Нажмите "Enter", чтобы перейти к контенту

Кросс-видное сохранение содержания эпизода дает основание для исследования in vivo вируса герпеса вируса саркомы Капоши LANA

Cross-species conservation of episome maintenance provides a basis for in vivo investigation of Kaposi's sarcoma herpesvirus LANA
Источник: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5599060/

Авторы заявляют, что конкурирующие интересы не существуют.

‡ JPM и KMK являются совместными старшими авторами.

Многие патогены, в том числе герпесвируса саркомы Капоши (KSHV), не обладают приемлемыми малыми животными моделями. KSHV сохраняется как многократный, ядерный эпизод в латентно инфицированных клетках. Связанный с латентностью ядерный антиген KSHV (kLANA) связывает ДНК-терминальную повторную (kTR) ДНК, чтобы опосредовать стойкость эписомы. Модельный патогенный мышиный гамма-герпесвирус 68 (MHV68) mLANA действует аналогично на ДНК mTR. kLANA и mLANA существенно отличаются по размеру, а kTR и mTR показывают небольшую консервацию последовательности. Здесь мы находим, что kLANA и mLANA действуют взаимно, чтобы опосредовать эписомную персистенцию TR ДНК. Кроме того, kLANA избавлял от mLANA дефицитный MHV68, позволяя химеру вируса установить скрытую инфекцию in vivo в зародышевых центрах B-клеток. Уровень латентности химерного вируса in vivo умеренно снижался по сравнению с WT-инфекцией, но WT или химерные инфицированные MHV68 клетки имели аналогичные копии вирусных геномов, которые оценивали с помощью иммунофлуоресценции LANA-внутриядерных точек или qPCR. Таким образом, несмотря на более 60 миллионов эволюционных расхождений, mLANA и kLANA действуют взаимно на TR ДНК, а kLANA функционально заменяет mLANA, что позволяет проводить исследование kLANA in vivo. Аналогичные химеры могут позволить in vivo исследование генов других патогенов человека.

KSHV латентно заражает клетки и сохраняется как многократный, ядерный эпизод. KSHV LANA (kLANA) поддерживает эпизоды, действуя на элементы вирусного терминального повторения (kTR). Модельный патоген MHV68 mLANA действует аналогично на ДНК mTR. На сегодняшний день расследование KSHV было ограничено отсутствием приемлемой модели небольшого животного. Здесь мы обнаруживаем, что, несмотря на 60 млн. Эволюционных расхождений, kLANA и mLANA обладают межвидовой функциональностью, действуя взаимно на TR ДНК, чтобы опосредовать эписомальную устойчивость. Кроме того, kLANA избавляла от mLANA дефицита MHV68, позволяя химеру вируса установить скрытую инфекцию in vivo. Уровень латентности in vivo был умеренно ниже для химерного вируса kLANA по сравнению с уровнем WT, но химерные и WT-инфицированные вирусы имели похожие копии копий генома вируса. Эти результаты теперь дают приемлемую модель для исследования kLANA in vivo. Этот химерный подход может быть широко применен к другим малым животным образцам для патогенов человека.

Все соответствующие данные содержатся в документе и его файлах вспомогательной информации.

Связанный с саркомой Капоши герпесвирус (KSHV), герпес вируса гамма-2, является этиологическим агентом саркомы Капоши, первичной эффузионной лимфомы и многоцентровой болезни Кастлмана [1-5]. КШВ-инфекция опухолевых клеток преимущественно латентна. Во время скрытой инфекции KSHV сохраняется как ядерный, многократный, внехромосомный, круговой эпизод [6]. Чтобы сохраняться в пролиферирующих клетках, геномы должны реплицироваться с каждым делением клеток и разделяться на ядра потомков.

Связанный с задержкой ядерный антиген (kLANA) (фиг. 1A) является одним из небольших подмножеств генов KSHV, выраженных в латентности. LANA действует на ДНК-повторе KSHV-терминала (kTR), чтобы опосредовать стойкость эписома [7,8], для которой это существенно [9]. N-концевой LANA связывает гистоны H2A / H2B на поверхности нуклеосомы с присоединением к митотическим хромосомам [10], а C-концевой ДНК-связывающий домен LANA (DBD) одновременно связывает соседние сайты связывания LANA (LBS) в TR ДНК, с образованием молекулярного который гарантирует, что геномы разделяются на ядра дочерних клеток после митоза [8,11-14]. LANA также опосредует репликацию ДНК KSHV и оказывает важные эффекты транскрипции и роста [11,15-25].

(A) Схема kLANA и mLANA. Гомологические области обозначены серым оттенком. В белых и черных регионах нет гомологии. Показаны номера аминокислотных остатков. P, пролин-богатый. Gardella после трансфекции ДНК m4TR (B) или m8TR (C). Блоты в B и C зондировали ДНК 32P-pRepCK. (D) гель Gardella после 87 дней указанных линий клеток из панелей B и C. Blot зондировали ДНК 32P-m8TR. Дни выбора G418 находятся под каждой панелью. O, происхождение геля; Показана плазмидная ДНК ccc. Дорожки содержат 1,5-2 × 106 клеток. Вертикальные линии справа (панели B, C, E) указывают положения эпизоотических полос. Звездочки обозначают слабые эпизодические группы. (E) Иммунная флуоресценция для kLANA. Клетки m8TR относятся к клеточной линии d (панели C, D). Яркость и контрастность были равномерно отрегулированы в панелях из того же поля, и красный сигнал был равномерно увеличен для панелей k8TR с использованием Adobe Photoshop. Увеличение, 630x.

Несмотря на то, что инфекция KSHV, естественно, ограничена людьми, стремление к небольшой модели заражения животных для изучения патогенеза было давней целью в этой области и было выполнено на нескольких моделях иммунизированных скомпрометированных мышей. Внедрение KSHV в мышей SCID, имплантированных человеческим титаном эмбриона и трансплантатами печени, приводило к литической и латентной инфекции с наиболее часто инфицированными В-клетками [26], тогда как инъекция в мыши NOD / SCID приводила к экспрессии латентного и литического гена в течение нескольких месяцев с инфицированием множественных клеток, включая В-клетки [27]. Пероральная, внутрибрюшинная или вагинальная инокуляция в гуманизированную мышь NOD / SCID / IL2rgamma, имплантированную пера плода человека и тимуса, позволила KSHV инфицировать В-клетки и макрофаги [28]. Эти модели являются выгодными для прямого исследования KSHV, но ограничены их требованием для иммунных подавленных мышей.

Муриновый гамма-2 герпесвирус 68 (MHV68 или муриновый герпесвирус 4) инфицирование лабораторных мышей обеспечивает дополнительную, хорошо охарактеризованную модель для исследования гамма-герпеса. После интраназальной инокуляции MHV68 подвергается литической инфекции в легких, распространяется в лимфоидные органы, где он устанавливает латентность в селезенке, и приводит к пролиферации B-клеток зародышевого центра (GC-B) [29-31]. MHV68 разделяет последовательность гомологий и имеет геном, который, как правило, является коллинеарным с KSHV [32]. MHV68 кодирует гомолог LANA (mLANA), который меньше, чем kLANA, но имеет консервативный C-концевой ДНК-связывающий домен (фиг. 1A). Аналогично kLANA, mLANA действует на ДНК mTR, чтобы опосредовать стойкость эписомы [33]. В соответствии с его центральной ролью в сохранении эписомы mLANA имеет важное значение для эффективного установления задержки MHV68 in vivo [34-36].

В этой работе мы исследовали возможность межвидовой функциональности между MHV68 и KSHV LANA для обслуживания эпизода. Мы обнаружили, что kLANA может поддерживать стойкость эписомы к плазмидам, содержащим mTR-элементы, и аналогично, mLANA может поддерживать эписомную устойчивость плазмид kTR. Кроме того, мы обнаружили, что химерный MHV68, экспрессирующий kLANA, но не mLANA, способен создавать скрытую инфекцию в селезеночных GC B-клетках, тем самым обеспечивая модель для исследования kLANA in vivo.

Поскольку KSHV и MHV68 LANAs имеют общую гомологию (рис. 1A), мы оценили, может ли kLANA опосредовать эписомную стойкость элементов MHV68 TR (mTR). Мы трансфицировали ДНК (кодирующую резистентность к G418), содержащую 8 (m8TR), 4 (m4TR) или 2 (m2TR) MHV68 TR копий, 8 копий KSHV TR (pk8TR) или вектор (pRepCK) в клетки лимфомы BJAB B человека, стабильно экспрессирующие kLANA (Bjab-Klana). k8TR проявлял гораздо более высокий рост от экспрессирующих клеток kLANA по сравнению с контрольными клетками BJAB (таблица S1). Более высокий рост обусловлен гораздо более высокой эффективностью опосредованного kLANA эписомной стойкостью по сравнению с интеграцией. Аналогично, резистентный рост m8TR, m4TR и m2TR G418 также увеличивался в клетках BJAB-kLANA по сравнению с клетками BJAB, что согласуется с возможной опосредованной опосредованностью клона, связанной с kLANA.

Устойчивые к G148 клеточные линии были расширены и оценены на наличие эпизодов гелями Gardella. В гелях Gardella живые клетки загружают в гель-лунки и лизируют in situ. Во время электрофореза хромосомная ДНК остается в гене геля, тогда как эписомальная ДНК размером до нескольких сотен килобаз мигрирует в гель. Как и ожидалось, клетки BJAB-kLANA, трансфицированные pk8TR, показали сильный эписомальный сигнал во всех тестируемых клеточных линиях (рис. 1B-1D) (таблица 1). Также, как и ожидалось, клетки BJAB-kLANA, трансфецированные вектором pRepCK, который не содержит последовательности TR, не имели эпизодов (фиг.1B и 1D). Трансфекция ДНК m2TR в клетки BJAB-kLANA приводила к только одной из 31 (3%) резистентных клеточных линий G418 с эпизодами (таблица 1). После трансфекции ДНК m4TR в клетки BJAB-kLANA и отбора G418 в течение 27 дней эпизоды были обнаружены в пять (фиг.1B, (обозначено звездочками)) из 17 дорожек, а в трех экспериментах 12 из 37 (32%) резистентных к G418 клеточные линии содержали эпизоды. Эпипломальный сигнал был значительно более слабым для эпизодов m4TR по сравнению с эписомальной ДНК pk8TR (рис. 1B, сравнение pk8TR с полосами m4TR), что указывает на меньшую эписомальную ДНК в этих клетках. Для ДНК m8TR эпизоды были обнаружены в 10 из 17 полос (рис. 1C), и в трех экспериментах 19 из 50 (38%) резистентных клеток G418 имели эпизоды. Хотя эписомальный сигнал m8TR был слабее по сравнению с уровнем клеток pk8TR (рис. 1C), по сравнению с m4TR (рис. 1B) наблюдался значительно более высокий эписомальный сигнал m8TR. Зонд, использованный на фиг. 1В и 1С, обнаруживал только векторную основную цепь, и поэтому эффективность обнаружения для всех плазмид была одинаковой. В целом, эпизоды mTR мигрировали гораздо медленнее, чем плазмидная ДНК ccc (например, фиг.1B, полоса 3 или фиг.1C, дорожка 2), а также более медленно, чем большинство эпикомплекса ДНК pk8TR, в течение 27 дней отбора. Большие рекомбинантные эпизоды были связаны с событиями рекомбинации и в основном состояли из входных плазмид, расположенных в тандемной головке с хвостовыми мультимерами, с расширением и сокращением тандемных МТР также (S1 Text, S1 и S2 Figs). Таким образом, kLANA может опосредовать эписомную персистенцию ДНК mTR, а эффективность эписомальной стойкости выше с более высоким номером копии mTR.

1 Фракции указывают количество клеточных линий, содержащих эпизоды, деленные на общее количество клеточных линий, анализируемых анализом Гарделлы; проценты указаны в скобках.

2Data из трех экспериментов

3Data из двух экспериментов.

4Дата из пяти экспериментов.

Мы исследовали способность kLANA поддерживать эпизоды mTR в течение более длительного периода времени. Из четырех клеточных линий (фиг. 1B, клеточные линии b, e, f, i), которые первоначально имели эпизоды m4TR после 27 дней выбора G418, три (фиг. 1B, клеточные линии b, e, f) больше не содержали эпизоды после ~ 2 месяцев в непрерывной культуре и четвертой клеточной линии m4TR (фиг. 1B, клеточная линия i) потеряли почти всю эписомальную ДНК после 87 дней выбора G418 (фиг. 1D, дорожка 19, звездочка указывает на слабый диапазон). Напротив, восемь устойчивых к g418 клеточных линий m8TR, содержащих эписомальную ДНК в течение 27 дней, продолжали поддерживать эписомальную ДНК m8TR после 87 дней селекции (рис. 1D), тогда как, как ожидалось, две клеточные линии, у которых отсутствовали эпизоды в 27 дней, линии клеток a и e , остался отрицательным. Таким образом, kLANA действует на ДНК m8TR, чтобы опосредовать долговременную эписомическую стойкость в течение по крайней мере ~ 3 месяцев, тогда как эпилептическая ДНК m4TR терялась с течением времени.

kLANA была обнаружена в клетках BJAB, экспрессирующих kLANA либо в присутствии, либо в отсутствие эпизодов, которые были под G418 в течение более трех месяцев. Были оценены как интерфазные, так и метафазные клетки (рис. 1Е). Как и ожидалось, в отсутствие эпизодов kLANA (зеленый) распределяется широко по всему ядру (красный) в интерфазе (наложение красного и зеленого генерирует желтый) и над митотическими хромосомами (красный). Напротив, kLANA (зеленый) концентрируется до точек как в межфазных ядрах (красный), так и вдоль митотических хромосом (красный) в клетках, содержащих эпизоды k8TR. Предыдущая работа показала, что каждая точка kLANA colocalizes с эпизодом [7]. В клетках с эпизодами m8TR (из рис. 1C и 1D, клеточная линия d использовалась в качестве репрезентативного примера), kLANA концентрировался на точки в интерфазе и вдоль митотических хромосом (красный), но некоторые kLANA также широко распределялись по всему ядру в межфазной и широко вдоль митотические хромосомы. Кроме того, в ячейках с m8TR в сравнении с k8TR, как правило, меньше точек kLANA, что соответствует меньшему количеству эпизодов m8TR на клетку. Таким образом, kLANA релокализуется к точкам в клетках k8TR и m8TR, хотя релокализация менее выражена в клетках с эпизодами m8TR по сравнению с эпизодами k8TR.

Поскольку kLANA опосредовал эписомную персистенцию ДНК mTR, мы спросили, может ли mLANA опосредовать эписомную стойкость ДНК k8TR. mLANA действует на mTRs, чтобы опосредовать стойкость эписомы, когда оба находятся в цис [33], и мы впервые провели эксперименты, которые продемонстрировали, что mLANA также действует в транс, чтобы опосредовать персистенцию (S3 Fig, S2 Text). Для оценки того, является ли mLANA опосредующей эпистомозную константу ДНК kTR, pk8TR-P или pRepCK-P-вектор (кодирующий устойчивость к рюомицину) трансфицировали в мышиные клетки A20 или клетки A20, экспрессирующие mLANAF. Как и ожидалось, устойчивый к пуромицину рост был низким после трансфекции вектора pRepCK-P или pk8TR-P в клетки A20 (таблица S1). Напротив, трансфекция pk8TR-P в клетки A20-mLANAF приводила к значительно более высокому росту, что соответствовало поддержанию эпизода.

Клетки оценивали гель Gardella для эпизодов. Как и ожидалось, экспрессирующие mlANA клетки, трансфецированные векторным контролем или клетки A20, трансфецированные k8TR-P, не имели эпизодов (фиг. 2). Напротив, после трансфекции pk8TR-P в клетки A20-mLANAF (B) 11 из 12 (фиг. 2) клеточных линий имели эпизоды и в общей сложности 4 эксперимента, 27 из 29 (93%) резистентных к пуромицину клеток содержали эписомы (Таблица 1). Таким образом, mLANA опосредует стойкость эписомы ДНК k8TR при относительно высокой эффективности. В соответствии с этими результатами и с теми, которые показали, что kLANA опосредует эписому персистенцию ДНК mTR (фиг. 1), мы обнаружили, что kLANA и mLANA связываются взаимно с последовательностями распознавания ДНК TR друг друга (S3 Text, S4 Fig).

Gardella после трансфекции клеток A20 или A20 / mLANA с помощью вектора pRepCK или ДНК k8TR. Дорожки содержат 2-3х106 клеток. Гель проводили в течение 24 дней после выбора пуромицина. Блот зондировали ДНК 32P-pk8TR. O, происхождение геля; E, S11 эпизоды; L, S11 линейных геномов из-за литической репликации; Показана плазмидная ДНК ccc.

Поскольку kLANA поддерживал поддержку эпизода mTR DNA, мы спросили, может ли kLANA функционально заменить mLANA в MHV68 для поддержки инфекции in vivo. ORNA kLANA и 5′-UTR, но не промотор kLANA [37], были вставлены в MHV68 в локусе mLANA. Экзон mORF72 (некодирующий), который перекрывается с N-концевым mLANA, был сохранен для сохранения событий сплайсинга, важных для экспрессии mORF72 и LANA. Таким образом, экспрессия kLANA управляется нативными промоторами mLANA (фиг. 3A) [38,39] в отсутствие mLANA. Полученный химерный вирус был назван v-kLANA. Мы также создали вирусы с мутациями в kLANA, которые отменяют связывание нуклеосом (называемый v-8A10, где остатки LANA 8LRS10 были мутированы до 8AAA10) [40] или связывание ДНК LANA (называемое v-Δ1007-21, где остатки от 1007 до 1021 были удалены) [41] (фиг. 3А). Эти мутации отменяют постоянство эпилепсии kLANA [40,41]. Все рекомбинанты kLANA-MHV68 были получены в фоновых изображениях MHV68 дикого типа или желтого флуоресцентного белка (yfp) MHV68 [42].

(A) Принципиальная схема. Кассета kLANA была вставлена ​​между стоп-кодоном M11 и экзоном mORF72 вместо MHV68 103,935-104,709, который включает большую часть ORAN mLANA. p1, p2, p3, являются mLANA-промоторами [38, 39]. Эксцидент mORF72 noncoding (черный) расположен в кодирующей области mLANA. Участок акцептора сплайна E2 (nt 104 871) и сайт донора сплайна mORF72 (nt 104 715) оставались нетронутыми, чтобы обеспечить экспрессию kLANA и mORF72. Начальный кодон mLANA и три нисходящие ATG были мутированы ATT, чтобы предотвратить начало трансляции (обозначены черными точками). Указывается фрагмент BamHI-G (геномный n 101,653-106,902). mLANA ORF, nt 104,868-103,927. (B) Конфокальное определение иммунофлюоресценции mLANA (верхние панели) или kLANA (нижние панели) от вирусов yfp. Увеличение 630x. (C) Иммуноблот вирусных белков. (D) Кривые роста вируса в клетках BHK-21 после инфицирования 0,01 PFU / клеткой. Не было существенной разницы между группами инфекции (p> 0,05 с использованием однонаправленного непараметрического ANOVA Kruskal-Wallis). (E) титры вируса легкого через 7 дней после инфицирования 104 PFU указанных вирусов. Круги представляют собой титры отдельных мышей (n = 19). Бары показывают среднее значение. v-Δ1007-21.yfp имел значительно более низкие титры, чем v-WT.yfp (** p <0,01, используя однонаправленный непараметрический ANOVA Kruskal-Wallis, а затем множественный сравнительный тест Dunn). Других статистически значимых различий между группами не было.

Предполагается, что промоторы mLANA приводят к транскрипции трансгенного kLANA во время литической репликации in vitro, как это делают для mLANA и mORF72 [38,43]. Мы оценили экспрессию LANA после заражения клеток BHK-21 MHV68 (v-WT), v-kLANA, v8A10 или v-Δ1007-21. Как и ожидалось, v-WT выражал mLANA, который широко распределялся по всему ядру (рис. 3B и S5A Fig, верхние панели) [43]. мутанты kLANA или kLANA, распределенные аналогично mLANA (рис. 3B и S5A Fig, нижние панели) после заражения химерными вирусами. Иммуноблоты подтвердили экспрессию mlANA или kLANA после инфицирования WT или химерных вирусов (фиг. 3C, S5B Fig). Множественные полосы kLANA обусловлены альтернативным инициированием трансляции и альтернативным сигналом поли аденилирования [44, 45]. vCyclin (ORF72) и M3 (хемокиновый связывающий белок, выраженный в литической инфекции), были одинаковыми для v-WT и химерных вирусов (рис. 3C, S5B Fig), что указывает на сохранение выраженной и сопоставимых уровней инфекции.

Кинетика роста v-kLANA, v8A10 или v-Δ1007-21 в клетках BHK-21, инфицированных при MOI 0,01, была похожа на кинетику вируса v-WT (рис. 3D и S5C Рис.). Для оценки литической репликации in vivo мы инокулировали интраназальными (то есть) мышей линии C57 BL / 6 с 104 PFU вируса v-WT или v-kLANA и определяли титры легких. Хотя титры всех вирусов были похожи на 3-й день (S5D Fig), на 7-й день после титров заражения были немного ниже для вирусов v-kLANA, особенно для мутантов kLANA, по сравнению с v-WT (рис. 3E и S5D Рис.). На 14-й день в легких не было обнаружено вируса (S5D Fig). Снижение титров на 7-й день указывает на то, что kLANA не может полностью заменить mLANA во время литической репликации in vivo, а нарушение N-концевой хромосомной связи kLANA или связывание с C-концевой ДНК влияет на эту фазу заражения.

Чтобы оценить, может ли kLANA поддерживать латентную инфекцию MHV68 in vivo, мы оценивали вирусную латентность в селезенке мышей, инфицированных химерным вирусом v-WT или kLANA. Чтобы идентифицировать латентно инфицированные спленоциты на 14-й день после заражения (пик скрытой инфекции), клетки инкубировали с клетками BHK (разрешающими для литической инфекции) для обнаружения вируса, продуцируемого после литической реактивации. Как и ожидалось, спленоциты от инфицированных v-WT мышей продуцировали вирионы. Спленоциты от инфицированных v-kLANA мышей также продуцировали вирус, хотя титры были на 2-2 ½-log ниже, чем у инфицированных v-WT животных (рис. 4А). В поразительном контрасте не было обнаружено обнаруживаемого реактивирующего вируса в группах инфекции v-8A10 или v-Δ1007-21 (фиг. 4A).

Вирусная латентность в селезенке мышей C57 BL / 6 через 14 дней после i.n. инфицирование 104 PFU указанных вирусов. (A) Скрытые титры, определяемые анализом реактивации с совместной культурой (замкнутые круги) и титры предварительно сформированного инфекционного вируса с помощью анализа бляшек (открытые круги). Круги — это титры отдельных мышей. Бары показывают среднюю и пунктирную линию, показывающую предел обнаружения анализа. Титры v-kLANA были значительно ниже, чем v-WT (тест Манна-Уитни). * Р <0,05. (B) Количественная оценка вирусных ДНК-положительных клеток в полных спленоцитах и ​​в сортированных GC-клетках (CD19 + CD95 + GL7 +). Данные из пулов из пяти селезенки на группу. Бары - это частота вирусных ДНК-положительных клеток. Шкалы ошибок указывают 95% доверительные интервалы. (C-E) Анализ проточной цитометрии. Представительные участки FACS от отдельных мышей показаны на левых панелях. Справа показаны графики квантования, в которых каждая точка представляет собой отдельную мышь. Бары - это средние значения. Данные объединяли из 2 независимых экспериментов с 5 мышами в каждой группе. (C) Общее количество GC В-клеток (CD19 + CD95 + GL7 +). NS, не имеет значения; * p <0,05 с использованием теста Манна-Уитни. (D) Процент клеток GC B, которые были YFP положительными. (E) Процент положительных клеток YFP, которые были GC B-клетками. *** p <0,001 in (D) и (E) с использованием теста Манна-Уитни.

Мы также исследовали частоту инфицированных клеток путем ограничения ПЦР разведения, в целом спленоцитах или в зародышевых центрах (ГК) В-клетках, поскольку этот подход непосредственно указывает количество латентно инфицированных клеток в отсутствие потребности в литической реактивации. Частота латентно инфицированных спленоцитов или клеток GC B для v-kLANA была на 1 log ниже, чем частота v-WT. В прямом контрасте латентно инфицированные клетки были на гораздо более низких уровнях для v-8A10 или v-Δ1007-21 (фиг. 4B).

Мы оценили возможность того, что снижение латентной инфекции v-kLANA на 14-й день может быть связано с различной кинетикой заражения v-kLANA по сравнению с v-WT путем изучения уровней латентности на 11 и 21 днях. Результаты показали, что v-kLANA латентная инфекция была аналогичным образом уменьшена по сравнению с v-WT на 11 и 21 дни, что указывает на постоянный дефицит во времени, а не на разную кинетику инфекции (S6 Fig). Мы также спросили, может ли более низкий уровень латентно инфицированных спленоцитов быть вызван уменьшенной литической репликацией v-kLANA в легких. Однако после внутрибрюшинной инфекции, которая обходит легкие для обеспечения доступа вируса к селезенке, латентная инфекция оставалась ниже для v-kLANA по сравнению с v-WT (S6A и S6B Fig).

Мы оценили скрытую инфекцию и популяции клеток GC B в селезенке проточной цитометрией через 14 дней после инфицирования вирусами WT или kLANA yfp. Процент В-клеток, которые были GC B-клетками, колебался между ~ 3-6% среди инфекционных групп (рис. 4C). Общее количество GC B-клеток было немного выше у мышей, инфицированных WT, по сравнению с kLANA, и значительно меньшие числа наблюдались для мутантов kLANA по сравнению с v-WT (рис. 4C, правая панель). Этот результат не является неожиданным в свете результатов на фиг. 4А и 4В, поскольку величина амплификации GC B-клеток после инфекции MHV68 коррелирует со скрытой вирусной нагрузкой [46]. Частоту инфицированных GC-клеток определяли из экспрессии YFP. Средний процент клеток YFP + GC B составлял 5,8% для v-WT.yfp и 1,4% для инфицированных v-kLANA.yfp мышей (рис. 4D, правая панель). Мыши, инфицированные мутантными вирусами kLANA, имели более чем 10-кратный более низкий процент YFP + GC B-клеток по сравнению с v-kLANA.yfp (рис. 4D). Около 80% инфицированных инфицированных клеток v-WT.yfp имели фенотип GC. Аналогично, ~ 60% инфицированных клеток v-kLANA.yfp имели фенотип GC (рис. 4E, правая панель). Напротив, из очень немногих инфицированных YFP + B-клеток в группах v-8A10.yfp и v-Δ1007-21.yfp, только малые проценты, 14 и 22%, соответственно, были GC B-клетками (рис. 4E, правая панель ). Таким образом, kLANA в значительной степени спасло задержку in vivo MHV68 в отсутствие mLANA, тогда как мутации, связанные с kLANA, которые устраняли эписомическую персистенцию, отсутствовали.

Чтобы дополнительно исследовать латентность v-kLANA, мы оценили экспрессию kLANA in vivo. Сначала мы подтвердили скрытую v-kLANA-инфекцию в селезенке путем выявления MHV68 miRNAs 1-6, которые экспрессируются в латентно инфицированных клетках [30]. Как и ожидалось, сигнал был обнаружен у инфицированных v-kLANA мышей, хотя в меньшем количестве клеток по сравнению с v-WT (фиг. 5A). LANA концентрируется до точек на участках эписомальной ДНК в ядрах латентно инфицированных клеток [7]. kLANA был обнаружен иммуногистохимией, иногда как ядерные точки, в соседних срезах в B-клетках фолликулов мышей v-kLANA (рис. 5B, стрелка). mLANA распределены аналогично в ядерных точках в секциях v-WT (рис. 5C). Мы также обнаружили точки LANA с помощью иммунофлюоресценции в v-WT (рис. 5D) или v-kLANA (рис. 5E), инфицированных В-клетчатых фолликулах.

Селезенки мышей, инфицированных 104 PFU v-WT или v-kLANA в течение 14 дней. (A) гибридизация in situ (коричневая) с зондами для вирусных miRNAs 1-6. Разделы контрастировали с Mayer’s Haemalum. (B, C) Обнаружение kLANA (B) и mLANA (C) иммуногистохимией в срезах, соседних с показанными на панели A. Стрелки на панели B указывают на ту же самую положительную ячейку kLANA. Стрелка на панели C указывает на положительную ячейку mLANA. Разделы контрастировали с гематоксилином. Сигнал kLANA не был обнаружен в срезах, окрашенных только вторичным антителом. (D, E) mLANA и kLANA, обнаруженные косвенной иммунофлюоресценцией. Изображения представляют собой проекции максимальной интенсивности Z-стеков, полученных по толщине селезенки. Никаких точек не наблюдалось в неокрашенных срезах или только с вторичными антителами. Увеличение 630x. (F) Количественное определение mLANA (n = 69 ядер из 3 мышей) или kLANA (n = 67 ядер из 3 мышей) точек на 100 μm3 ядерного объема. Бары указывают средства. Количество точек на объем не было существенно различным между v-WT и v-kLANA-мышами (тест Манна-Уитни, p> 0,05). (G) Вирусные геномы в FACS сортировали YFP + и YFP-GC B-клетки из селезенков v-WT.yfp (n = 7) и v-kLANA.yfp (n = 6) инфицированных мышей. Круги представляют отдельные мыши. Бары указывают средства. Не было существенной разницы между двумя инфекционными группами (тест Манна-Уитни, р> 0,05).

Мы количественно определили количество ядерных точек, так как LANA концентрируется на точках в вирусных эпизодах, и каждая точка указывает на вирусный геном. Поскольку целые ядра редко присутствовали в сечениях, мы подсчитали количество точек на ядерный объем через конфокальные z-стеки. Концентрация точек mLANA или kLANA была сходной, с показателями 8.2 (диапазон 2,2-21,0) и 7,7 (от 1,3 до 21,8) точек на 100 мкм3 соответственно (рис. 5F). Рассматривая объем ядро-цитоплазмы 4: 1 и диаметры 7-10 мкм для клеток GC B [47], мы оцениваем ядерный объем от 144 до 419 мкм3 для инфицированных клеток. Исходя из этих объемов, мы прогнозируем среднее значение от 12 до 34 mLANA или kLANA точек, а следовательно, вирусных эпизодов на ядро ​​в латентно инфицированных клетках в фолликулах B-клеток. Мы также квантифицировали вирусные геномы в FACS-сортированных клетках GC B от инфицированных мышей с помощью qPCR. В YFP + GC B-клетках среднее число копий на ячейку составляло 80,6 (от 56,5 до 120,1) и 84,9 (от 47 до 115,7) для v-WT.yfp и v-kLANA.yfp соответственно (фиг. 5G). Большее количество эпсиомов, определяемых ПЦР, может относиться к недооценке ядерного объема при расчете точек ЛАНА на ядро ​​или, возможно, к соседним геномам, наблюдаемым в виде одиночных точек. Вместе эти результаты показывают, что химерный вирус kLANA сохраняется на экземпляре WT-копии в ядрах латентно инфицированных спленоцитов.

Эта работа демонстрирует, что kLANA и mLANA действуют взаимно, чтобы опосредовать эписомную стойкость ДНК TR. Это функциональное сохранение обеспечило обоснование для оценки химерного MHV68 с заменой kLANA на mLANA. kLANA спасла дефицит mLANA, при этом химерный вирус обнаружил скрытую инфекцию in vivo. Эти результаты не всегда ожидались. Предыдущие работы показали, что поддерживающий белок вируса герпеса вируса гепатита V резуса гамма-1 действует на человеческий эпилептический элемент (EBV) человека in vitro для поддержки эписомы [48]. Однако герпесвирусы гамма-1 более тесно связаны с герпесвирусами гамма-2. Гамма-1 герпесвирусы заражают только людей (EBV) и не-человеческих приматов [49], а гепсувирус резуса гамма-1, по оценкам, расходится с EBV всего ~ 5 миллионов лет назад [50]. Напротив, герпесвирусы гамма-2 заражают людей (KSHV), не-человеческие приматы и многие виды не приматов. Соответственно, MHV68, по оценкам, расходится с KSHV ~ 60 миллионов лет назад [49,50]. В соответствии с этой степенью эволюционной дивергенции mLANA и kLANA существенно различаются в последовательности (фиг. 1A), а также по-разному с ДНК [51]; kTR (0.8kb) и mTR (1.2 kb) также различаются по размеру и не соответствуют гомологии последовательности, хотя оба они богаты GC (84,5% и 77,6% GC для kTR и mTR соответственно) [32]. В соответствии с выводами здесь наблюдалось сохранение функциональности для способности kLANA подавлять транскрипцию из mTR, аналогичную mLANA [52].

Меньший затухающий фенотип v-kLANA при скрытой инфекции по сравнению с v-WT может быть вызван дефицитом в литическом реактивации или связанными с ЛАНА эффектами роста. v-kLANA обнаружил дефицит 2 log по сравнению с v-WT в анализе на основе реактивации (фиг. 4A). Однако частота латентно инфицированных GC-клеток v-kLANA была только на 1 log ниже (фиг. 4B), хотя важно отметить, что количество клеток GC B было умеренно уменьшено в v-kLANA по сравнению с v-WT-инфицированным мышей (фиг. 4С). Остается возможным, что литическая реактивация может быть важной для расширения числа инфицированных клеток на ранних стадиях задержек. Тем не менее, также возможно, что kLANA не может полностью способствовать эффективному распространению инфицированных GC-клеток через такие функции, как регулирование mLANA уровней белка Myc и NF-kb посредством ubiquitination [53,54].

Несмотря на уменьшение количества инфицированных клеток GC B, kLANA полностью повторила способность mLANA поддерживать номер копии генома WT в клетках. Число копий Episome было одинаковым для v-WT.yfp и v-kLANA.yfp, независимо от того, определено ли оно количеством точек mLANA или kLANA на ядро ​​(каждая точка LANA соответствует эпизоду) (рис. 5F) или путем ПЦР вирусной ДНК от инфицированных клеток (фиг. 5G). Несмотря на то, что эти подходы привели к умеренно различным оценкам абсолютного количества геномов, оба указывают, что зараженные GCAN-клетки kLANA и mLANA содержат эквивалентное количество эпизодов на клетку.

Небольшой дефицит репликации легких химерного вируса kLANA предполагает, что kLANA не полностью заменяет mLANA на этой фазе инфекции. В предыдущей работе mLANA-нулевые вирусы или рекомбинанты, содержащие C-концевые мутанты mLANA, которые отменяли связывание ДНК, имели небольшие литические дефекты роста в культивируемых мышечных фибробластах [43, 52] и затухание в острой литической репликации легких [34,55,56] , Таким образом, для эффективной литической репликации считалось, что mLANA и, в частности, C-концевой связывающий ДНК ДНК. Фенотип ослабления легких v-Δ1007-21, который кодирует ДНК-связывающий дефицит kLANA, напоминает эти данные [55].

Обнаружение, что мутации kLANA 8A10 или Δ1007-21 отменяют способность MHV68 эффективно устанавливать латентность (рис. 4), демонстрирует постоянство эписомы, необходимое для создания задержки. LANA 8A10 или Δ1007-21 каждый отменяют способность LANA реплицировать ДНК и выделять эписомы на ядра потомков, устраняя ассоциацию хромосом или связывание ДНК, соответственно. Эти результаты показывают, что критическая функция этих остатков kLANA сохраняется в этой модели химерной инфекции.

Эта работа предлагает различия в эффективности обслуживания эпизода между kLANA и mLANA. Хотя как kLANA, так и mLANA действуют на ДНК TR, чтобы опосредовать стойкость эписомы, kLANA, по-видимому, действовала более эффективно на родственной ДНК, чем mLANA. kLANA поддерживал эпизоды в 100% (таблица 1) резистентных клеточных линий G418 после трансфекции ДНК k8TR, в то время как mLANA поддерживал эпизоды только у 25% -58% устойчивых к пуромицину клеточных линий после трансфекции ДНК m4TR-P. Использование четырех копий mTR в сравнении с восемью копиями KTR в этих экспериментах вряд ли будет объяснять существенно более низкую эффективность mLANA. Фактически, в предыдущей работе kLANA последовательно поддерживала эпизоды во всех резистентных клеточных линиях G418 после трансфекции плазмид, содержащих два, три или восемь копий КТР ([8,40,57]).

Возможно, что уменьшенная эффективность mLANA связана с присущими различиями в TR элементах, а не различиями между mLANA и kLANA. Как и ожидалось, kLANA опосредовало стойкость эпимуса более эффективно для kTR, чем для ДНК mTR (таблица 1). Однако mLANA также опосредовало стойкость эпимуса более эффективно для kTR по сравнению с mTR. mLANA опосредовала постоянство ДНК k8TR в 67-93% клеточных линий, в то время как сохранение ДНК m4TR происходило только в 25-58% клеточных линий. Хотя это различие может быть связано с дополнительными 4 элементами TR в k8TR по сравнению с m4TR, возможно, что элементы KSHV TR эволюционировали, чтобы обеспечить более высокий уровень эффективности обслуживания эпизода.

kLANA и mLANA демонстрируют взаимное связывание с последовательностями распознавания друг друга, хотя связывание kLANA с mLBS существенно слабее, чем связывание с kLBS (S4 Fig). Хотя сайты связывания ДНК kLANA и mLANA имеют существенную гомологию, они не идентичны (S4A Fig), а mLBS отличается от высокоаффинного kLBS1 на нескольких нуклеотидах, важных для связывания LANA [55, 58]. В соответствии с этими выводами, DBLAN kLANA связывает mLBS1-2 с KD 116,0 нМ по сравнению с 13,7 нМ для kLBS1-2 [51]. Уменьшенное связывание kLANA с mLBS может также относиться к его по-разному режиму термодинамического связывания по сравнению с mLANA.

Несмотря на менее эффективное связывание kLANA с mLBS, стойкость к краснухе kLANA в фолликулах селезенки с вирусом, сохраняющимся на уровнях WT в инфицированных клетках, о чем свидетельствует количество вирусных геномов на инфицированную клетку. kLANA и mLANA ДНК-связывающие домены обладают значительной структурной гомологией и взаимодействуют с образованием олигомеризованных димеров [55,59-61]. Вероятно, наличие нескольких элементов TR (каждый из которых содержит LBS1-2) в MHV68 приводит к усиленным кооперативным связыванию и / или другим событиям олигомеризации, которые повышают эффективность связывания, что может позволить kLANA эффективно опосредовать поддержание эпизода ДНК mTR и вируса упорство. Например, несмотря на мутации, которые породили тяжелый дефицит связывания ДНК ДНК с аминокислотой с mLBS1-2, mLANA эффективно опосредовал эписомную стойкость при установлении полного комплемента mTRs в MHV68 [62]. Кроме того, обнаружение больших, рекомбинантных 4TR и 8TR эпизодов здесь (рис. 1 и 2; S1 и S2 Рис.) И, как было замечено ранее [7,63,64], вероятно, отражает потребность в ~ 40 TR элементах, аналогичных тем, что KSHV, для оптимальной функциональной эффективности.

Здесь мы показываем, что, несмотря на более 60 млн. Лет эволюционных расхождений, mLANA и kLANA демонстрируют функцию поддержки реципрокных эпизодов, обеспечивая основу для анализа in vivo KSHV LANA. Этот химерный вирус должен позволять в будущем исследовать kLANA в хорошо зарекомендовавшей себя малой животной модели скрытой инфекции MHV68. Модель in vivo также предоставляет средства для оценки нацеливания kLANA с помощью таких стратегий, как ингибирование малых молекул. Наконец, этот подход потенциально может быть применен к другим вирусам, у которых отсутствуют небольшие модели животных, но для которых существуют модельные вирусные системы.

A20 мышиные клетки В-лимфомы [65] (АТСС) культивировали с RPMI, дополненной 10% Fetalplex (Gemini) или бычьей сывороткой роста (BGS) (Hyclone), бетамеркаптоэтанолом, пируватом натрия, HEPES, глутамакс (Invitrogen) и 15 мкг / мл гентамицина. Зараженные инфицированные клеточные линии, S11 (инфицированные MHV68) [66] и BCBL-1 (инфицированные KSHV) (NIH AIDS Reagent Program) поддерживались в RPMI с 20% BGS. Клетки S11 также дополняли бета-меркаптоэтанолом. Клетки BJAB выращивали в среде RPMI, содержащей 10% BGS (Hyclone) или Fetalplex (Близнецы) и 15 мкг / мл гентамицина. Клетки BJAB, стабильно экспрессирующие KSHV LANA, содержащие N-концевую эмпирическую эмбрионовую ФЛАГ (BJAB-kLANA) [7], выращивали в RPMI, содержащей 10% Fetalplex или BGS, и среду дополняли гигромицином B (200 единиц / мл Calbiochem). 293Т (АТСС) клетки выращивали в среде DMEM, содержащей 10% BGS. Клетки NIH-3T3-CRE [67] выращивали в модифицированной Дульбекко среде Eagle (DMEM), дополненной 10% инактивированной энергией фетальной бычьей сыворотки, 2 мМ глутамина и 100U / мл пенициллина и стрептомицина. Фибробласты почек детеныша хомяка (BHK-21, клон 13 CCL-10) (АТСС) культивировали в модифицированной в Глазго среде Eagle (GMEM), дополненной как для клеток NIH-3T3-CRE, с добавлением 10% триптозофосфатного буфера , Было подтверждено, что клетки были свободны от микоплазмы.

mLANAF [33] содержит mLANA с 3-кратным C-концевым тегом FLAG, приводимым в действие его нативным промотором. mLANA с N-концевыми метками Myc и C 3 × FLAG-эпитопами генерировали путем переваривания pCMV-myc-mLANA-C3F с помощью SacI и XhoI, и полученный фрагмент mLANA лигировали в вектор pBluescript + II, расщепляемый SacI и XhoI. m2TR, m4TR и m8TR [33] содержат две, четыре или восемь копий mTR элементов повторного терминала MHV68. Для генерации m4TR-P ген устойчивости к неомицину был удален из m4TR путем переваривания BglII и HpaI, а сайт BglII затуплен. Ген резистентности к пуромицину был удален из pBabe puro [68] путем переваривания ClaI и SnaBI, сайт ClaI затуплен, а фрагмент был вставлен в расщепленный mpaTR HpaI и BglII, образуя m4TR-P. Для генерации pRepCK-P mTR были удалены из pm4TR-P невалютным расщеплением и сайтом NotI. Для генерации pk8TR-P p8TR (pk8TR) [40] расщепляли MluI и PsiI для выделения гена устойчивости к неомицину и затем лигировали с фрагментом ДНК MluI / PsiI, содержащим ген устойчивости к пуромицину, из pm4TR-P.

Экстракты, полученные из резистентных клеток, содержащих 0,25 × 10 6 пуромицинов, загружали на каждую полосу для блоттинга FLAG-антитела и 0,5х106 клеток на полосу, загружали для блоттинга, прощупаемого моноклональным антителом 6A3 против mLANA на S3. Моноклональное антитело 6A3 мыши [55], которое было поднято против mLANA аминокислот 140-314, был получен в моноклональной базе антител, Европейской лаборатории молекулярной биологии. Белки разрешали на 8% SDS-PAGE, переносили в нитроцеллюлозу и детектировали антителом против FLAG, конъюгированным с HRP (Sigma), используемым при разведении 1: 750, мышиным антитубулиновым моноклональным антителом B-5-1-2 (Sigma ), используемого при разведении 1: 1000, или супернатанте гибридомы 6А3, используемом при разведении 1: 2. Вторичное конъюгированное антитело против мышиного HRP с последующей хемилюминесценцией использовали для обнаружения антител против тубулина и 6A3. Анти-kLANA-крысиное моноклональное антитело (LN53, ABI Sciences) использовалось при 1: 1000, анти-vCyclin (mORF72) [69] (подарок от Samuel Speck) использовали в 1: 500, кроличьи анти-M3 поликлональные [70] использовали при 1: 3000, мышь anti-eGFP (Clontech) использовали при 1: 1000, а кроличьи антиактины (Sigma) использовали при 1: 1000. Конъюгированные вторичные антитела конъюгированной пероксидазы лошади (HRP) были получены от GE Healthcare и Jackson Immunoresearch.

Десять миллионов клеток A20 в логарифмической фазе трансфицировали 35 мкг mLANAF или 35 мкг pRepCK-вектора в 400 мкл RPMI, содержащей 10% сыворотки, но без антибиотиков, путем электропорации с использованием системы электрофореза BTX Electrosquare Porator T820 путем пульсирования клеток при 225 вольтах за 65 миллисекунд один раз. Через три дня после трансфекции клетки высевали в микротитровальные планшеты на 5000, 1000 или 100 клеток на лунку и помещали под выборку G418 (400 мкг / мл) (Близнецы). Клоны, устойчивые к G418, были расширены, и те, которые были трансфицированы mLANAF, были скринированы на экспрессию mLANAF иммуноблотом антителом против FLAG.

Устойчивые к G418 клетки A20 или устойчивые к G418 клетки A20, стабильно экспрессирующие mLANAF, трансфицировали, как указано выше, 35 мкг m4TR-P, pk8TR-P или pRepCK-P и культивировали в RPMI, дополненной 400 мкг / мл G418 (Близнецы) в течение 3 дней. Затем клетки высевали в 96-луночные планшеты на 10, 100 или 1000 клеток на лунку, а пуромицин 2,5 мкг / мл (Invitrogen) включали в среду в дополнение к G418. Расширялись клеточные линии, устойчивые как к пуромицину, так и к G418.

Клетки BJAB-kLANA выращивали в логарифмической фазе в течение трех последовательных дней, а затем десять миллионов клеток трансфецировали 35 мкг m2TR, m4TR, m8TR, pk8TR, pRepCK или плазмидную ДНК, спасенную из клеток, содержащих эписомы, в 400 мкл среды RPMI с 10% сыворотки при 200 В и 960 мкФ в кювете с 0,4 см-см с электропоратором Bio-Rad. Через три дня после трансфекции клетки высевали в микротитрационные планшеты на 1, 10, 100 или 1000 клеток на лунку в среде, содержащей G418 (600 мкг / мл, Gibco или Gemini), а затем расширились до 6-луночных планшетов.

Гель-анализ Гарделлы [71] проводили на клеточных линиях A20 или BJAB. Клетки лизировали in situ в гель-загрузочных лунках, снабженных ДНК-свободной протеазой (Sigma # P6911) и додецилсульфатом натрия, и проводили электрофорез в Tris-borate-EDTA. Затем ДНК переносили в нейлоновую мембрану и детектировали с помощью авторадиографии с использованием меченого 32Р зонда.

Устойчивые к G418 клетки BJAB-kLANA, трансфицированные m8TR, k8TR или pRepCK, были метафазой, подвергнутой инкубации в течение 16 часов с 1 мкг / мл колчемида (Calbiochem). 0,2 × 10 6 клеток ресуспендировали в 1 мл гипотонического буфера (1% -ный Na-цитрат, 1 мМ MgCl2, 1 мМ CaCl2) в течение 5 минут. 300 мкл клеток распределяли на полилизиновую ползу от цитопсина (Thermoshandon), фиксировали в 4% формальдегиде, проницали с 0,5% тритона X-100 и блокировали в 20% козьей сыворотке. kLANA был обнаружен путем инкубации с моноклональным антителом против kLANA IA-2-12 (подарок Mary Ballestas) [72], разведенным 1: 1000 в 20% козьего сыворотки в течение двух часов с последующей инкубацией с вторичным антителом против мыши, конъюгированным с Alexa Фтор 488 (Молекулярные зонды) разводили 1: 1000 в 20% сыворотке коз. ДНК была обнаружена с использованием иодида пропидия в концентрации 1 мкг / мл (Invitrogen). Слайды высушивали в этаноле 70%, а затем инкубации в 90% и 100% этаноле перед тем, как покровные стекла наносили на держатель Aqua-Poly (Polysciences). Микроскопия проводилась с помощью оборудования Zeiss Axioskop, PCM2000 и программного обеспечения для обработки изображений C (Compix, Inc.).

ДНК, кодирующая ген kLANA и 5’UTR, фланкированный геномной последовательностью MuHV4, клонировали в pSP72 (Promega). 5′-конец mORF73 и верхняя фланкирующая область (координаты 104710-105092, присоединение GenBank U97553) были амплифицированы ПЦР из генома MuHV-4 с праймерами Imm_TR1 (AAAGAATTCAATCACCTTGGCATCC) и Imm_TR2 (AATGCCTGAAGATCTTCCAG). Primer Imm_TR1 представляет EcoRI-сайт (подчеркнутый) четырьмя основаниями после сайта донора mORF72-сращивания (двойной подчеркнутый) и мутацией C104710A (жирным шрифтом), чтобы изменить ATG (координата 104712) на ATT. Primer Imm_TR2 содержит геномный сайт BglII (координата 105087). ПЦР-фрагмент клонировали в pSP72 с использованием сайтов BglII / EcoRI для создания pSP72_PCR1. MORF73 АТГ (координата 104869) и два входных последовательностей ATG (координаты 104779 и 104714) были изменены, чтобы АТТ в pSP72_PCR1 с помощью QuikChange Мульти сайт-направленный мутагенез (Stratagene) и праймеров Imm_TR5_C104721A (GAATTCAATCACCTTGGAATCCCGGTGGTGG), Imm_TR6_C104777A (GCGTCTTTTAGGAGGAATGGCTGCTGGTTTG) и Imm_TR7_C104867A (CGGTGGGGATGTGGGAATTATCTGAAAGAG) (мутированные нуклеотиды выделены жирным шрифтом). Полученную плазмиду называли pSP72_PCR1_2. Область KSHV, кодирующая N-концевую область kLANA и 5’UTR (координаты 126473-127886, присоединение GenBank U75698), была амплифицирована ПЦР из ДНК фага L54 [73] с праймерами Imm_TR8 (ATCACCCCAGGATCCCTCAGAC) и Imm_TR9 (AAAGAATTCATTTGGAGGCAGCTGCG). Imm_TR8 содержит геномный сайт BamHI (подчеркнуто, координата 126473), а Imm_TR9 представляет сайт EcoRI (подчеркнутый) перед kLANA 5’UTR. Продукт ПЦР лигировали в сайты BamHI / EcoRI pSP72_PCR2 для генерации pSP72_PCR1_3. ДНК, кодирующую остальную часть kLANA (соответствующую геномным координатам 123808-126473), амплифицировали с помощью ПЦР из pEGFP kLANA [40] с праймерами Imm_TR10 (AAAAAGCTTTTATGTCATTTCCTGTGG) и Imm_TR11 (CTGAGGGATCCTGGGGGGGGG). IMM_TR10 представляет сайт HindIII (подчеркнутый) после стоп-кодона kLANA (жирный шрифт). Imm_TR11 содержит геномный сайт BamHI (подчеркнуто, координата 126473). Продукт ПЦР лигировали в pSP72_PCR1_3 с использованием сайтов HindIII и BamHI для создания pSP72_PCR1_4. Нижняя фланкирующая область mORF73 (координаты 102728-103934) была получена ПЦР из ДНК MuHV-4 с праймерами Imm_TR3 (AAACTCGAGCAGATGAGATCTGTACTC) и Imm_TR4 (AAAAAGCTTTCAGACATAAATCACATTC). Imm_TR3 вводит XhoI-сайт (подчеркнутый) 6 нуклеотидов из геномного сайта BglII (координата 102728, двойной подчеркнутый), а IMM_TR4 представляет сайт HindIII (подчеркнутый) после стоп-кодона M11 (полужирный). Продукт ПЦР клонировали в сайты XhoI / HindIII pSP72_PCR1_4 для генерации pSP72_PCR1_5. Аланиновые замены 8LRS10 до 8AAA10 в kLANA были введены ПЦР в pSP72_PCR1_3 с использованием праймера kLANA_8AAA10 (CCGGGAATGCGCGCCGCAGCGGGACGGAGCACCGG) (мутированные нуклеотиды выделены жирным шрифтом). Мутированная область субклонирована из pSP72_PCR1_3_8A в сайты BamHI / SacI pSP72_PCR1_5 для создания pSP72_PCR1_5_8AAA10. ДНК-кодирование kLANA Δ1007-21 субклонировали из pSG5 kLANA delta 1007-21 [41] в pSP72_kLANA с помощью BamHI и StuI для генерации pSP72_PCR1_5_Δ1007-21. Последовательность областей, полученных из ПЦР, была подтверждена секвенированием ДНК. Последовательности KSHV, фланкированные геномными последовательностями MUHV4 из pSP72_PCR1_5, pSP72_8A и pSP72_Δ1007-21, субклонировали в геномный фрагмент BamHI-G MuHV-4, клонированный в челночной плазмиде pST76K-SR, с использованием сайтов BglII. Каждую рекомбинантную плазмиду BamHI-челнока трансформировали в E.coli, унаследовающую BAC (pHA3) [74] или WF MuHV-4 BAT (YFP) -WT MuHV-4 BAC [42]. После многоступенчатой ​​процедуры отбора [74] рекомбинантные геномы BAC были идентифицированы с помощью профилей расщепления ПЦР и HindIII, BamHI и EcoRI. Вирусы восстанавливали путем трансфекции ДНК BAC в клетки BHK-21 с использованием X-tremeGENE HP (Roche Applied Science). Кассетку BAC с фланцем Box IoxP удаляли путем вирусного прохода через клетки NIH-3T3-CRE.

Исследования животных проводились в соответствии с официальным директором ветеринарной службы Португалии (Portaria 1005/92), Европейским директивом 86/609 / EEC и Ассоциацией европейских ассоциаций лабораторных ассоциаций животных в области лабораторного благополучия животных. Эксперименты на животных были одобрены официальным ветеринарным отделом Португалии по лицензированию благосостояния (протокол AEC_2010_017_PS_Rdt_General) и Комитетом по этике животных им.

Запасы вирусов были получены путем инфицирования клеток BHK-21 (0,001 PFU / клетка). Вирусы собирали из очищенных супернатантов путем центрифугирования при 15000 г в течение 2 ч при 4 ° С. Титразы инфекционных вирусов определяли с помощью анализа бляшек в клетках БХК-21. Для экспериментов с мышами размер выборки основывался на наших и других предыдущих исследованиях, которые дают биологически достоверные данные. В частности, размер выборки варьировался от 3 мышей к группе до максимум 5 в зависимости от характера эксперимента. Специальная рандомизация или ослепление не применялись. Для инфекций in vivo 6-8-недельные самок мышей C57BL / 6 J (Charles River Laboratories) инокулировали интраназально под анестезией изофлуораном с 104 PFU в 20 мкл PBS. В указанные моменты времени после заражения мышей умерщвляли и собирали легкие или селезенки. Легкие гомогенизировали, замораживали-оттаивали и титры определяли путем анализа бляшек. Одноцепочечные суспензии готовили из селезенки, а реактивирующий вирус количественно определяли путем совместной культивирования с клетками BHK-21. Анализ налета проводили в эквивалентных образцах с замораживанием-оттаиванием для определения предварительно сформированного инфекционного вируса. Плиты инкубировали в течение 4 дней (анализ бляшек) или 5-дневный (анализ с совместной культурой), затем фиксировали 4% формальдегидом и окрашивали 0,1% толуидиновым синим. Бляшки подсчитывали с помощью пластинчатого микроскопа.

Одноцепочечные суспензии готовили из селезенки. После лизиса эритроцитов в гипотоническом растворе NH4Cl количество жизнеспособных клеток определяли путем исключения трипанового синего. Fc-рецепторы блокировали анти-CD16 / 32 (2,4G2) (BD Pharmigen), разведенным в FACS-буфере (PBS, содержащем 2% фетальную бычью сыворотку) в течение 15 минут на льду. Клетки инкубировали в течение 25 минут на льду со следующими антителами, разведенными в FACS-буфере: APC-H7-конъюгированный анти-CD19 (1D3) (BD Pharmingen), используемый при 1: 400, PE-конъюгированный анти-CD95 (Jo2) (BD Pharmingen ), используемого при 1: 800 и eF660-конъюгированном анти-GL7 (GL7) (eBioSciences Inc), используемом в 1: 200. YFP и маркеры клеточной поверхности и были обнаружены на LSR Fortessa (BD BioSciences) с использованием программного обеспечения DIVA и данные были проанализированы с помощью FlowJo 9.3.2 (Tree Star). Клетки были закрыты на живых клетках и синглетах на основе параметров FSC / SSC и FSC-A, соответственно. Общее количество GC-клеток определяли на основании данных FACS и количества клеток спленоцитов.

Частоту вирусных ДНК-положительных клеток определяли в общих спленоцитах или GC B-клетках путем ограничения разведения в сочетании с ПЦР в реальном времени. Спленоциты объединяли из 5 мышей. GC B-клетки (CD19 + GL7 + CD95 +) очищали из пулов 5 селезенки, используя цитометр BD FACSAria Fow (BD BioSciences). Чистота сортированных клеток была более 95%. Клетки серийно разводили дважды и 8 повторов каждого разведения анализировали с помощью ПЦР в реальном времени (Gene Rotor Gene 6000, Science Life Corbett). Наборы праймеров / зондов были специфичны для гена M9 MHV68 (праймеры M9-F 5′-GCCACGGTGGCCCTCTA и M9-R 5′-CAGGCCTCCCTCCCTTTG -3, а зонд Taqman M9T, 5′-6-FAM-CTTCTGTTGATCTTCC-MGB-3 ‘ ). Положительные и отрицательные реакции оценивали с использованием программного обеспечения Rotor Gene 6000 и определяли частоту инфицированных клеток, как описано [46].

YFP- и YFP + GC B-клетки (CD19 + GL7 + CD95 +) были FACS, отсортированные из отдельных селезенков инфицированных мышей с использованием BD FACSAria Fow Cytometer (BD BioSciences). Вирусные геномы были обнаружены ПЦР в реальном времени с использованием праймеров M9 и зонда Такмана, описанных выше. Клеточную ДНК количественно оценивали параллельно путем детектирования гена рибосомного белка L8 (Rpl8) (праймеры mRpl8 F1 5′-CATCCCTTTGGAGGTGGTA и mRpl8 R1 5′-CATCTCTTCGGATGGTGGA и зонда Taqman mRpl8T 5′-VIC-ACCACCAGCACATTGGCAAACC-MGB), как описано выше. Реакции проводили в роторе Gene 6000 (Corbett Life Science), и данные анализировали с помощью программного обеспечения Rotor Gene 6000. Продукты ПЦР превращали в копии генома по сравнению со стандартной кривой плазмиды, содержащей ген MHV68 M9 или ген мыши rpl8 (мышь cDNA NM_012053, Origene), последовательно разбавляли в том же буфере, что и образцы. Количество копий вирусных генов для каждой ячейки было получено путем деления количества копий M9 на половину количества копий Rpl8.

Селезенки фиксировали в 10% формалине в PBS в течение 24 часов при комнатной температуре и вставляли парафин. Гибридизацию in situ для обнаружения miRNA-кодированных MuHV-4 проводили в 5 мкм срезах с использованием меченых дигоксигенином рибопробов, генерируемых транскрипцией T7 pEH1.4, как описано ранее [30]. Для обнаружения белков LANA разрезали 4 мкм срезы, обезжиривали, обрабатывали кислотой для извлечения антигена и блокировали белковым блоком (DAKO) для окрашивания kLANA или с использованием мышиного набора (DAKO) для окрашивания mLANA. Разделы инкубировали в течение 1 часа при комнатной температуре с анти-mLANA mAb 6A3 (разведение 1: 2 супернатанта гибридомы) или антителом против kLANA крысы (1: 1000). Для иммуногистохимии первичные антитела были обнаружены с помощью набора анти-мышиного набора ENVISION (DAKO) или ImmPress HRP Anti-Rat IgG Peroxidase Polymer Detection Kit (Vector Laboratories), которые используют систему обнаружения пероксидазы / DAB. Слайды контрастировали с гематоксилин-эозином, и изображения были получены с помощью микроскопа Leica DM2500, соединенного с цифровой камерой. Для иммунофлюоресценции первичные антитела были обнаружены с помощью антител против мышиной Alexa 594 или антител против Alexa-568 (Molecular Probes). Разделы были смонтированы в реале золота Prolong с DAPI (Molecular Probes) для окрашивания ДНК. Изображения были получены с помощью конфокального микроскопа Zeiss LSM 710 с увеличением 630x и с использованием программного обеспечения Zen. Изображения обрабатывались с помощью Image J. Для количественного определения точек были обнаружены конфокальные z-стопки ядер, идентифицированные с окрашиванием DAPI, содержащие точки mLANA или kLANA из разных областей селезеночных фолликулов. Число точек в отдельных ядрах подсчитывалось D через z-стеки. Поскольку большинство ядер не были целыми в селезенке, мы определили количество точек на ядерный объем. Сначала мы определили ядерный объем в каждом срезе, умножив площадь ядер, измеренную с помощью ImageJ, на толщину конфокального среза. Конечным объемом для каждого ядра была сумма объемов срезов.

Статистическую значимость оценивали с помощью непарного двухстороннего непараметрического теста Манна-Уитни U или одностороннего непараметрического теста ANOVA (критерий Крускала-Уоллиса), в зависимости от случая, с использованием программного обеспечения GraphPad Prism.

(DOCX)

Щелкните здесь для получения дополнительных данных.

(DOCX)

Щелкните здесь для получения дополнительных данных.

(DOCX)

Щелкните здесь для получения дополнительных данных.

(DOCX)

Щелкните здесь для получения дополнительных данных.

(A) Схематическая диаграмма, показывающая сайты расщепления для плазмид m4TR, m8TR или pk8TR с NotI или HindIII / XhoI, соответственно. Показаны размеры ожидаемых фрагментов. TR, один элемент mTR; tr, один элемент kTR; нас, уникальная последовательность KSHV. (Фиг. 1В, дорожки 6 и 7), m8TR (фиг. 1C, дорожки с 19 по 21) или m4TR (фиг. 1B, дорожки 6 и 7), m8TR (фиг. 1B, дорожки 6 и 7) 1B, дорожка 16), собирали в течение 76 дней после выбора G418. ДНК с низкой молекулярной массой выделяли, расщепляли NotI (панель B) или HindIII и XhoI (панель C) и оценивали по Саузерн-блоттингу. Время экспозиции указывается ниже каждого пятна. Линейные буквы соответствуют тем же буквам, что и на рис. 1. Панель слева в (B) находится на 16-часовой экспозиции, а справа показывает полосы 6-11 после 4-дневной экспозиции.

(JPG)

Щелкните здесь для получения дополнительных данных.

После ~ 90 дней отбора G418 ДНК с низкой молекулярной массой очищали из клеточной линии BJAB-kLANA, устойчивой к G418, содержащей эпизоды k8TR (клеточная линия a, показанная на фиг.1C, дорожка 3 и на фиг.1D, дорожка 5) или из двух G418-устойчивые клеточные линии BJAB-kLANA, содержащие эпизоды m8TR (клеточная линия d, показанная на фиг.1C, дорожка 8 и фиг.1D, дорожка 10 и линия клеток f, показанная на фиг.1C, дорожка 10 и фиг.1D, дорожка 11), трансформированы путем электропорации в бактерии и бактерий, выбранных для устойчивости к ампициллину. (A) Переваривание рестрикционного фермента с помощью NotI. (B) Расщепление рестрикционным ферментом с HindIII и XhoI. (C) Переваривание рестрикционного фермента с помощью HindIII. (D) анализ гелеобразования Gerrella Rm8TR-f.i в клетках BJAB-kLANA после 58 дней выбора G418. Блот зондировали ДНК 32P-m8TR. O, гель. Вертикальная линия справа указывает на эпизоды mTR. Для плазмидной ДНК самым быстрым мигрирующим сигналом является круговая, ковалентно замкнутая ДНК. Дорожка 13 была положительной для эписомальной ДНК при более длительной экспозиции. Размытый сигнал в дорожках 12-23 в нижней половине геля обусловлен деградацией ДНК.

(JPG)

Щелкните здесь для получения дополнительных данных.

(A) Иммуноблоты mLANA, обнаруженные моноклональным антителом 6A3 или FLAG. Клетки A20 устойчивы к G418. mLANAF-m4TR полосы из клеток с эпизодами в 47 дней выбора G418. Лейн 9 имеет клетки A20, трансфецированные mLANAF-m4TR через 3 дня после трансфекции. mLANAF мигрировал немного медленнее, чем S11 mLANA из-за 3xFLAG. В каждую полосу были загружены клетки размером 0,5 × 10 6 (верхняя панель) или 0,25 × 106 клеток (FLAG-пятно). (B, C) анализы гель-геллера клеток A20 или клеточных линий A20-mLANA, трансфецированных m4TR-P. На каждую полосу загружали ячейки 2-3х106. O, происхождение геля; E, S11 эпизоды; L, S11 линейных геномов из-за литической репликации; вертикальные линии указывают на эпизоды m4TR; Звездочка указывает ccc плазмидную ДНК. (D) Иммуноблот клеточных линий, устойчивых к пуромицину mLANA, из панели C. (E) Иммуноблот устойчивых к клеткам клеток, устойчивых к пуромицину mLANA, из панели D. В каждую полосу загружали клетки размером 0,25 × 10 6. Нижние панели показывают тубулин.

(JPG)

Щелкните здесь для получения дополнительных данных.

(A) Выравнивание kLBS 1-2 с mLBS 1-2. Идентичные нуклеотиды показаны синим цветом. (B) EMSA с in vitro переведенным mLANA или kLANA или (C) EMSA с очищенным mLANA или DBLAN. (B) Длительное воздействие полос 11-14 показано справа. Звезда (дорожка 18) или звездочки (дорожка 14) обозначают суперсферированные комплексы. (C) сплошной круг указывает смещенные комплексы в дорожках 13, 14. P, свободный зонд 32P.

(TIF)

Щелкните здесь для получения дополнительных данных.

Экспрессия вирусных белков после инфицирования клеток BHK-21 в течение 6 часов 3 PFU / клеткой вируса v-WT или v-kLANA. (A) Конфокальные изображения после иммунофлюоресцентного окрашивания mLANA или kLANA. ДНК окрашивали DAPI. Увеличение 630x. (B) Иммуноблот для kLANA, mLANA, vCyclin или M3. (C) клетки BHK-21 инфицировали 0,01 PFU / клеткой вируса v-WT или v-kLANA и определяли титры. Не было значимой статистической разницы между инфекционными группами (p> 0,05 с использованием однонаправленного непараметрического ANOVA Kruskal-Wallis.) (D) Титра вируса легкого после инфицирования 104 PFU указанных вирусов. Каждый круг представляет собой отдельную мышь, бары указывают среднее значение. Титры значительно различались между v-WT и v-Δ1007-21.yfp на 7-й день (* p <0,05, используя однонаправленный непараметрический ANOVA Kruskal-Wallis, а затем сравнительный тест Dunn). Других статистически значимых различий не было.

(TIF)

Щелкните здесь для получения дополнительных данных.

Мышей C57 Bl / 6 инфицировали вирусом v-WT или v-kLANA, и селезенки собирали на 11-й день, 14 (панели A, B) или 21 (C, D) после инфицирования. (A, C) титры вируса реактивации (замкнутые круги) и титры предварительно сформированного инфекционного вируса (открытые круги). Круги представляют собой титры отдельных мышей. Бары показывают среднюю и пунктирную линию, показывающую предел обнаружения анализа. (B, D) Частота инфицированных спленоцитов, определяемых параллельно в пулах селезенки из каждой группы инфицирования. Бары представляют собой частоту вирусных ДНК-положительных клеток, а полосы ошибок указывают 95% доверительные интервалы.

(TIF)

Щелкните здесь для получения дополнительных данных.

(DOCX)

Щелкните здесь для получения дополнительных данных.

(DOCX)

Щелкните здесь для получения дополнительных данных.

(DOCX)

Щелкните здесь для получения дополнительных данных.

Horng-Shen Chen клонировали m4TR-P и Kambez Benam клонировали pCMV-myc-mLANA-C3F. Mary Ballestas предоставила анти-LANA-антитело. Мы благодарим гистологию и сравнительную патологию, биоионизацию и проточную цитометрию, Институт молекулярной Лиссабон. Мы благодарим Таню Карвалью за задумчивые дискуссии.

Комментариев нет.

Добавить комментарий

Ваш e-mail не будет опубликован. Обязательные поля помечены *