивирусной упаковочной системой второго поколения (psPAX2 и pMD2.G) в соотношении 3: 2: 1. Клетки промывали через 24 часа после трансфекции, супернатант собирали каждые 24 ч с 48-96 ч после трансфекции, а клеточный дебрис удаляли центрифугированием. Лентивирус концентрировали путем ультрацентрифугирования в течение 1,5 ч при 16,600 г г, инкубировали O / N в Optimem при 4 ° С, затем ресуспендировали в Optimem, аликвотировали и замораживали при -80 ° С на следующий день перед использованием.

Клетки HepG2.2.15 поддерживали, как указано выше, до трансдукции, а затем трансдуцировали с помощью sgRNA-Cas9-2A-Puro lentiviruses при слиянии 50-60% с MOI в 1. Трансдукцию проводили смешением аликвот лентивируса со стандартным HepG2.2.15 культуральную среду, промывают клетки и добавляют среду, содержащую лентивирус, в 2,5 мл / лунку в 6-луночном планшете, центрифугируют в течение 1 часа при 200 × g и затем инкубируют в течение дополнительных 23 часов. Через 24 часа после добавления лентивируса клетки промывали 3 раза и инкубировали в стандартной среде + 2,5 мкг / мл пуромицина для удаления непереведенных клеток. Выделение пуромицина продолжали в течение 48 ч, затем клетки промывали 3 раза и выдерживали в стандартной среде. Затем трансдуцированные клетки непрерывно пассировали после достижения слияния на 80%; в каждом проходе подсчитывали клетки, собирали клеточные гранулы для каждого состояния, а часть оставшихся клеток подбирали при 10% слиянии.

Конструкции Cas9 с направляющими РНК, нацеленными на последовательности, присутствующие в геноме HBV, интегрированные в клеточную линию HepG2.2.15, использовались для описанных экспериментов. Гистологические РНК имели вид 5′-G (N19) -3 ‘, причем их целевые последовательности имеют форму 5′-G (N19) -NGG-3’. Олигос для создания gRNAs клонировали в конструкцию lentiCRISPR, описанную в (12) или PX330a, описанную в (21). Были созданы два набора конструктивных элементов управления: несоответствующие направляющие конструкции для РНК для перспективных направляющих молекул РНК были созданы путем лигирования олигонов до PX330a или lentiCRISPR, который содержал 5 несоответствий базовой пары на 3′-конце прокладки, но в остальном идентичны конструкциям, предназначенным для нацеливания на HBV. Конструкции для контроля нуклеазы Cas9 D10A / H840A были получены путем переваривания рестрикционной РНК плазмиды lentiCRISPR, содержащей конструкции с BamHI и XbaI (ThermoScientific), а затем вставкой ПЦР-амплифицированного D10A / H840A Cas9 с использованием сборки Gibson. D10A и H840A являются мутациями, которые являются достаточными для отмены активности нуклеазы S. pyogenes SF370 Cas9828.

Целевые локусы амплифицировали с помощью ПЦР с использованием полимеров Phusion Flash (NEB) или Heruclase II (Agilent) и праймеров, перечисленных в таблице S2. Для sg17 и sg21 для каждого гида были разработаны два отдельных набора праймеров для оптимизации реакции ПЦР; наборы F2 и R2 рекомендуются. Продукты ПЦР подвергали гель или ПЦР-очистке с использованием наборов Qiagen и подвергали анализу Surveyor (Transgenomics) в соответствии с инструкциями производителя. Показатель Indel для инспекторов был рассчитан, как описано в ссылке (8).

Потенциальные целевые сайты были идентифицированы с использованием онлайн-инструментария CRISPR (crispr.mit.edu). 8 верхних участков хромосомной вне мишени для направляющих sg6, sg17 и sg21 вместе с сайтами-мишенями были амплифицированы ПЦР с помощью праймеров, предназначенных для прикрепленных адаптеров Illumina P5 и специфичных для образца штрих-кодов. Продукты ПЦР очищали с использованием QIAQuick PCR Spin Columns (QIAGEN), количественно определяли с помощью флюорометра Qubit 2.0 (Life Technologies) и объединяли в эквимолярном отношении. Затем ампликоны были секвенированы персональным секвенсором Illumina Miseq. Частоты Indel для считывания NGS были рассчитаны аналогично Hsu et al.29 в Geneious.

Как процитировать эту статью: Ramanan, V. et al. Разрушение CRISPR / Cas9 вирусной ДНК эффективно подавляет вирус гепатита В. Sci. По донесению
5, 10833; doi: 10.1038 / srep10833 (2015).

Мы благодарим Х. Флеминга за редактирование рукописи. Это исследование было частично поддержано Фондом науки и технологий Сколково 022423-003 (SNB), Национальным институтам здравоохранения Грант DK085713 (до CMR и SNB), грантом поддержки Института Коха P30-CA14051 от Национального института рака ( Центр биотехнологии Swanson), грант Центра фундаментального центра P30-ES002109 от Национального института наук об охране окружающей среды, Американской ассоциации научных исследований в области гастроэнтерологии и Национального института здравоохранения Грант 1K08DK101754 (до RES), стипендии Фонда Фанни и Джона Герца (до VR ) и стипендий для выпускников научных исследований в Национальном научном фонде (для VR и DAS), попечительского стипендии Merck (до EM) и стипендии Henry E. Singleton (до DAS). Дальнейшая поддержка этого проекта была предоставлена ​​грантом Фонда Робертсона (Э.М.). В ВИДЕ. является стажером в программе клинических исследований, Университет Рокфеллера, поддержанный грантом 8 UL1 TR000043 от Национального центра исследовательских ресурсов и Национального центра по продвижению трансляционных наук, Национальным институтам здравоохранения. S.N.B. является исследователем медицинского института Ховарда Хьюза. F.Z. поддерживается Национальным институтом психического здоровья (NIMH) через Pioneer Award от NIH (5DP1-MH100706), NINDS через грант NIH Transformative R01 (5R01-NS073124), Keck, Merkin, Vallee, Damon Runyon, Searle Scholars, Фонд семьи Клармана, Клингенштайн, Фонды Пойтраса и Симонса и Боб Меткалф. D.B.T.C. является стажером программы MD-PhD в Гарвардской медицинской школе и поддерживается номером премии T32GM007753 от Национального института общих медицинских наук.

Авторские вклады В.Р. и D.B.T.C. разработали первоначальную идею исследования. V.R., A.S., D.B.T.C. и R.E.S. планировал эксперименты с данными других авторов. V.R., A.S., D.B.T.C., R.E.S., E.M., A.B. и D.A.S. провели эксперименты и проанализировали результаты. F.Z., C.M.R. и S.N.B. контролировал исследование. V.R., A.S., D.B.T.C., R.E.S., F.Z., C.M.R. и S.N.B. написал и отредактировал статью.

(a) Схема жизненного цикла ВГВ и предполагаемый анти-HBV-эффект конструкций CRISPR; Cas9-опосредованное образование DSB должно линеаризовать небольшую, эписомальную cccDNA несколько раз, потенциально приводя к образованию индела (образующих менее подходящие вирусные мутанты) или даже деградации. (b) (слева) организация генома HBV и расположение последовательностей мишеней для нескольких тестируемых направляющих конструкций РНК. (справа) Таблица всех возможных целевых сайтов CRISPR в каждой ORF HBV, включая количество возможных целевых сайтов в консервативных геномных областях. (c) Экспериментальная схема для (de): клетки HepG2 ко-трансфицированы с помощью конструкции 1,3x WT HBV и sgRNA / Cas9-2A-mCherry и (d) предгеномная РНК внутриклеточной HBV и (e) секретируемый HBsAg количественно определяют через 72 часа , Показанные данные были сгенерированы в одном представительном эксперименте с внутриклеточной pgRNA, собранной из одного гранулы, и HBsAg, собранным из реплицированных лунок на группу; все данные согласованы в трех независимых экспериментах. (f) Экспериментальная схема для (gh): 1.3x WT HBV и sgRNA / Cas9-2A-mCherry доставляются в печень иммунодефицитных мышей NRG посредством гидродинамической инъекции и (g) HBsAg и (h) секретируемый титр HBV количественно определяют в мышь крови через 2 и 4 дня после инъекции. 21M: направляющая РНК с несоответствием 5 bp от g21. Данные показаны из одного представительного эксперимента и согласованы в нескольких экспериментах. UT: «нецеленая» направляющая РНК (без целевой последовательности в геноме HBV). * p <0,05 для выбранного сравнения; ** p <0.01 для выбранного сравнения; *** p <0,001 для выбранного сравнения, которое оценивается с помощью двухстороннего t-теста.

(a) Схема вектора лентивируса и экспериментальной стратегии для устойчивого выражения CRISPR. (b-c) Конструкции CRISPR, нацеленные на HBV, вызывают прогрессирующее снижение (b) cccDNA и (c) общих уровней ДНК HBV в зависимости от успешного нацеливания вирусной ДНК и активности нуклеазы Cas9; данные показаны из одного репрезентативного эксперимента, объединенного с тремя отдельными направляющими HBV-ориентирования (sg6, sg17, sg21) и согласованными в нескольких независимых экспериментах по трансдукции. (d) Саузерн-блоттинг ДНК-форм HBV с использованием экстракции Hirt (для истощения высокомолекулярной ДНК), показывает, что HGV-нацеленные sgRNAs с активностью, вызванной нуклеазой Cas9, вызывают почти полное сокращение cccDNA. (e) Исследование с целью определения образования инделла в общей ДНК HBV (верхняя) и эписомальной ДНК HBV, обогащенной обработкой плазмид-безопасной ДНКазой (снизу); Лентивирусная трансдукция обеспечивает высокий уровень разрезания HBV. Arrowheads изображают продукты пищеварения сюрвейера. Ожидаемые размеры ПЦР-продуктов для sg6, sg17 и sg21 составляют соответственно 599, 946 и 507 б.п. Приблизительные размеры продуктов пищеварения сюрвейера для sg6, sg17 и sg21 составляют соответственно: 429 + 170, 570 + 376, 275 + 232. (f) Иммунофлуоресцентная визуализация белка основного белка HBV демонстрирует значительное уменьшение окрашивания ядра при нацеливании с помощью sg17, особенно против ядра ORF. (g-h) Касс-трансдуцированные каз9 / гРНК клетки Hep-NTCP сополируют клетками HepG2.2.15 для инфицирования HBV с последующим истощением клеток HepG2.2.15 с использованием выделения пуромицина (схема на рис. S6 слева). (g) Слева направо, секреция HBsAg, копии cccDNA, уровни РНК HBV 3.5kb относительно контроля несоответствия 5 bp и титр ДНК HBV в культуральной среде показывают, что Cas9 / sg17 снижает HBV-инфекцию при инфекции de novo. 17M: контроль несоответствия 5 bp. 17D: мертвый Cas9 с g17. Данные показаны из одного репрезентативного эксперимента и согласованы между экспериментами. (h) Сюрвейерный анализ, проведенный на необработанном (левом) или обработанном (справа) ДНК с плазмидной безопасной ДНКазой для удаления неэпизомальных вирусных форм. Стрелки указывают на формирование indel. (b-c) * p <0,05 для выбранного сравнения; ** p <0,01 для выбранного сравнения, как оценивается односторонним ANOVA с Tukey post-hoc test.

Комментариев нет.

Добавить комментарий

Ваш e-mail не будет опубликован. Обязательные поля помечены *