Нажмите "Enter", чтобы перейти к контенту

Эпигенетический ландшафт саркомы, ассоциированного с геном Herpesvirus от Kaposi, в тканях Саркомы классического Капоши

Epigenetic Landscape of Kaposi's Sarcoma-Associated Herpesvirus Genome in Classic Kaposi's Sarcoma Tissues
Источник: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5291540/

Авторы заявили, что не существует никаких конкурирующих интересов.

Концептуализация: RS ESR KL.

Формальный анализ: RS.

Приобретение финансирования: ESR KL.

Исследование: RS.

Методология: RS.

Ресурсы: XT XinW XiaW LY.

Надзор: ESR KL.

Написание — оригинальная черновик: RS ESR KL.

Связанный с саркомой Капоши герпесвирус (KSHV) является этиологически связанным с саркомой Капоши (KS), первичной эффузионной лимфомой (PEL) и многоцентровой болезнью Каслмана (MCD). Он обычно отображает два разных этапа в своем жизненном цикле, латентность по умолчанию и случайную литическую репликацию. Считается, что эпигенетические модификации определяют судьбу инфекции KSHV. Предыдущие исследования элегантно изображали эпигенетический ландшафт латентного вирусного генома в системах клеточной культуры in vitro. Однако физиологически релевантный сценарий в клинических образцах тканей KS неясен. В настоящем исследовании мы установили протокол ChIP-Seq для клинических образцов тканей KS и наметили эпигенетический ландшафт генома KSHV в классических тканях KS. Мы исследовали модификации гистонов AcH3 и H3K27me3 на геноме KSHV, а также геномные сайты связывания с латентным ядерным антигеном (LANA). Наши результаты показали, что обогащенный AcH3 был в основном ограничен скрытым локусом, а H3K27me3 был широко распространен на геноме KSHV в классических тканях KS. Эпигенетический ландшафт в области гена vIRF3 подтвердил свое молчаливое состояние в тканях KS. Между тем, обильное обогащение LANA в терминальном повторном (TR) регионе также было подтверждено в классических тканях KS, однако на геном хозяина наблюдались различные сайты связывания LANA. Кроме того, мы проверили модификации гистонов ChIP-qPCR и обнаружили доминирующий репрессивный H3K27me3 в промоторной области репликации и активатора транскрипции (RTA) в классических тканях KS. Интригующе мы обнаружили, что область TR в классических тканях KS отсутствовала в модификациях гистонов AcH3. Эти данные теперь установили эпигенетический ландшафт генома KSHV в классических тканях KS, который дает новые идеи для понимания эпигенетики и патогенеза KSHV.

Предполагается, что эпигенетические модификации определяют судьбу инфекции KSHV. Эпигенетический ландшафт генома KSHV в системах клеточной культуры in vitro был хорошо изучен ранее. Однако физиологически релевантный сценарий в клинических тканях KS неясен. В этом исследовании мы провели эксперименты ChIP-Seq в классических тканях KS и наметили модификации гистонов AcH3 и H3K27me3 на геноме KSHV, а также сайты связывания LANA в масштабе генома. Результаты показали сходный ландшафт H3K27me3, но отличались AcH3-образцами генома KSHV по сравнению с результатами культивированных in vitro культивированных клеток PEL и KSHV, инфицированных KSHV. Интригующе, были обнаружены различные сайты связывания LANA, обнаруженные в геноме хозяина, и было обнаружено уменьшение количества модификаций гистонов AcH3 в области TR генома KSHV. Установленный эпигенетический ландшафт генома KSHV в классических тканях KS дает новое представление о нашем понимании эпигенетики KSHV, что важно для будущих исследований механизма инфекции и патогенеза KSHV.

Все соответствующие данные содержатся в документе и его файлах вспомогательной информации; Все файлы данных ChIP-Seq доступны из базы данных NCBI SRA (номер доступа SRP081036).

Связанный с саркомой Капоши герпесвирус (KSHV) впервые был идентифицирован в биопсии саркомы Капоши (KS) Чангом и Муром в 1994 году и, как было доказано, является этиологическим агентом нескольких раковых заболеваний человека, включая KS, первичную эффузионную лимфому (PEL) и многоцентровое заболевание Castleman (MCD) [1-3]. KSHV представляет собой двухцепочечный ДНК-вирус с большим геномом около 170 Kb, принадлежащий подсемейству гамма-герпеса [4, 5]. Он обычно отображает два разных этапа в своем жизненном цикле, латентность по умолчанию и случайную литическую репликацию [5]. Во время латентности вирусные геномы сохраняются как эпизоды с ограниченной экспрессией латентного гена в ядре инфицированной клетки, а вирион не образуется [6, 7]. Скрытые гены группируются в одном локусе в геноме, включая ORF73 (латентный ядерный антиген, LANA), ORF72 (vCyclin), ORF71 / K13 (vFlip), K12 (Kaposin) и кластер miRNAs [8, 9] , При определенных условиях, таких как гипоксия, клеточный стресс и вальпроевая кислота или стимуляция бутиратом, вирус будет активироваться из латентности с организованной экспрессией литических генов, что приведет к массивному производству зрелых вирионов [10-12]. Активатор репликации и транскрипции (RTA), закодированный ORF50, является регулятором ключа, который контролирует реактивацию KSHV [13, 14]. Добавление ингибиторов ДНК метилтрансферазы или гистондеацетилаз к инфицированным KSHV клеткам может эффективно индуцировать экспрессию RTA, которая способствует проникновению вируса в литическую репликацию из латентности [11, 15, 16].

Поскольку эпигенетические модификации, как полагают, определяют судьбу инфекции KSHV, важно понять эпигенетический статус вирусного генома во время латентности и реактивации [17-20]. В предыдущих исследованиях были изящно изображены модификации гистонов по всему геному генома KSHV в системах клеточной культуры in vitro [21, 22]. Было продемонстрировано, что активирование модификаций гистонов, таких как ацетилирование гистонов (AcH3), только обогащено несколькими локусами, тогда как репрессивные модификации гистонов, такие как H3K27me3, широко распространены по вирусному геному, что хорошо объясняет картину экспрессии вирусных генов во время латентности [21, 22] , В то время как большинство исследований установлено на использование культивируемых in vitro клеток, подвергнутых PEL и KSHV-инфицированным эндотелиальным клеткам, физиологически релевантный сценарий в клинических образцах KS неясен.

KS — высокососудистая саркома на коже, происходящая из эндотелиальных клеток, которая характеризуется инфильтрированными воспалительными клетками и неоангиогенезом [8, 23]. Согласно географическому распределению и клиническим результатам, KS можно разделить на четыре подтипа, которые являются классическими, эндемичными, ятрогенными и связанными со СПИДом KS. Все подтипы поражений KS имеют общую гистологическую характеристику, но существенно различаются при прогрессировании заболевания [23-26]. Структура экспрессии латентных генов в KS не совсем такая же, как в PEL [27, 28]. Предыдущее исследование показало, что экспрессия гена vIRF3 обнаруживается только в образцах ПЭЛ, что указывает на отчетливый эпигенетический статус в КС [28]. Как правило, клетки, полученные из тканей KS, очень быстро теряют эпизоды во время культуры in vitro, поэтому трудно получить клеточные линии, отражающие физиологически релевантный сценарий в тканях KS [29, 30]. Поэтому важно непосредственно определить эпигенетический ландшафт генома KSHV в тканях KS.

В настоящем исследовании мы установили протокол ChIP-Seq для клинических образцов KS и непосредственно наметили эпигенетический ландшафт генома KSHV в классических тканях KS, которые связаны только с инфекцией KSHV и получены из района Синьцзян в Китае. В частности, мы исследовали модификации гистонов AcH3 и H3K27me3 на геноме KSHV, а также на участках связывания LANA в геноме. Наши результаты показали, что обогащенные модификации гистонов AcH3 были в основном ограничены в скрытом локусе, в то время как модификации гистонов H3K27me3 были широко распространены в геноме KSHV в классических тканях KS. Эпигенетический ландшафт в области гена vIRF3 подтвердил его молчаливую экспрессию генов в тканях KS. Между тем, обильное обогащение LANA в терминальном повторном (TR) регионе также было подтверждено в классических тканях KS, однако на геном хозяина наблюдались различные сайты связывания LANA. Кроме того, доминирующие репрессивные модификации гистонов H3K27me3 в области промотора RTA были проверены ChIP-qPCR. Интригующе мы обнаружили, что область TR в классических тканях KS отсутствовала в модификациях гистонов AcH3 с обильным накоплением LANA. Более того, установленный эпигенетический ландшафт в тканях KS был дополнительно подтвержден в новых случаях классических и связанных с СПИДом тканей KS. Анализируя модификации гистонов и сайты связывания LANA в классических тканях KS, наше исследование дает новые идеи для понимания эпигеники KSHV.

Предыдущие исследования эпигенетического ландшафта генома KSHV с использованием in vitro систем клеточной культуры имеют системно определяемые распределения генома из четырех известных модификаций гистонов ChIP-on-ChIP, включая AcH3, H3K4me3, H3K27me3 и H3K9me3 [21, 22]. Эти результаты подтвердили предсказанную активирующую роль AcH3 и преобладающую репрессивную роль H3K27me3 в геноме KSHV. Чтобы получить физиологически релевантную карту эпигенетического ландшафта генома KSHV в классических тканях KS, мы провели эксперименты ChIP-Seq на классических тканях KS, возникших у двух разных пациентов. Конкретный протокол ChIP в клинических тканях KS был обобщен в разделе 1 и разделе материалов и методов. Каждый эксперимент был разделен на пять экспериментальных групп, которые вводятся, IgG, LANA, AcH3 и H3K27me3. Очищенный продукт ChIP из групп ввода, LANA, AcH3 и H3K27me3 подвергали секвенированию следующего поколения. Последовательность считывания для каждого образца была выровнена с геномом KSHV (HQ404500 + 35TR) и геномом человека (Hg19) с использованием Bowtie2 [31]. Результаты выравнивания были представлены в таблице 1. Общая скорость выравнивания к геному KSHV составляла около 0,02%. Относительно высокая скорость в группе H3K27me3 предполагала возможное обогащение генома KSHV. Выровненные файлы были подвергнуты пиковому вызову и генерации геномных карт с использованием анализа на основе моделей ChIP-Seq (MACS) и гипергеометрической оптимизации программного обеспечения Motif EnRichment (Homer) [32, 33]. Общие карты модификаций гистонов AcH3 и H3K27 на геноме KSHV проиллюстрированы на рисунке 2. Расширенные карты представлены на рис. 3 (AcH3) и рис. 4 (H3K27me3). Пиковые панели, показанные на фиг.2, 3 и 4, демонстрируют наиболее потенциально и значительно обогащенные сигналы на геноме KSHV. Как показано на фиг. 2, обогащенные модификации гистонов AcH3 были в основном ограничены латентным локусом, а модификации гистонов H3K27me3 были широко распространены в геноме KSHV. Сравнение между панелями AcH3 и H3K27me3 показало взаимоисключающие сигналы (высокий уровень AcH3 с низким уровнем H3K27me3) в скрытом локусе и несколько локусов, включая промоторную область гена vIRF3, области вокруг ORF8-гена и гена K5. В кодирующей области гена vIRF3 преобладали репрессивные модификации гистонов H3K27me3 (рис. 3 и 4), что предполагает, что ген vIRF3 замолкнут, но может быть легко активирован в классических тканях KS. Между тем, мы также подтвердили, что экспрессия vIRF3 была ограничена на чрезвычайно низком уровне в классических образцах KS (S1 Fig). Этот результат соответствовал предыдущим выводам о том, что экспрессия vIRF3 не обнаруживается в тканях KS с помощью иммуногистохимического анализа [28]. Эпигенетический ландшафт генома KSHV в этих двух случаях классических тканей KS отличался друг от друга в нескольких локусах. Первый случай показал более высокий уровень модификаций гистонов AcH3 в геноме KSHV, чем второй случай в целом (рис. 2 и 3), хотя была аналогичная тенденция. Следует отметить, что промотор и кодирующие области гена K15 были обогащены модификациями гистонов AcH3 только в первом случае (фиг. 3). В то же время мы наблюдали уникальный пик H3K27me3 в промоторной области гена LANA только в первом случае (рис. 4). Более высокий уровень AcH3 и уникальный пик H3K27me3 в промоторной области гена LANA в первом случае обеспечивают подтверждающие доказательства репрессивной роли LANA в экспрессии вирусных генов, как сообщалось ранее [34-37]. Разница в общем эпигенетическом ландшафте между этими двумя случаями указывает на разные состояния KSHV-инфекции у этих двух пациентов, которые могут иметь клиническое значение для прогрессирования KS (файл S1). По сравнению с ранее опубликованными эпигенетическими картами генома KSHV [21, 22] мы обнаружили, что обогащенные сигналы AcH3 при множественных локусах (например, 10 Kb, 20-30 Kb, 87 Kb) в системах культивирования клеток in vitro (BCBL-1 и KSHV-инфицированные SLK) не наблюдались в классических тканях KS, в то время как ландшафт модификаций гистонов H3K27me3 в системах клеточной культуры in vitro был очень похож на ландшафт в тканях KS. Сообщалось, что KSHV может иметь различные программы задержки в разных тканях или клеточных линиях, и на картину экспрессии вирусных генов могут влиять цитокины, присутствующие в местной клеточной среде [27, 38]. Разница в модификации гистонов AcH3 классических тканей KS может указывать на относительно мягкую среду с меньшим количеством цитокинов для классических тканей KS. Файлы для генерации геномных карт были представлены в разделе S1 Supporting Information.

Основные этапы протокола включают: (1) предварительное лечение; (2) сшивка; (3) Получение ячейки; (4) Обычные процедуры ChIP.

Иллюстрированы общие карты модификаций гистонов AcH3 и H3K27 на геноме KSHV. Последовательность читается для AcH3, H3K27me3, а входные образцы были выровнены с геномом KSHV (HQ404500 + 35TR) и визуализированы в программном обеспечении IGV. Значения, показанные на оси y, представляют собой относительное обогащение сигналов ChIP-Seq и нормализованы в соответствии с рассчитанными коэффициентами нормализации. Эпигенетические карты, показанные на рисунке, содержат информацию из двух случаев классических тканей KS. 1 #: первый случай. 2 #: второй случай. Сигналы модификаций гистонов AcH3 и H3K27 были наложены на сигналы Input (базовая линия) соответственно. Красный: AcH3 или H3K27. Синий: вход. *: промоторная область гена vIRF3. **: скрытый локус.

Иллюстрируется увеличенная карта модификации гистонов AcH3 на геноме KSHV при более высоком разрешении. Эпигенетические карты, показанные на рисунке, содержат информацию из двух случаев классических тканей KS. 1 #: первый случай. 2 #: второй случай. Сигналы модификации гистонов AcH3 накладываются на сигналы Input (базовый уровень). Красный: AcH3. Синий: вход.

Иллюстрируется увеличенная карта модификации гистонов H3K27me3 на геноме KSHV при более высоком разрешении. Эпигенетические карты, показанные на рисунке, содержат информацию из двух случаев классических тканей KS. 1 #: первый случай. 2 #: второй случай. Сигналы модификации гистонов H3K27me3 были наложены на сигналы Input (базовый уровень). Красный: H3K27me3. Синий: вход.

ЛАНА-белок имеет решающее значение для поддержания эпизода KSHV [39-41]. В ряде исследований [42-47] были подробно описаны сайты связывания LANA в геноме в системах культивирования клеток in vitro. Тем не менее его след не известен в тканях KS, который также демонстрирует последовательную экспрессию LANA. Поэтому важно исследовать поведение LANA в тканях KS. Мы разработали экспериментальную группу LANA в экспериментах ChIP-Seq. В геноме KSHV в классических тканях KS показаны участки связывания LANA в геноме по всему миру на рис. 5A. Обильное обогащение LANA в терминальном повторном (TR) регионе было подтверждено в обоих случаях классических тканей KS, тогда как ранее сообщалось, что обогащения в скрытом локусе LANA были найдены только в первом случае, что дополнительно подтвердило различные состояния KSHV у этих двух пациентов. Панели представили несколько небольших пиков по всему геному, но в этих двух случаях не были последовательными, и было трудно отличить от фонового шума. Хотя в геноме KSHV в дополнение к области TR и латентному локусу в предыдущих исследованиях [42-47] было обнаружено несколько слабых сайтов связывания LANA, результаты в классических тканях KS не показали этих пиков. Это различие может быть результатом снижения чувствительности ChIP-Seq для более слабых сайтов связывания белка и меньшего размера классических тканей KS.

(A) Обозначены общие карты сайтов связывания LANA на геноме KSHV. Последовательность читается для образцов LANA и Input, которые были выровнены с геномом KSHV (HQ404500 + 35TR) и визуализированы в программном обеспечении IGV. Значения, показанные на оси y, представляют собой относительное обогащение сигналов ChIP-Seq и нормализованы в соответствии с рассчитанными коэффициентами нормализации. Эпигенетические карты, показанные на рисунке, содержат информацию из двух случаев классических тканей KS. 1 #: первый случай. 2 #: второй случай. Сигналы обогащения LANA были наложены на сигналы Input (базовая линия) соответственно. Красный: LANA. Синий: вход. (B) Распределение пиков по отношению к генам. Определенные пики LANA на геном хозяина были классифицированы в разные группы в соответствии с аннотацией пиков PAVIS. (C) Расстояние от пиков LANA (-3000 bp до +3000 bp) до TSS в бункерах 100 б.п. (D) Количество пиков LANA (-3000 bp to +3000 bp), идентифицированных по каждому случаю тканей KS и количеству перекрывающихся пиков. (E) LANA пики как у тела гена, так и у промоторной области гена MORC2, проиллюстрированного IGV на GRCh37 / hg19. Промоторная область гена MORC2 проиллюстрирована в ящике. Гистограмма справа является результатом LANA ChIP-qPCR в области промоутера MORC2. Данные были нормализованы методом процентного ввода (сигналы, полученные из ChIP, были разделены сигналами, полученными из входного образца) и были представлены как среднее ± SD. Соответствующее значение Р (0,0058) рассчитывали по t-критерию Стьюдента.

В то же время мы также проанализировали сайты связывания LANA с геномом хозяина. Отобранные пики связывания LANA с помощью MACS были подвергнуты анализу пиковой аннотации и визуализации (PAVIS) [48]. Результат PAVIS иллюстрирует относительное распределение пиков LANA по отношению к генам (рис. 5B). Резкое снижение пиков LANA было аннотировано в 5′-UTR-области в тканях KS по сравнению с клеточными линиями PEL в 3-5 раз. Анализируя относительное расстояние от пиков до TSS (сайт начала транскрипции), мы обнаружили совершенно другую схему распределения пиков связывания LANA в зонах промотора в тканях KS по сравнению с предыдущими исследованиями в PEL (рис. 5C). Перекрестно сравнивая идентифицированные пики LANA в этих двух тканях KS, мы обнаружили очень мало перекрывающихся пиков, как показано на рис. 5D и наборе данных S1. Репрезентативный перекрываемый пик был проиллюстрирован и подтвержден на рис. 5Е. Дальнейшее сравнение с сайтами связывания LANA в PEL, KSHV-инфицированных SLK и линиях эндотелиальных клеток, мы практически не обнаружили общих сайтов в тканях KS (S1 Dataset). Разница в связывании сайтов LANA с геномом хозяина в тканях KS может указывать на другую роль LANA в патогенезе KSHV, но не исключает возможности того, что результаты возникают из-за клеточной гетерогенности в тканях KS.

RTA-белок, кодируемый ORF50, является ключевым переключателем, который контролирует реактивацию KSHV [13, 14]. Эпигенетический статус в области RTA может отражать состояние инфекции KSHV [21, 22]. Чтобы проверить эпигенетический ландшафт в классических тканях KS, мы тщательно изучили и проверили модификации гистонов в области промотора RTA с помощью ChIP-qPCR. Как показано на фиг.6А, репрессивные модификации гистонов H3K27me3 доминировали в зоне промотора RTA (69-71 Kb) в тканях KS обоих пациентов. Результаты ChIP-qPCR также подтвердили обогащение H3K27me3 в промоторной области RTA и отразили различия между этими двумя случаями (рис. 6B). Более того, обогащение H3K27me3 может быть обнаружено в разных областях промотора RTA в анализе ChIP-qPCR (S2 Fig). В области GAPDH были представлены обогащения AcH3 и небольшие или вообще отсутствующие модификации гистонов H3K27me3, которые были экспериментальным контролем для специфичности антител LANA, AcH3 и H3K27me3 (рис. 6B). Предыдущие исследования в системах культивирования клеток in vitro описали очень похожий эпигенетический ландшафт в области промотора RTA по сравнению с результатами в тканях KS [21, 22], подразумевая, что заключение исследований in vitro по регулированию RTA вполне может поддержать и применить к сценарий in vivo.

(A) Иллюстрация модификаций гистонов AcH3 и H3K27me3 в области промотора RTA (HQ404500: 68000-71000). Сигналы модификаций гистонов AcH3 и H3K27 были наложены на сигналы Input (базовая линия) соответственно. Красный: AcH3 или H3K27. Синий: вход. *: область относительного сильного обогащения H3K27me3. (B) Результаты ChIP-qPCR в области промотора RTA и гена GAPDH (контроль) в классических тканях KS. Образцы, приготовленные для ChIP-Seq, были разделены и небольшое количество (1/5) хранилось для анализа ChIP-qPCR до создания библиотеки. Данные ChIP-qPCR были нормализованы методом процентного ввода (сигналы, полученные из ChIP, были разделены сигналами, полученными из входного образца). Данные представлены как среднее ± SD. N.A. не является амплификацией.

TR-область генома KSHV состоит из сильно повторяющихся последовательностей 801 bp с несколькими копиями, которые могут находиться в пределах более 20 Kb [4]. Предыдущие исследования продемонстрировали обильные модификации гистонов AcH3 с накоплением LANA в области TR в системах культивирования клеток in vitro [21, 22, 49]. Однако мы обнаружили, что область TR в классических тканях KS отсутствовала в модификациях гистонов AcH3 с обильным накоплением LANA (рис. 3 и 5А). Чтобы проанализировать эпигенетический ландшафт в области TR без учета повторения последовательности, мы повторно выровняли последовательность, считываемую для каждого образца, в TR-последовательность с использованием Bowtie2. Повторноанализируемый эпигенетический ландшафт в области TR не изменился, как показано на рис. 7A. Чтобы проверить результаты ChIP-Seq, мы исследовали область TR с теми же образцами с помощью ChIP-qPCR. Как показано на фиг.7B, обогащение связывания LANA и отсутствие модификаций гистонов AcH3 были подтверждены ChIP-qPCR. Для подтверждения четких результатов в тканях KS мы провели эксперименты ChIP в доксициклин-индуцибельной рекомбинантной KSHV.219, несущей SLK (iSLK.219) и клеточные линии лимфомы на основе полости тела (BCBL-1 и BC3), используя тот же протокол. Результаты показаны на фиг.7С. Очень сильно обогащенные сигналы связывания LANA и модификации гистонов AcH3 наблюдались в области TR, как сообщалось ранее. Предполагалось, что гиперацетилирование гистона H3 в области TR было вовлечено в сборку факторов репликации ДНК, но значение оставалось неизвестным [49]. TR содержит источник скрытой репликации генома KSHV, поэтому гипоацетилирование гистона H3 в области TR может влиять на скрытую репликацию генома KSHV, препятствуя поддержанию эпизодов KSHV [40, 50, 51]. Это требует дальнейшего изучения, чтобы определить, были ли проигравшие эпизоды в процессе in vitro культуры клеток, полученных из тканей KS, связаны с отсутствием модификаций гистонов AcH3 в области TR. Гиперацетилирование гистона H3 может ввести ослабленную структуру хроматина в области TR, что может способствовать формированию структуры хроматина в длинной уникальной области для топологической спекуляции. Показано, что гипоацетилирование гистона H3 в области TR в классических тканях KS коррелирует с молчаливым состоянием вирусного генома, поэтому ацетилирование гистона в области TR не может быть связано с экспрессией гена KSHV по результатам.

(A) Иллюстрация эпигенетического ландшафта в области TR (gi | 139472801: 137169-137969). Данные были представлены в виде линейного графика в IGV. Сигналы изменений гистонов AcH3 и H3K27, а также обогащения LANA накладываются на сигналы Input (базовый уровень). Красный: LANA. Зеленый травы: AcH3. Синий: H3K27me3. Sky Blue: вход. (B) Результаты ChIP-qPCR в области TR в классических тканях KS. Образцы, приготовленные для ChIP-Seq, хранили небольшое количество (1/5) для анализа ChIP-qPCR до создания библиотеки. Данные ChIP-qPCR были нормализованы методом процентного ввода (сигналы, полученные из ChIP, были разделены сигналами, полученными из входного образца). Данные представлены как среднее ± SD. (C) Результаты ChIP-qPCR в области TR в культивируемых клеточных линиях in vitro (iSLK.219, BCBL-1 и BC3).

Поскольку опухолевые клетки KS происходят из эндотелиальных клеток, мы также изучали модификации гистонов и сайты связывания LANA генома KSHV в инфицированных KSHV лимфатических эндотелиальных клетках (LEC.KSHV). Однако результат в LEC.KSHV также отличался от установленных результатов в тканях KS. Сильное обогащение связывания LANA и модификаций гистонов AcH3 можно было наблюдать в области TR как то же самое с другими культивированными клеточными линиями in vitro (S3 Fig).

Для дальнейшего подтверждения установленного эпигенетического ландшафта в тканях KS мы исследовали эпигенетические модификации гистонов генома KSHV в новых случаях тканей KS (два классических и один связанный со СПИДом). Как показано на фиг.8А и 8В, результаты ChIP-qPCR в новых случаях классической ткани KS сохраняли хорошую согласованность с ранее рассмотренными двумя случаями. Утвержденный эпигенетический ландшафт на нескольких участках был подтвержден, включая промотор TR, RTA, miR-кластер и области vIRF3. Общие карты этих двух случаев проиллюстрированы на рисунке S4. Поскольку другие подтипы KS имеют общую гистологическую характеристику [23], мы задались вопросом, будут ли они иметь подобный эпигенетический ландшафт, как классические ткани KS. Мы дополнительно определили эпигенетические модификации гистонов генома KSHV в одном случае ткани KS, связанной с СПИДом, с помощью ChIP-qPCR. Интригующе, мы обнаружили, что результаты в ткани KS, связанные со СПИДом, сходны с установленными в классических тканях KS, но большее количество модификаций гистонов AcH3 наблюдалось в кодирующей области TR и vIRF3 (рис. 9). Разница между классическими и связанными со СПИДом образцами заставила нас предположить, что ацетилирование гистона H3 в кодирующей области TR и vIRF3 может соответствовать прогрессированию заболевания KS. Повреждения в классических случаях КС обычно локализуются на конечностях с медленным или ограниченным прогрессированием, тогда как поражения в случаях КС, связанных со СПИДом, обычно распространяются на весь организм и приводят к значительной смертности [52-56]. Предположение о связи между ацетилированием гистонов в кодирующей области TR и vIRF3 и прогрессией заболевания KS потребует более широкого подмножества случаев для изучения этой гипотезы, хотя данные до сих пор очень наводящие на размышления.

(A) Новый классический случай KS1 и (B) Новый классический случай KS2. Результаты ChIP-qPCR в области TR, промотора RTA, miR-кластера, гена vIRF3 и GAPDH (контроль) в классической ткани KS. Образцы, приготовленные из новых случаев классической ткани KS, использовали для анализа ChIP-qPCR. Данные ChIP-qPCR были нормализованы методом процентного ввода (сигналы, полученные из ChIP, были разделены сигналами, полученными из входного образца). Данные представлены как среднее ± SD. N.A. не является амплификацией.

Результаты ChIP-qPCR в области TR, промотора RTA, miR-кластера, гена vIRF3 и GAPDH (контроль) в ткани KS, связанной с СПИДом. Образцы, приготовленные из ткани KS, связанной со СПИДом, использовали для анализа ChIP-qPCR. Данные ChIP-qPCR были нормализованы методом процентного ввода (сигналы, полученные из ChIP, были разделены сигналами, полученными из входного образца). Данные представлены как среднее ± SD. N.A. не является амплификацией.

Анализируя модификации гистонов и сайты связывания LANA в классических тканях KS, наше исследование впервые выявило эпигенетический ландшафт генома KSHV в клинических образцах KS. Установленный эпигенетический ландшафт генома KSHV в классических тканях KS дает прямые доказательства для поддержки различных скрытых программ в тканях KS. Аналогичный эпигенетический ландшафт наблюдался в области промотора RTA в тканях KS по сравнению с результатами систем клеточной культуры in vitro, которые подтвердили физиологическое значение исследований in vitro по регулированию RTA. Четкие модификации гистонов AcH3 в кодирующих областях TR и vIRF3 в классических тканях KS дали важные сведения о прогрессировании заболевания KS, что было бы полезной ссылкой для врачей, чтобы диагностировать клинических пациентов с использованием эпигенетических целевых стратегий. Мы проанализировали эпигенетический ландшафт генома KSHV в классических тканях KS и продемонстрировали сходства и различия, которые дают новое понимание понимания эпигенетики KSHV, что важно для будущих исследований механизма инфекции KSHV и патогенеза.

Эксперименты в настоящем исследовании проводились в соответствии с принципами Хельсинкской декларации. Использование клинических тканей саркомы Капоши (KS) было пересмотрено и этически одобрено Комитетом по институциональной этике Первой учебной больницы Синьцзянского медицинского университета (Урумчи, Синьцзян, Китай, Протокол исследования № 20082012). Письменное информированное согласие было получено от всех участников, и все образцы были анонимизированы.

Клинические ткани KS были собраны у четырех пациентов, получивших патологический диагноз KS, включая три классических KS и один KS, связанный со СПИДом. Пациенты были выходцами из уйгурской и казахской национальностей из местного региона. Все образцы были собраны из провинции Синьцзян, северо-запад Китая. Подробная информация о пациентах / образцах была описана в файле S1.

Линия клеток лимфомы на основе полости тела (BCBL-1) была получена от пациентов с положительной первичной эффузионной лимфомой KSHV [57]. BCBL-1 и BC3 поддерживали в среде RPMI 1640 (Hyclone), содержащей 10% фетальной бычьей сыворотки (FBS) и 5% антибиотиков (пенициллин и стрептомицин, Hyclone). Доксициклин-индуцибельный рекомбинантный KSHV.219, укрывающий клеточную линию SLK (iSLK.219), был установлен J. Myoung и D. Ganem [58] и любезно предоставлен Fanxiu Zhu (Университет штата Флорида). Линия клеток iSLK.219 культивировали в DMEM (Hyclone), дополненном 10% FBS (Hyclone) и 5% антибиотиками (пенициллин и стрептомицин, Hyclone). Лимфатические эндотелиальные клетки (LEC) были приобретены у PromoCell (C-12216) и культивировали с помощью набора MV2 для эндотелиального роста клеток (C-22121, PromoCell).

Собранные свежие клинические образцы KS (0,1-0,2 г) хранились при -80 ℃ перед использованием. Протокол ChIP-Seq в клинических образцах KS описан ниже:

Предварительная обработка: отрежьте ткань на мелкие кусочки и перенесите ткань в пробирку с 1 мл PBS.

Сшивка: добавьте формальдегид до конечной концентрации 1,5%. Инкубируйте при комнатной температуре в течение 20 мин. Закалите сшивку, добавив 0,15 мл глицина (1,25 М). Инкубируйте при комнатной температуре в течение 10 мин. Центрифугируйте при 200 × g в течение 5 мин, чтобы удалить супернатанты и дважды промыть таблетку PBS.

Приобретение клеток: Добавить коллагеназу D или P с Dispase (Roche) до конечной концентрации 3 мг / мл. Инкубируйте при 37 ° С в течение 1 ч с осторожным встряхиванием. Измельчить тканью в сумерках на льду. Используйте 0,7 мкм фильтр Falcon для получения разделенных клеток. Центрифугируют при 300 × g в течение 5 мин и промывают гранулу PBS.

(Необязательно) Улучшенная сшивка: добавьте формальдегид до конечной концентрации 1,5%. Инкубируйте при комнатной температуре в течение 3 мин. Закалите сшивку, добавив 0,15 мл глицина (1,25 М). Инкубируйте при комнатной температуре в течение 10 мин. Центрифугируйте при 200 × g в течение 5 мин, чтобы удалить супернатанты и дважды промыть таблетку PBS.

Обычные процедуры ChIP: осадок лизировали с помощью буфера для лизиса SDS (50 мМ HEPES, 1 мМ ЭДТА, 1% SDS, 1 мМ фенилметилсульфонилфторида [PMSF]) в течение 10 мин на льду. Лизаты подвергали ультразвуковой обработке с получением 200 п.о. фрагментов ДНК (Sonics, импульсный цикл 2/6 с, амплитуда 30-35%), а затем центрифугировали при 12000 × g при 4 ° С в течение 10 мин, чтобы получить супернатанты. Супернатанты разбавляли 1:10 буфером RIPA (50 мМ Трис-HCl, pH 7,4, 150 мМ NaCl, 0,5% Triton X-100, 1 мМ PMSF). 10% супернатантов сохраняли в качестве входных данных, а остаток делили на группы в соответствии с экспериментом. Аликвоты инкубировали с предварительно обработанными белками A или G и соответствующими антителами в течение ночи при 4 ° C. После интенсивной промывки буфером RIPA промывают буфер (20 мМ Трис-HCl, pH 8,0, 1 мМ ЭДТА, 250 мМ LiCl, 0,5% NP-40, 1 мМ PMSF) и TE-буфер (10 мМ Трис-HCl, pH 8,0, 1 мМ ЭДТА) (четыре раза каждый), гранулы ресуспендировали в TE-буфере. Ресуспендированные гранулы подвергали перевариванию РНКазы А и протеиназы К, и сшивание менялось на обратную сторону при 65 ° С в течение 8-10 ч. ДНК рециркулировали с помощью набора для очистки ДНК (Tiangen).

Создание библиотеки и ее последовательность: библиотека ChIP-seq была подготовлена ​​в соответствии с руководством Illumina для подготовки образца ChIP. Диапазон выбора размера для библиотеки составлял 200-400 б.п. Установленная библиотека была проверена Agilent Bioanalyzer и соответствующим образом нормализована. Секвенирование выполнялось на платформе Hiseq 2500.

* Обратите внимание, что предварительно обработанные гранулы не должны блокироваться ДНК спермы.

Антитела в экспериментах ChIP-Seq: поликлональное антитело кролика кроликов (3-4) было получено из Merck Millipore. Антицеллюлитный гистон H3 (AcH3) кроличьего поликлонального антитела (06-599) был приобретен у Merck Millipore. Моноклональное антитело против LANA, продуцируемое гибридом 1B5, было получено в нашей лаборатории (источник антигена для иммунизации: LANA 900-1162aa) [45].

Данные ChIP-Seq (параметры качества данных были описаны в файле S2) были выровнены с геномом человека (hg19) и геномом KSHV (HQ404500 плюс 35 копий TR [U75699.1]) с использованием Bowtie2 [31]; разрешено только одно несоответствие. Выходные файлы были подвергнуты пиковому вызову и генерации геномных карт с MACS (модельный анализ ChIP-Seq) и Homer2, как описано ранее [32, 33]. Группа ввода использовалась в качестве контроля. Для анализа модификаций гистонов с помощью MACS параметры были установлены в соответствии с протоколом, следующим за ним: -nomodel, -shiftsize = 73. По умолчанию значение P для обнаружения пика составляло 10-5. Для анализа изменений гистонов с Homer2, скорректированные параметры были установлены следующим образом: -style = histone, -size = 100 или 150, -minDist = 300. Отключение значения P по умолчанию для обнаружения пика составляло 10-4. Конечный результат идентифицированных пиков был сформирован комбинацией анализа MACS и Homer2. Для анализа сайтов привязки LANA с MACS параметры были установлены, как сообщалось ранее: -nomodel, -shiftsize = 50. Группа ввода использовалась в качестве контроля. Обрезание значения P для обнаружения пика составляло 10-3. Результаты были отображены программным обеспечением IGV [59]. Факторы нормализации рассчитывались в соответствии с глубиной последовательности и формулировались следующим образом: Фактор нормализации = Общее количество пробы / Общее количество считываемых данных. Значения на оси y каждой панели в программном обеспечении IGV были скорректированы в соответствии с рассчитанными коэффициентами нормализации (файл S3). Пиковая информация была аннотирована Peak Analyzer. Распределение пиков по отношению к генам было рассчитано Пависом [48].

RT-PCR в режиме реального времени выполняли с помощью набора SYBR green Master Mix (Toyobo). Реакционные смеси содержали 5 мкл Master Mix plus Rox, 1 мкМ каждого праймера и 4 мкл разбавленного образца. Все праймеры перечислены ниже:

ChIP-TR-F: GGGGGACCCCGGGCAGCGAG

ChIP-TR-R: GGCTCCCCCAAACAGGCTCA

ChIP-RTAp-F: TCCCCTTCTCCACCGTCA

ChIP-RTAp-R: TCCGCAATGTCAGGTTCCAC

ChIP-GAPDH-F: TACTAGCGGTTTTACGGGCG

ChIP-GADPH-R: TCGAACAGGAGGAGCAGAGAGCGA

vIRF3-F (ChIP & RT): GTGTGATCTGCGGACTGTCA

vIRF3-R (ChIP & RT): ACGAGGGGGACCATATCGAA

ChIP-vIRF3p (vIRF2) -F: CTCTGGGACTTGGGAGCAAA

ChIP-vIRF3p (vIRF2) -R: TCTTAACCGCCACCCAATCC

ChIP-miR-cluster-F: TGTGGCACCAGGTTATGGTC

ChIP-miR-cluster-R: GCGTCATGACTAAGGGGGAG

MORC2-ChIP-F: AAGCCCTGTTTGAGTCCCTG

MORC2-ChIP-R: TGCTTTACACTGGGTGCCAT

RTAp-1.6k-F: TCCACAGGACGGCAAATAG

RTAp-1.6k-R: TCCTCATTAGTCGGGACTCG

RTAp-0,4k-F: TCCCAGATCAAAGTCATGTCA

RTAp-0,4k-R: GGCTCAACACCAGACTGAATC

Программа, установленная в системе обнаружения последовательности 7900HT (Life Technologies), составляла 95 ℃ в течение 5 минут, а затем 40 циклов при 95 ℃ в течение 15 с, 58 ℃ в течение 20 с и 72 ℃ в течение 30 с. Анализ кривой плавления проводили для проверки специфичности продуктов, и каждый образец был испытан в трех экземплярах.

Исходные данные были отправлены в SRA (Sequence Read Archive) на веб-сайте NCBI. Номер доступа к этому проекту SRP081036. KSHV геном: HQ404500. TR: NC_009333, 137169-137969.

Клетки BCBL-1 и классические ткани KS собирали для экстракции РНК и транслировались обратно к кДНК. Относительное количество определяли с помощью qPCR. Данные были нормализованы против GAPDH (A). Чтобы уменьшить влияние гетерогенности в тканях KS, данные были также проанализированы путем нормализации против LANA (B). Данные представлены как среднее ± SD.

(TIF)

Щелкните здесь для получения дополнительных данных.

Результаты ChIP-qPCR в разных регионах промотора RTA в классической ткани KS (Case2). Образцы, приготовленные для ChIP-Seq, были разделены и небольшое количество (1/5) хранилось для анализа ChIP-qPCR до создания библиотеки. Данные ChIP-qPCR были нормализованы методом процентного ввода (сигналы, полученные из ChIP, были разделены сигналами, полученными из входного образца). Данные представлены как среднее ± SD. N.A. не является амплификацией.

(TIF)

Щелкните здесь для получения дополнительных данных.

Результаты ChIP-qPCR в области TR, промотора RTA, miR-кластера и гена GAPDH (контроль) в инфицированных KSHV лимфатических эндотелиальных клетках (LEC). Данные ChIP-qPCR были нормализованы методом процентного ввода (сигналы, полученные из ChIP, были разделены сигналами, полученными из входного образца). Данные представлены как среднее ± SD. N.A. не является амплификацией.

(TIF)

Щелкните здесь для получения дополнительных данных.

Последовательность считывания для образцов AcH3, H3K27me3, LANA и Input была выровнена с геномом KSHV (HQ404500 + 35TR) и визуализирована в программном обеспечении IGV. Значения, показанные на оси y, представляют собой относительное обогащение сигналов ChIP-Seq и нормализованы в соответствии с рассчитанными коэффициентами нормализации. Эпигенетические карты, показанные на рисунке, содержат информацию из двух случаев классических тканей KS. Сигналы изменений гистонов и обогащения LANA были наложены на сигналы Input (базовая линия) соответственно. Красный: AcH3 или H3K27 или LANA. Синий: вход. #: для случайного заражения удалены сигналы в области кодирования RTA в группе LANA.

(TIF)

Щелкните здесь для получения дополнительных данных.

(ZIP)

Щелкните здесь для получения дополнительных данных.

(XLS)

Щелкните здесь для получения дополнительных данных.

(DOCX)

Щелкните здесь для получения дополнительных данных.

(DOCX)

Щелкните здесь для получения дополнительных данных.

(DOCX)

Щелкните здесь для получения дополнительных данных.

Мы признаем Omics Core, CAS-MPG Partner Institute for Computational Biology, Шанхайские институты биологических наук, Китайскую академию наук для обслуживания ChIP-Seq.

Комментариев нет.

Добавить комментарий

Ваш e-mail не будет опубликован. Обязательные поля помечены *