Нажмите "Enter", чтобы перейти к контенту

Гомолог-пентамерный комплекс диктует вирусный эпителиальный тропизм, патогенность и врожденную инфекционную скорость в морском цитомегаловире

A Homolog Pentameric Complex Dictates Viral Epithelial Tropism, Pathogenicity and Congenital Infection Rate in Guinea Pig Cytomegalovirus
Источник: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4936736/

Авторы заявили, что не существует никаких конкурирующих интересов.

Задуманные и разработанные эксперименты: AM KYC SC. Выполняли эксперименты: AM KYC SC MR. Проанализированы данные: AM KYC SC MR. Используемые реагенты / материалы / инструменты анализа: AM KYC. Написал статью: AM KYC SC.

В цитомегаловирусе человека (HCMV) тропизм к эпителиальным и эндотелиальным клеткам зависит от пентамерного комплекса (ПК). Учитывая структуру плаценты, ПК потенциально является важным нейтральным целевым антигеном антитела против врожденной инфекции. Морская свинка — единственная маленькая модель для врожденного CMV. Цитомегаловирус свиньи (GPCMV) потенциально кодирует UL128-131 HCMV гомологический локус (GP128-GP133). В исследованиях переходной экспрессии гликопротеины GPCMV gH и gL взаимодействовали с гомологическими белками UL128, UL130 и UL131 (обозначенные соответственно GP129 и GP131 и GP133) с образованием ПК или подкомплексов, которые были определены реакциями иммунопреципитации, направленными на gH или gL. Природный GP129 C-терминальный делеционный мутант (aa 107-179) и химерный HCMV UL128 C-терминальный доменный подкачка GP129-мутант не смог сформировать ПК с другими компонентами. GPCMV-инфекция новообразованной линии эпителиальных клеток морской свинки требовала полного ПК, а мутантный вирус GP129 не обладал эпителиальным тропизмом и был ослаблен у морской свинки для патогенности и имел низкую врожденную скорость передачи. Индивидуальный нокаут генов GP131 или 133 приводил к потере вирусного эпителиального тропизма. Было обнаружено, что мутантный вирус GP128 сохранил эпителиальный тропизм и GP128 не был компонентом ПК. Ряд мутантов GPCMV продемонстрировал, что gO не является строго необходимым для эпителиальной инфекции, тогда как gB и ПК необходимы. Эктопическая экспрессия кДНК GP129 в мутантном вирусе GP129 восстанавливает эпителиальный тропизм, патогенность и врожденную инфекцию. В целом, GPCMV формирует ПК, подобный HCMV, который позволяет оценивать стратегии вакцины на основе ПК на модели морской свинки.

Врожденный ЦМВ является ведущей причиной умственной отсталости и глухоты у новорожденных. Эффективная вакцина против врожденного ЦМВ остается неуловимой целью. HCMV кодирует пентамерный комплекс гликопротеинов (ПК), необходимый для тропизма, к эпителиальным, эндотелиальным и миелоидным клеткам. Учитывая структуру плаценты, вирусный ПК считается важным для врожденной инфекции и потенциально важным антигенным антигенным антигенным антителом. Морская свинка с структурой плаценты, подобной человеку, является единственной маленькой моделью для врожденного CMV. В этой статье показано, что GPCMV кодирует гомологический ПК, который обеспечивает эпителиальный тропизм на вновь созданной клеточной линии. Вероятно, ПК GPCMV улучшает вирусный тропизм для различных типов клеток, поскольку ПК-положительный вирус улучшает вирусную патогенность и врожденную инфекцию in vivo. Это исследование закладывает важные основы для разработки стратегии вмешательства на базе ПК против врожденной ЦМВ в этой модели.

Все соответствующие данные содержатся в документе и его файлах вспомогательной информации.

Цитомегаловирус человека (HCMV или вирус герпеса человека 5) является членом рода Betaherpesvirinae и кодирует более 165 генов [1]. Вирусная инфекция в значительной степени бессимптомна у здоровых людей, но устанавливает пожизненное, в основном, скрытое состояние у хозяина. Тем не менее, заражение иммунного скомпрометированного хозяина (больных СПИДом и трансплантатами) или реактивация вируса из-за нарушения иммунной системы могут иметь серьезные последствия заболеваемости или смертности [2, 3]. Еще одним важным аспектом HCMV является врожденная инфекция, когда вирус пересекает плаценту и заражает плод в матке. Это происходит примерно у 1% живорождений [4] в США и вызывает серьезные симптомы, включая умственную отсталость и сенсоневральную потерю слуха (SNHL) у новорожденных [4-8]. Наибольший риск развития врожденной инфекции у матерей, которые приобретают первичную инфекцию во время беременности и предшествующего иммунитета, может снизить риск до 69% [9]. Следовательно, воздействие вакцины является потенциально существенным, особенно в странах, где существует высокий риск первичной инфекции во время беременности. Эти регионы включают США, ЕС и Японию, где до 50% женщин, несущих возраст, отрицательны для HCMV [8, 10]. Лицензированные противовирусные препараты HCMV доступны для пациентов, перенесших трансплантацию и СПИД, но не врожденных ЦМВ [11]. Следовательно, разработка вакцины против врожденного ЦМВ является первоочередной задачей.

Любое предлагаемое вмешательство для профилактики или лечения инфекции HCMV в идеале должно оцениваться в доклинической модели. К сожалению, HCMV чрезвычайно видоспецифичен. Следовательно, патогенность модели животных, вакцинации и противовирусные исследования проводятся с использованием животных-специфических ЦМВ, включая мышиные, крысиные, морские свинки и макаки резуса [12-16]. Морская свинка уникальна, поскольку она является единственной малой моделью для животных, позволяющей изучать врожденную ЦМВ-инфекцию, где вирус пересекает плаценту и заражает плод в матке, в отличие от модели мыши [17]. Плаценты человеческой и морской свинки являются гемомонохроническими, содержащими гомогенный слой трофобластных клеток, разделяющих циркуляцию матери и эмбриона [18-20]. Кроме того, как и в случае с беременностью человека, период беременности (приблизительно 65 дней) можно разделить на триместры. Важно отметить, что врожденная инфекция GPCMV вызывает заболевание у плода и новорожденных щенков, подобных тем, которые обнаружены у людей, включая SNHL [21-23]. Следовательно, модель морской свинки лучше всего подходит для тестирования стратегий вмешательства, направленных на предотвращение врожденной инфекции ЦМВ [11, 24, 25].

Основной недостаток в исследованиях GPCMV в значительной степени был преодолен недавней секвенированием вирусного генома и развитием инфекционных ВАК-клонов GPCMV [15, 26-29]. Действительно, манипулирование ВАХ GPCMV позволило провести предварительное исследование некоторых вирусных генов [11, 30-36]. Кроме того, геном морской свинки был секвенирован (http://www.ensembl.org/Cavia_porcellus/Info/Index), который позволяет разрабатывать новые реагенты для этой модели. Анализ генома GPCMV [15, 29] показал, что вирусы кодируют гомологи к гликопротеинам HCMV (gB, gH, gL, gM, gN, gO) в генах, колинейных с геномом HCMV (обозначенные GP55, GP75, GP115, GP100, GP73 и GP74 соответственно). В HCMV эти шесть гликопротеинов (gB, gH, gL, gM, gN, gO) необходимы для ввода фибробластов и образуют гликопротеиновые комплексы gCI (gB), gCII (gM / gN), gcIII (gH / gL / gO) на вирусной мембране [37-39]. Кроме того, в HCMV эти комплексы являются важными нейтрализующими мишенями антител и такими потенциальными кандидатами на вакцину [40-44]. Недавно мы продемонстрировали, что GPCMV образует функционально сходные гликопротеиновые комплексы, и эти комплексы необходимы для инфицирования фибробластных клеток, а также важных мишеней-мишеней [36]. Как в HCMV, так и в GPCMV, вирусный гликопротеин gB является иммунодоминантным нейтрализующим вирусным антигеном [45-49]. Рекомбинантный HCMV gB был исследован как кандидатная субъединичная вакцина в клинических испытаниях фазы II, но это в лучшем случае составляет приблизительно 50% эффективности, несмотря на высокие титры антител [41].

Предполагалось, что процесс входа HCMV в клетку происходит через механизм клеточного слияния, опосредованный gB, но также требующий других гликопротеинов [50-52]. Текущие исследования показывают, что это триплекс (gH / gL / gO) и особенно gH / gL, который способствует слиянию gB-клеток в фибробластах. Это согласуется с общей моделью герпесвирусов с сердечным слиянием, связанным с gB и gH / gL [53-58]. Однако gM / gN считается существенным для вирусной инфекции всех типов клеток и является наиболее распространенным комплексом в вирионе [59]. Большинство ранних исследований по введению клеток HCMV проводили на клетках фибробластов с лабораторно адаптированными штаммами HCMV (например, AD169). Эти вирусные штаммы не обладают способностью эффективно инфицировать другие типы клеток, такие как эндотелиальные, эпителиальные клетки. Клинические штаммы HCMV также кодируют пентамерный гликопротеиновый комплекс (gH / gL / UL128 / 130/131), который позволяет вводить вирусные клетки в эпителиальные, эндотелиальные и миелоидные клетки посредством альтернативного пути ввода клеток, который требует наличия пентамерного комплекса (ПК) в сочетании с gB [55, 57, 60-66]. Alphaherpesviruses, в отличие от CMV, кодируют только один тип комплекса gH / gL. Однако некоторые вирусы гамма-герпеса (например, вирус Эпштейна-Барра) кодируют два разных комплекса gH / gL, чтобы включить gB-слияние в запись разных типов клеток, которая потенциально обеспечивает модель для ЦМВ [54]. Вероятно, комплексы на основе gH / gL работают выше gB для ввода клеток, но это плохо определено [58]. Альтернативный маршрут ввода ячейки CMV будет упоминаться как зависящий от ПК путь в этом отчете. Однако исследования показывают, что gO, который является уникальным для всех ЦМВ, также усиливает инфицирование эпи / эндотелиальных клеток неопределенным механизмом [67]. Вирусная инфекция, связанная с вирусом эпителия и эндотелия, зависящая от ПК, происходит через не зависящий от клатрина путь эндоцитоза с эндосомами, подвергающимися воздействию кислотного потока [61, 68]. Зависимая от вируса инфекция ДНК дендритных клеток не зависит от рН, но зависит от холестерина через путь макропиноцитоза [69]. Интересно, что недавнее исследование показало, что проникновение вируса в клетки фибробластов также может происходить с помощью пути макропиноцитоза с рН / клатрином, независимого от ПК [70]. Несомненно, ПК необходим для эффективного проникновения в эпителиальные и эндотелиальные клетки. Вирусный локус, кодирующий уникальные гены PC (UL128-131), нестабилен при прохождении клинических штаммов HCMV на клетках фибробластов, а кодированные гены быстро получают точечные мутации или делеции с последующей потерей эпи-эндотелиального вирусного тропизма, связанного с невозможностью сформировать функциональный ПК [71]. Лабораторные адаптированные штаммы HCMV (например, AD169) могут инфицировать эпи / эндотелиальные клетки при восстановлении мутированного локуса или функциональные гены, выраженные в эктопическом положении, которые позволяют формировать ПК [64, 72, 73]. Основа для образования HCMV gH / gL / gO триплексного или gH / gL ПК плохо определена, но оба комплекса присутствуют на вирионах клинических штаммов, но отношения различаются между штаммами [74]. Потенциально конкурентное связывание gO или UL128 с gH / gL может быть ключевым этапом, но также предполагается, что белок UL148 играет роль в балансе между этими комплексами [55, 75].

ПК считается важной нейтрализующей мишенью для HCMV на эпителиальных / эндотелиальных клетках и предположительно для врожденной инфекции, учитывая эпи / эндотелиальную структуру плаценты [76-78]. Важность ПК в качестве целевого антигена была подтверждена выделением нейтрализующих человеческих моноклональных антител к ПК с более высокой эффективностью, чем антитела к другим антигенам-мишеням [76, 77]. В контексте врожденной инфекции считается, что нейтрализующие антитела с высоким титром эффективны против трансплацентарной вирусной передачи [76, 79, 80]. Потенциально, задержка в иммунном ответе на ПК приводит к инфекции плода [81]. Важность ПК в вирусной инфекции клеток подчеркивается недавним нахождением для вакцины HCM с субъединицей gB. В клинических испытаниях вакцина gB индуцирует нейтральный нейтральный иммунный ответ с высоким титром, который эффективен при нейтрализации вируса на фибробластах [41, 82]. Однако в отдельных исследованиях сыворотки от вакцинированных индивидуумов gB менее эффективны при нейтрализации вирусной инфекции на эндотелиальных и эпителиальных клетках по сравнению с выздоравливающими сыворотками от лиц, инфицированных HCMV [78, 83, 84]. Это продемонстрировало важность других вирусных нейтрализующих целевых антигенов для инфицирования этих типов клеток. Следовательно, другие целевые антигены должны считаться важными в разработке вакцины против врожденного ЦМВ. Важно отметить, что вакцина gB полностью не защищает от врожденного CMV в модели морской свинки [49, 85, 86].

Потенциально GPCMV кодирует гомологический ПК в качестве гомологического локуса UL128-131 (GP128-133), который идентифицирован в вирусном запасе ATCC с низким проходом GPCMV, штамм 22122 (ATCC VR682) [28, 87]. Последовательность этого вируса также соответствовала последовательности слюнной железы (SG) GPCMV (экстенсивно сериально пассировали in vivo у морских свинок) [25]. Однако очищенный от бляшки изолят (обозначенный PP ATCC), используемый для установления первой последовательности GPCMV, имел делецию в этом локусе [15]. PP ATCC имела нормальную кинетику роста в тканевой культуре, но ослаблялась in vivo по сравнению с SG GPCMV [25, 26]. Мы предположили, что вирусное затухание связано с неспособностью вируса сформировать гомологический пентамерный комплекс, который воздействует на тропический вирусный клеточный тип на конкретные типы клеток (например, эпителиальные клетки) и, следовательно, патогенность у животного. Тропизм вирусных клеток оценивали с помощью недавно созданной линии эпителиальных клеток почки морской свинки. Потенциальные взаимодействия гомогенных гликопротеинов GPCMV gH и gL с белками, закодированными в локусе GP128-133, были изучены, чтобы показать данные ПК GPCMV. [63]. Кроме того, для эпителиального тропизма был восстановлен мутантный вирус GPCMV, который кодировал интактный локус, но мутированный ген GP129 (гомолог UL128), путем экспрессии полноразмерной кДНК GP129 в эктопическом положении. Этот рекомбинантный вирус (GP129FRT) включал myc tagged GP129 в вирусную частицу как часть ПК. Нокаут GP129, GP131 или GP133 (UL128, UL130 и UL131 гомологи соответственно) в рекомбинантной GPCMV-вирусной репликации на эпителиальные клетки, но не фибробласты. Важно отметить, что вирус, восстановленный для ПК, улучшил патогенность и врожденные скорости передачи по сравнению с мутантным вирусом, лишенным комплекса. В целом, сходство функции между пентамерными комплексами HCMV и GPCMV усиливает модель морской свинки в разработке эффективной доклинической стратегии вакцины против эпителиальной и врожденной инфекции на базе ПК CMV.

В ранее опубликованных исследованиях GPCMV штамм 22122 (ATCC VR682) вирус патогенной слюнной железы (SG) поддерживался серийным прохождением у животных, но мог быть ослаблен обширным последовательным прохождением вируса на клетках фибробластов,> 11-25 проходов [ 21, 88, 89]. Однако молекулярная основа для этого ослабления была неопределенной, и вирусные запасы пассивного вируса SG и фибробластов больше не доступны (персональное сообщение Griffith (Yale University, CT) с AM). Потенциальной основой для затухания вируса в GPCMV может быть модификация гомологического локуса UL128-133 [28, 87, 90]. В клинических штаммах HCMV адаптация вируса к росту на клетках фибробластов быстро приводила к мутациям в этом локусе и нарушала тропический тип к различным типам клеток [60, 71, 91]. Inoue и коллеги [87] определили два варианта GPCMV в низкочастотном ATCC-складе GPCMV (штамм 22122). Один вариант GPCMV был неповрежден для локуса гомолога UL128-131 (GP128-GP133), в то время как другой переносил делецию в локус и был похож по последовательности на штамм GPCMV, адаптированный к тканевой культуре [15, 29]. GPCMV, штамм 22122 (АТСС), был серийно размножен у морских свинок в Детском больничном научно-исследовательском фонде, Цинциннати (Огайо, США) с конца 1980-х по 2005 год. Ряд исследователей широко применяли вирусные запасы слюнных желез (SG) в исследованиях на врожденные GPCMV. Этот шток вируса SG был недавно секвенирован и показан для кодирования полноразмерного локуса GP128-133 [92], тогда как адаптированный к культуре культуры вирус, полученный из запаса SG GPCMV, используемый для установления первой последовательности вирусного генома, содержал делецию в этом локусе [15 ]. В настоящем исследовании для оценки последовательности локуса GP128-133 вирулентного вируса использовали GP11M слюнные железы SG11 (11 последовательных проходов у морских свинок). Кроме того, для оценки последовательности вируса, адаптированного к лабораторным исследованиям, использовали зараженный бляшками (PP ATCC) вирус, широко пассированный на клетках фибробластов. ПЦР-праймеры ([87], таблица S1) использовали для амплификации локуса GP128-GP133 и продукта ПЦР, клонированного до секвенирования. На фиг.1 (i) показана структура локуса GP128-133 и анализ клонированных продуктов ПЦР для локуса GP128-133 от соответствующих вирусов. Последовательный анализ клонированных продуктов ПЦР (см. Рис. 1 (ii) A и S1 Рис.) Подтвердил, что два запаса вируса (SG GPCMV и изолят plaque PP ATCC) отличались идентично двум изолятам, зарегистрированным в запасе ATCC с низким проходом [ 28, 87]. SG GPCMV имел полный локус GP128-133 (продукт PCR 2 кБ), в то время как вирус PP ATCC [26] содержал 1,6 т.п.н. делеции (0,4 т.п.н. PCR-продукт), которые удаляли большую часть кодирующей последовательности GP129-133 (196,925- 198 573), как показано с помощью ПЦР-анализа (см. Рис. 1 (ii) А). Это потенциально подтверждает гипотезу о том, что полный локус GP128-133 необходим для полного тропизма / патогенности in vivo, поскольку GPCMV, мутированный в локусе GP128-133, ослабляется в модели животного [29]. RT-PCR на поздней стадии инфекции подтвердила транскрипцию генов, закодированных в локусе GP128-133 в клетках, инфицированных SG GPCMV (S2 ​​Fig).

(i) Макет GPCMV GP128-133 локуса генов. Аннотированный геном GPCMV (координаты 195,713-199,263 нуклеотидов), который кодирует GP128-gp134. Отдельные гены, представленные в виде синих стрелок и направлений, обозначают либо смысл (выше строки), либо комплементарную цепочку (ниже строки). Прямыми гомологами генов HCMV пентамера являются UL128 (GP129), UL130 (GP131), UL131 (GP133). GP129 (3 экзона) и GP131 (два экзона) являются сплайсированными генами. P1 (196707) и P2 (198,701) показывают местоположение пары праймеров ПЦР (P1 / P2), используемой для амплификации генов локуса GP128-GP133. Верхняя линия показывает усиление локуса полной длины (2 kb) от SG GPCMV. В нижней строке показана амплификация удаляемого локуса GP128-GP133 в адаптированном клиенте PP ATCC (0,4 kb). Сплошная линия указывает, что сохраненная последовательность между локусом полной длины и пунктирной линией указывает на удаленную последовательность. Координаты 196,925-198 573 нуклеотидов представляют собой специфическую делецию в локусе для вируса PP ATCC. Специфическая аннотированная нуклеотидная последовательность локуса GP128-GP133 показана на S1. (Ii) A. Анализ полноразмерных и усеченных вирусов и эпителиальных клеток. Агарозный гель-электрофорез ПЦР P1 / P2 для локуса GP128-133 от GPCMV. Слева, kb-лестница (Invitrogen). Средний, (ATTC) PP ATCC GPCMV (0,4 kb). Правильно, (SG) SG GPCMV (2 kb). B, C и D. Иммунофлуоресцентный анализ эпителиальных клеток, инфицированных SG GPCMV. B. GPCMV IE2, обнаруженный с помощью первичного кролика anti-IE2 / вторичного IgG-FITC кролика. C. GPCMV инфицированный моноэфир эпителиальных клеток морской свинки, проверенный окрашиванием маркером цитокератина с помощью первичного мышиного анти-панситокератина / вторичного антимышиного IgG-TRITC. D. Наложение B и C на клеточные ядра, окрашенные DAPI. (iii) Сравнительная кривая роста SG GPCMV и PP ATCC GPCMV на эпителиальных клетках и клетках фибробластов. Клетки инфицировали либо в moi 1 pfu / cell. Образцы брали в разные дни после инфицирования и титровали в двух экземплярах на клетках GPL, как описано ранее [33]. Результаты показаны как титр вируса против дней после инфицирования: A, рост на эпителиальных клетках; B, рост клеток GPL. Алмаз (синий), SG GPCMV. Квадратный (красный), PP ATCC.

В HCMV следствием адаптации вируса клинического штамма к клеткам фибробластов является неспособность вируса сформировать функциональный ПК (gH / gL / UL128-131), необходимый для инфицирования эпителиальных или эндотелиальных клеток и других типов клеток [60, 62 -64, 71]. Потенциально GPCMV кодирует гомологический ПК, но клеточный тропизм, связанный с этим локусом, не был успешно продемонстрирован [90], за исключением инфекции макрофага [93]. Основным ограничением в исследованиях GPCMV является доступность различных типов клеточных линий культуры тканей для оценки вирусного тропизма. Следовательно, мы создали новую почковую линию эпителиальных клеток морской свинки из почек. Колонии были клониально изолированы, характеризуются маркером цитокератина и линертными линиями клеток, как описано в материалах и методах. Эпителиальные клетки были охарактеризованы анализом для цитокератина либо методом Вестерн-блоттинга, либо иммунофлюоресценции (см. S3 Рис.). Эпителиальные клетки морской свинки были положительными для цитокератина в отличие от клеток GPL (S3 Fig). Важно отметить, что SG GPCMV способен инфицировать и реплицировать эпителиальные клетки. На рис. 1 (ii) показаны инфицированные вирусом эпителиальные клетки, окрашенные в цитокератин (цитоплазму) и белок IE2 GPCMV (ядро), см. Соответственно на панелях C и B. Напротив, вирусные антигены не были обнаружены в инфицированных EP ATCC GPCMV эпителиальных клетках (S4 Fig), но контрольные исследования продемонстрировали вирусную инфекцию фибробластов (S4 Fig). Кроме того, кривая роста SG GPCMV против PP ATCC показала, что вирус с интактным локусом GP128-133 может инфицировать и реплицировать на эпителиальные клетки, тогда как мутантный вирус PP ATCC был сильно нарушен для роста на эпителиальных клетках, см. Рис. 1 (iii) A. Напротив, оба вируса были способны к нормальному росту на клетках фибробластов (рис. 1 (iii) B).

Был сделан вывод о том, что SG GPCMV обладает способностью реплицироваться на эпителиальные клетки, в отличие от лабораторного адаптированного GPCMV. Кроме того, тропизм был результатом вируса SG GPCMV, кодирующего полный локус GP128-133, в отличие от лабораторного адаптированного вируса. Это может быть подтверждено сравнительным анализом последовательностей между изолятами, которые указывают на то, что единственное различие между вирусами, связанными с локусом GP128-133 [29, 87, 94].

Чтобы исследовать образование комплекса пентамерного гликопротеинового комплекса GPCMV, клоны полной длины кДНК GP128, GP129, GP131 и GP133 были клонированы в векторы экспрессии млекопитающих или векторы рекомбинантного аденовируса под контролем промотора MMS HCMV, как описано в материалах и методах [36]. Кроме того, ORF были C-терминальным эпитопом, помеченным для включения обнаружения: GP129 (myc); GP131 (HA); GP128 (FLAG); и GP133 (FLAG). Кроме того, ранее были описаны GP75 (gH ORF) и GP115 (gL ORF), C-конце, помеченные GFP или mCherry соответственно, в плазмидах экспрессии млекопитающих или рекомбинантном дефектном аденовирусе [36]. Все конструкции были проверены путем секвенирования и суммированы в S5 Fig.

В начальной серии экспериментов исследовалась клеточная локализация различных белков GPCMV. Клетки, трансдуцированные с дефектными аденовирусами, экспрессирующими gH, gL, GP129, GP131 и GP133, приводили к цитоплазматической ко-локализации gH и gL с GP129, GP131 и GP133 (S5 Fig). Затем проводили иммунопреципитационный анализ на клетках, которые экспрессировали все компоненты потенциального пентамерного комплекса для демонстрации белково-белковых взаимодействий. На рис. 2 (i) показано, что трансдукция эпителиальных клеток рекомбинантным аденовирусом, кодирующим один гликопротеин, позволила их успешное выявление путем вестерн-блот-анализа с использованием их соответствующего маркера метки эпитопа. Экспериментальная экспрессия gHGFP и gLmCherry ранее была описана [36]. Вестерн-блот-анализ временно экспрессируемых GP129myc, GP131HA и GP133FLAG продуцирует белки с большим, чем ожидалось, размером: GP129myc (ожидается 24 по сравнению с 40 кДа); GP131HA (25 по сравнению с 31 кДа); GP133FLAG (16,7 по сравнению с 19 кДа) (таблица S2). Предполагалось, что это было результатом посттрансляционной модификации, такой как гликозилирование, как было продемонстрировано ранее для gH и gL [36]. Потенциально, как гликозилированные, так и негликозилированные версии GP131HA показаны на фиг. 2 (i) в виде белков с двумя различными молекулярными массами (приблизительно 31 и 25 кДа). Обработка клеток ингибитором гликозилирования туникамицина (S6 Fig) показала, что GP129 и GP131 подвергались гликозилированию, как предсказывалось в таблице S2. В присутствии туникамицина были обнаружены только белки с низкой молекулярной массой. Туникамицин также приводил к появлению более агрегированных белков в исследованиях клеточной иммунофлюоресценции (S6 Fig).

(i) Индивидуальная экспрессия пентамерных комплексных компонентов в эпителиальных клетках, трансдуцированных рекомбинантным аденовирусом, кодирующим либо gHGFP, gLmCherry, GP129myc, GP131HA, либо GP133FLAG, анализируемым вестерн-блоттингом с использованием соответствующих первичных антител: gH (анти-GFP); gL (anti-mCherry); GP129 (анти-myc); GP131 (анти-НА); GP133 (анти-FLAG). Группы, визуализированные с использованием соответствующего вторичного конъюгата антитело-HRP, как описано в материалах и методах [36]. Lys указывает на дефектную трансформированную аллель аденовируса, а MI указывает на лизат ложных клеток. (ii) Иммунопреципитация пентамерного комплекса из эпителиальных клеток, трансдуцированных всеми пятью рекомбинантными дефектными аденовирусами, кодирующими отдельные компоненты (10 TDU / вирус / клетка). Образцы анализировали как полный клеточный лизат, как указано выше, или обрабатывали для иммунопреципитационного анализа. Иммунопреципитацию проводили с помощью ловушки GFP, как описано ранее [36]. Отдельные белки детектировали, как описано для (i). Вестерн-блот-полосы: 1-3 (анти-mCherry); 4-5 (анти-GFP); 6-8 (antiFLAG); 9-10 (анти-myc); 11-12 (анти-НА). Lanes 1 и 6 mock зараженный клеточный лизат. Дорожки 2, 4, 7, 9 и 11 (общий клеточный лизат). Дорожки 3, 5, 8, 10 и 12 (иммунопреципитация). (iii) Контроль иммунопреципитации ПК с помощью GFP, заменяющего gHGFP. Эпителиальные клетки, трансдуцированные дефектными рекомбинантными аденовирусами, кодирующими GFP, gLmCherry GP129myc, GP131HA и GP133FLAG, с последующей иммунопреципитацией GFP и вестерн-блот для белков, как описано ранее [36]. Вестерн-блот-полосы: 1-4 (анти-GFP); 5-7 (anti-mCherry); 8-11 (анти-myc); 12-14 (анти-НА); 15-17 (анти-FLAG). Lanes 1 и 8 mock зараженный клеточный лизат. Дорожки 2, 5, 9, 12 и 15 (общий лизат клеток). Дорожки 3, 6, 10, 13 и 16 (проточные). Дорожки 4, 7, 11, 14 и 17 (иммунопреципитация).

Затем для выявления взаимодействия с образованием gH-GFP / PC в клетках, трансдуцированных всеми пятью рекомбинантными аденовирусами (AdgHGFP, AdgLmCherry, AdGP129myc, AdGL13HAHA и AdGP133FLAG), использовали анализы иммунопреципитации GFP-ловушки (Chromotek) (IP), фиг.2 (ii) , Ранее подход GFP-ловушек использовался для успешного изучения гликопротеиновых комплексов GPCMV gM / gN (через gMGFP IP) и gH / gL / gO (через gHGFP IP) [36]. IP-лиганд GFP-ловушек, трансдуцированный для всех потенциальных компонентов белка ПК, привел к успешному IP-методу gLmCherry, GP129myc, GP131HA и GP133FLAG с помощью gHGFP (рис. 2 (ii)). Интересно, что оба вида GP131HA были иммунопреципитированы. Напротив, контрольная GFP-ловушка IP-ячеек, трансдуцированная AdGFP, AdgLmCherry, AdGP129myc, AdGP130HA и AdGP133FLAG, но не AdgHGFP, привела к успешному IP-интерфейсу GFP, но ни один из компонентов ПК (рис. 2 (iii)), который продемонстрировал специфичность анализа IP, а также важность gH во взаимодействиях с другими белками ПК. Аналогичную серию реакций иммунопреципитации ПК также проводили с использованием RFP-ловушки (Chromotek) с gLmCherry и контролем mCherry. Все компоненты ПК могли быть осаждены gLmCherry IP, которые продемонстрировали важность gL для формирования ПК (S7 Fig). Контроллер mCherry вместо gLmCherry не смог иммунопреципитатировать компоненты ПК (S7 Fig)

Затем мы исследовали влияние C-концевых GP129 (гомологов UL128) на способность образовывать пентамерный комплекс с другими белками GPCMV. Первоначальное исследование было проведено с использованием природного мутантного GP129. Вирус второго поколения GPCMV BAC кодирует полный спектр вирусных генов [29, 95], но содержит делецию 4 bp в гене GP129, что помещает ORF из кадра и усекает кодированный белок на кодоне 102 (NRD13, см. S8 Инжир). Вирус, полученный из этого БАК, имеет нормальную кинетику роста клеток фибробластов, но не обладает способностью расти на эпителиальных клетках (см. Раздел о восстановлении эпителиального тропизма). Клон кДНК усеченного мутантного GP129 (обозначенный GP129NRD13) был myc-эпитопом, помеченным и клонированным в вектор экспрессии, и анализировали на способность образовывать ПК в анализе иммунопреципитации ловушки GFP. Несмотря на обнаруживаемые уровни экспрессии GP129NRD13, белок не был иммунопреципитирован как часть ПК (рис. 3). Это указывало на важность С-концевого домена GP129 в комплексном образовании. Химерный GP129 C-концевой мутант также генерировался синтетически, который кодировал C-концевой домен HCMV UL128 (штамма Мерлина) вместо GP129 после сайта усечения NRD13 (обозначенный GP129UL128, см. S8 Fig). В исследованиях с временными экспрессиями химерный белок GP129UL128 не смог сформировать ПК с другими компонентами (рис. 3). Это указывает на недостаточную сохранность между С-терминальными доменами GPCMV GP129 и HCMV UL128 для обеспечения формирования ПК. Хотя мутанты GP129 не могли быть осаждены как часть ПК, реакции иммунопреципитации gHGFP удаляли другие компоненты комплекса (gL, GP131 и GP133). Потенциально компоненты ПК были способны образовывать подкомплексы с gH / gL. Следовательно, была исследована способность GP129, GP131 и GP133 самостоятельно формировать триплексы с gH / gL. В анализе иммунопреципитации с временной экспрессией на основе gHGFP, gH / gL образуются триплексные комплексы с GP129, GP131 или GP133 (фиг. 3). Сопутствующая клеточная локализация белка также может быть продемонстрирована в цитоплазме эпителиальных клеток (рис. 4 и S9 рис.). Уместность различных подкомплексных триплексов на ПК или в триплексном образовании gH / gL / gO и вирусной сборке еще предстоит более полно исследовать в будущих исследованиях, но укажет, что взаимодействие gH / gL не зависит исключительно от GP129. Подкомплексное образование было также исследовано для мутантного GP129. Невозможно продемонстрировать образование триплексов с gH, gL и GP129 NRD13 с аналогичным результатом, полученным для взаимодействия со всеми компонентами ПК (рис. 3). Это означало, что C-терминальная часть GP129 также важна для формирования подкомплексов. В целом был сделан вывод о том, что GPCMV образует гомолог-пентамерный комплекс и что гомолог UL128 (GP129), особенно С-концевой домен, важен для комплексного образования.

С-концевые мутанты GP129 оценивали на способность образовывать пентамерные комплексы с gHGFP, gLmCherry, GP131HA и GP133FLAG. Мутанты GP129 экспрессировали на транзиторных экспрессирующих плазмидах, трансфецированных на эпителиальные клетки. Иммунопреципитацию проводили с использованием ловушки GFP, как описано в материалах и методах. Мутанты GP129 (NRD13 и GP129UL128) были обнаружены тегом myc epitope. (i) анализ PC-образования с использованием gHGFP и других компонентов мутанта PC и GP129 (NRD13) и IP-ловушки GFP. Дорожки 1, 5, 9, 13 и 17 представляют собой полные клеточные лизаты, проанализированные соответствующими антителами. Дорожки 3, 7, 11, 15 и 19 являются каналами иммунопреципитации с использованием GFP-ловушки [36]. Дорожки 2, 6, 10, 14, 18 проходят через стиральные дорожки до иммунопреципитации. Дорожки 4, 8, 12, 16 и 20 представляют собой ложный клеточный лизат. Образцы анализировали на: gH (анти-GFP), полосы 1-4; gL (anti-mCherry), полосы 5-8; GP131 (анти-НА), полосы 9-12; GP133 (анти-FLAG), полосы 13-16; и GP129 мутант NRD13 (анти-myc), дорожки 17-20. Вторичным антителом был антимышиный IgG-HRP. (ii) анализ PC-образования с использованием gHGFP и других компонентов мутанта PC и GP129 (GP129UL128) и IP-ловушки GFP. Дорожки, как описано для (i), за исключением полос 17-20 GP129UL128 мутантного пятна.

GP129, GP131, GP133 и gO ​​оценивали на способность образовывать триплексные комплексы с gH и gL. Переходная экспрессия эпителиальных клеток с gHGFP, gLmCherry, GP129myc, GP131HA и GP133FLAG была такой же, как описано в материалах и методах. Оценка образования триплексов осуществлялась путем клеточной колокализации или методом иммунопреципитации ловушки GFP. А-Е. gHGFP / gLmCherry / GP129myc триплекс. Панели A-D, временная экспрессия отдельных белков в эпителиальных клетках и совместная локализация, показанная в объединенном изображении (D). Вестерн-блот из триплексной иммунопреципитации (E). Дорожки 1, 4 и 7 (общий клеточный лизат). Дорожки 3, 6 и 9 (IP). Дорожки 2, 5 и 8 (поток через промывку). F-J. gHGFP / gLmCherry / GP131HA. Панели F-H, переходная экспрессия отдельных белков в эпителиальных клетках и совместная локализация, показанная в объединенном изображении (I). Вестерн-блот триплексной иммунопреципитации (J), как описано для E, за исключением полос 7-9 GP131HA западной. К-О. gHGFP / gLmCherry / GP133FLAG. Панели K-M, переходная экспрессия отдельных белков в эпителиальных клетках и совместная локализация, показанная в объединенном изображении (N). Вестерн-блот из триплексной иммунопреципитации (O), как описано для E, за исключением полос 7-9 GP133FLAG в западном направлении. Р-Т. gHGFP / gLmCherry / gOFLAG. Панели P-R, переходная экспрессия отдельных белков в эпителиальных клетках и совместная локализация, показанная в объединенном изображении (S). Вестерн-блот из триплексной иммунопреципитации (Т), как описано для E, за исключением полос 7-9 gOdelFLAG. Соединительные фигуры, объединенные в сотовой локализации (D, K, N и S), включают сополированные DAPI клетки. GP129myc, GP131HA, GP133FLAG и gOdelFLAG, обнаруженные первичным антиэпитопным антителом и вторичным анти-мышиным IgG-Cy5 (иммунофлуоресценция) и анти-мышиным IgG-HRP (вестерн-блот). Как gHGFP, так и gLmCherry были обнаружены с помощью флуоресценции (локализация клеток) и специфического антитела к эпитопу (западное). Панели E, J, O и P вестерн-блотов. Дорожки: 1, 4 и 7 общий лизат клеток; 2, 5 и 8 промывают поток; 3, 6 и 9 иммунопреципитация.

GPCMV серийно пассировали у животных, так как запасы слюнных желез сохраняли способность инфицировать эпителиальные клетки, в отличие от лабораторного адаптированного вируса. Второе поколение GPCMV BAC кодировало полноразмерный локус GP128-GP133, но перенесло делецию 4 bp, которая усекала ORF GP129 (мутант NRD13, S8 Fig) по сравнению с вирусом дикого типа [29, 95]. Переходная экспрессия белка GP129NRD13 вместе с другими компонентами пентамерного комплекса (gH, gL, GP131 и GP133) не смогла создать детектируемый ПК (фиг. 4). Кроме того, на основе BAC GPCMV не хватало эпителиального тропизма, но обычно росло на клетках фибробластов (см. Ниже) [96]. Способность GPCMV, полученного из BAC, сформировать функциональный пентамерный комплекс и потенциально восстановить эпителиальный тропизм, была оценена путем введения полноразмерной кассеты экспрессии кДНК GP129 в геном GPCMV в несущественном межгенном локусе. Межгенный сайт между гомологами UL25 и UL26 (GP25 и GP26) был выбран на основе ко-терминальных транскриптов, заканчивающихся в этом локусе, с достаточной межгенной последовательностью, чтобы включить вставку эктопической кассеты без вмешательства в экспрессию GP25 или GP26 на основе предыдущих исследований [ 25] (см. S10 Рис.). Антитела ORG, обработанная кДНК myc с тегами GP129 ORF, используемая в исследованиях переходной экспрессии, сначала клонировали в челночный вектор (pGP2526GP129LinkKm), который помещал кДНК GP129 под промотором SV40 и SV40 polyA, как описано в материалах и методах (S11 Fig). Клоны мутантных GPCMV BAC были выбраны маркерами канамицина (Km). Полноразмерные мутанты GPCMV BAC, кодирующие GP129myc в локусе GP25 / GP26, были проверены с помощью анализа профиля рестрикционных ферментов (S12 Fig) и с помощью ПЦР (S11 Fig) и секвенирования. ДНК из правильно идентифицированных мутантных GPCMV BACs трансфицировали на клетки GPL для генерации вируса (GP129FRT). Вирусную экспрессию myc-tagged GP129 и включение белка в вирусную частицу продемонстрировали вестерн-блот-анализом очищенных вирусных частиц, обработанных градиентом сахарозы. На фиг.5 показано, что GP129myc экспрессируется в инфицированных вирусом клетках. Кроме того, этот GP129 присутствовал в очищенных вирусных частицах, как и GP131, еще один уникальный компонент ПК. Гликопротеин gH также может быть обнаружен в вирусных частицах, предположительно как часть триплексного гомолога (gH / gL / gO), а также пентамерный комплекс (gH / gL / GP129 / GP131 / GP133). Кроме того, гликопротеин gB можно было обнаружить как компонент вирусных частиц, но не GFP, который был экспрессирован в инфицированных клетках, но не был включен в вирусную частицу. Кривая роста подтвердила, что GP129FRT GPCMV был очень трофическим для эпителиальных клеток с эффективным ростом вируса (рис. 6). Для сравнения, родительский вирус GPCMV BAC NRD13, который кодировал усеченный GP129, но жизнеспособный GP131 и GP133, не смог эффективно реплицировать на эпителиальные клетки (фиг. 6).

(i) Структура родительского BAC-вируса (NRD13) и модифицированного мутантного GP129FRT GPCMV. Модифицированный мутант кодирует ectopic GP129 (myc tagged) кДНК под контролем промотора SV40 в межгенном локусе GP25 / GP26, как описано в материалах и методах (S14 Fig). Стрелки (справа) указывают на вирусный тропизм на эпителиальные клетки: красный, без тропизма; зеленый, тропизм. (ii) Вестерн-блот-анализ очищенного градиента сахарозы GP129FRT. Очищенный вирус оценивали на наличие структурных белков, присутствующих в вирусной мембране, с помощью вестерн-блот-анализа: gB (обнаруженный мышиным анти-gB), полосы 1-3; gH (кролик анти-gH), полосы 4-6; GP131 (мышь anti-GP131), полосы 7-9; GP129 (мышь anti-myc), дорожки 10-12. Кроме того, был также проанализирован белок GFP контроля (мышиный анти-GFP), экспрессируемый вирусом (полосы 13-15). Вторичными антителами были либо антимышиный IgG / HRP, либо IgG / HRP против кроликов. Дорожки: 1, 4, 7, 10 и 13 общий лизат клеток (GP129FRT); 2, 5, 8, 11 и 14 общий лизат клеток (неинфицированный); 3, 6, 9, 12 и 15 (очищенная вирусная частица). Эквивалентную загрузку белка определяли по анализу Брэдфорда.

Эпителиальные клетки свиньи Гвинеи были инфицированы либо GP129FRT (кодирующим эктопический GP129), либо NRD13 (кодирующий мутант GP129) в moi 1 pfu / cell. Образцы брали в разные дни после инфицирования и титровали в двух экземплярах и титровали на клетках GPL, как описано ранее [33]. Результаты показаны как титр вируса против инфекции после дня.

Затем была оценена потребность в других компонентах гомологического ПК для роста вируса на эпителиальных клетках. Целевой мутагенез проводили на локусе GP128-GP133 для генерации мутантов GPCMV BAC с нокаутом GP128, GP129-GP131 или GP133 в отдельных реакциях мутагенеза BAC. Конечные мутанты GPCMV BAC кодировали эктопическую кДНК GP129 в межгенном локусе GP25 / GP26 в дополнение к специфическим мутациям в локусе GP128-GP133, как описано в материалах и методах. BAC-мутанты характеризовались анализом профиля рестрикции, ПЦР и секвенированием продукта ПЦР (S12 Fig и S11 Fig). Рекомбинантные вирусы были обозначены GP128FRT / GP129Link (мутант GP128); GP129-GP131FRT / GP129Link (мутант GP131); GP133FRT / GP129Link (мутант GP133). Хотя эти вирусные мутанты имели сходную кинетику роста клеток GPL, у них не было способности эффективно инфицировать эпителиальные клетки (S13 Fig). Исключением был мутант GP128, который сохранял способность инфицировать эпителиальные клетки (рис. 7). В случае GP131 и GP133 GFP-меченых мутантных вирусов (нециклический BAC-фрагмент) контрастная инфекция может быть продемонстрирована между фибробластами и эпителиальными клетками. В отдельных экспериментах moi 1 pfu / cell приводил к 100% -ной заражению клеток GPL, но только приблизительно 1 из 106 эпителиальных клеток. Кроме того, мутантные вирусы, инфицированные эпителиальными клетками, не привели к распространению вируса в окружающие клетки, в отличие от GP129FRT или SG GPCMV. Примеры нарушений роста мутантного вируса GP131 и GP133 на эпителиальных клетках по сравнению с клетками GPL показаны на S13 (ii).

(i) GP128 представляет собой ядерный белок. Переходная плазмидная ко-экспрессия GP128 (маркировка FLAG), gHGFP и gLmCherry через 24 часа после трансфекции. Панели A-D той же ячейки. Панель A, иммунофлюоресценция GP128FLAG (мышиный анти-FLAG / антимышиный IgG-Cy5); GFP-флуоресценция gHGFP (B); флуоресценция mCherry gLmCherry (C); объединенные изображения A-C (D). (ii) вирус нокаута GP128 (GPCMVdel128) растет на эпителиальных клетках. E. Иммунофлуоресценция IE2 (кролик против IE2 / антикролиновый IgG-FITC). F. Иммунофлуоресценция цитокератина (мышиный анти-панцитокатин / антимышиный IgG-TRITC). G. Слияние изображений панелей A плюс B и DAPI окрашенных клеточных ядер.

В целом было сделано заключение, что эпителиальный тропизм может быть восстановлен в лабораторном адаптированном GPCMV путем эктопической экспрессии отсутствующего полноразмерного белка GP129. Этот вирус (GP129FRT) экспрессировал GP129 и GP131 белки как часть вирусной частицы. Нокаут отдельных генов в локусе GP128-GP133 на фоне вируса, экспрессирующего эктопическую полноразмерную GP129, также подтвердил важную роль GP131 и GP133 в формировании ПК и эпителиальном тропизме. Нокаут гена GP128 не предотвращал эпителиальный тропизм и кратковременную экспрессию GP128 показал, что он представляет собой белок, нацеленный на ядерную терапию (рис. 7). Функциональное значение GP128 в жизненном цикле GPCMV остается неизвестным. Анализ BLAST прогнозируемой последовательности белка GP128 показал, что он является потенциальным гомологом MCMV IE2 [15] и поэтому вряд ли будет иметь отношение к формированию ПК.

В предыдущем исследовании было продемонстрировано, что GPCMV образует триплекс гликопротеина гомолога gH / gL / gO и что gO (GP74) был необходим только в лабораторном адаптированном вирусе, у которого отсутствовал ПК [36]. Чтобы продемонстрировать, что ПК более важен, чем триплексный комплекс для инфицирования эпителиальных клеток, серия goc (GP74) / GP129 мутантных GPCMV BAC была трансфицирована на GPL или эпителиальные клетки для оценки распространения вируса. Использовали три мутанта GPCMV BAC (рис. 8): (1) GP74Km, который содержит нокаут GP74 на BAC GPCMV, который не имел GP129 полной длины [36]; (2) NRD13, GPCMV BAC, который не имел полной длины GP129; (3) GP129FRT / GP74Km, GPCMV BAC, который кодировал нокаут GP74 и полноразмерную кДНК GP129 в межгенном локусе GP25 / GP26. Трансфекция ДНК GPC GP74Km GPCMV (1) на GPL или эпителиальные клетки не позволила разработать вирусные бляшки, а вместо этого оставалась как единичные трансфицированные клетки, которые могли быть идентифицированы экспрессией гена GFP-репортера (рис. 8A-8C). Трансфекция NRD13 (GP129 мутант) GPCMV BAC (2) на GPL или эпителиальные клетки приводила к развитию вирусных бляшек и распространению на клетках фибробластов, но не вызывала вируса на эпителиальных клетках (рис. 8D-8F). Трансфекция GPCMV BAC GP129FRT / GP74Km на GPL и эпителиальные клетки привела к развитию вирусных бляшек на обоих типах клеток (рис. 8G-8I). Важно отметить, что вирус, полученный из BAC GP129FRT / GP74Km, показал, что gO не является полностью необходимым для инфицирования эпителиальных клеток. Распространение вируса распространяется на весь монослой эпителиальных клеток. Хотя GPCMV-инфекция эпителиальных клеток может возникать в отсутствие gO через ПК, гликопротеин gB, как полагают, необходим для инфицирования эпителиальных клеток, как показано для клеток фибробластов [36]. В дополнительном эксперименте PC + / gO + / gB (GP55) отрицательный мутант GPCMV BAC (GP129FRT / GP55Km) при трансфецировании на эпителиальные клетки не смог вызвать инфекционный вирус. Напротив, вирус спасения gB восстановил эпитропизм, который подчеркивал существенную природу белка gB для эпителиальной инфекции, несмотря на потребность в ПК (S14 Fig) [36]

Мутанты GPCMV BAC трансфицировали на клетки (GPL и EPI) для получения положительного вируса GFP и для демонстрации требования к пентамерному комплексу, но не к триплексу для эпителиального клеточного тропизма. Мутанты GPCMV: (A) NBGP74Km, двойной мутант, gO (GP74Km) и мутант GP129 (NRD13); (D) NBNRD13, мутант GP129 (NRD13); (G) NBGP129FRT / GP74Km, двойной мутант, gO (GP74Km) и GP129 (NRD13) плюс эктопическое выражение полной длины GP129myc (локус GP26 / GP26). Вирус, определяемый репортерным геном GFP, распространяется по клеточному монослою. Результаты показаны примерно через 18 дней после трансфекции BAC как для GPL, так и для клеток EPI для каждого вируса. Панели B и C, NBGP74Km. Панели E и F, NBNRD13. Панели H и I, NBGP129FRT / GP74Km.

Так как инфекция эпителиальных клеток произошла для отрицательного вируса PC + / gO, но не для вируса ПК / gO +, мы пришли к выводу, что инфекция эпителиальных клеток не является абсолютно зависимой от gO или триплекс gH / gL / gO, но ПК необходим для эпителиального клеточной инфекции. По общему признанию, этот конкретный анализ был относительно грубым, поскольку он не смог полностью различить распространение клеток и клеток от вируса клеточного высвобождения. Тем не менее, стратегия продемонстрировала важность ПК для инфицирования эпителиальных клеток. Аналогичный подход определил существенный характер гликопротеинов GPCMV (gB, gH, gL, gO, gM и gN) для клеток фибробластов [36]. В HCMV вирус PC + / gO + может более легко инфицировать эпителиальные клетки, чем отрицательный вирус PC + / gO [67]. Поэтому в HCMV gO имеет неопределенную роль в заражении типов клеток, отличных от фибробластов, через неопределенный механизм [36]. Роль gO в потенциальном усилении GPCMV-инфекции эпителиальных клеток и других типов клеток еще предстоит оценить.

В HCMV, зависящая от PC инфекция эпителиальных и эндотелиальных клеток происходит через эндоцитарный путь, который требует кислотного потока в эндосоме [61]. Антибиотик-бафиломицин предотвращает HCMV-инфекцию эпи / эндотелиальных клеток путем ингибирования АТФазы и последующего подкисления эндосомы [61, 97, 98]. Предварительная обработка эпителиальных клеток морской свинки с 50 нМ бафиломицином резко ингибировала вирусную инфекцию эпителиальных клеток, но не оказывала сильного влияния на инфекцию фибробластов (S15 Fig). Это потенциально указывало на то, что вхождение GPCMV в эпителиальные клетки происходит через аналогичный путь к HCMV. Более целенаправленные будущие исследования процесса входа GPCMV в эпителиальные клетки могли бы лучше понять входной путь для GPCMV и сходство с HCMV. Анализ уровня ПК по сравнению с gH / gL / gO на частицах GPCMV может быть достоин будущих исследований, поскольку это может помочь определить тропический клеточный тропизм.

Чтобы определить, увеличила ли экспрессия вируса вирусную патогенность, сравнительные исследования на животных проводились с использованием разных GPCMV: GP129FRT (группа 1); SG GPCMV (группа 2); и NRD13, BAC, полученный GPCMV (группа 3). Серонегативных животных случайным образом делят на три группы (n = 12 на группу), а животных каждый инокулировали 106 БОЕ вируса (либо GP129FRT, SG GPCMV, либо NRD13 в зависимости от их конкретной группы). В различные моменты времени (4, 8, 12 и 27 дней после инфицирования) три животных на группу подвергали эвтаназии, а вирусную нагрузку в ткани и крови целевой определяли по ПЦР в реальном времени, как описано в материалах и методах. Результаты исследования вирусной патогенности показаны на рис. 9. Статистический анализ (тест Стьюдента t) был проведен для GP129FRT против SG GPCMV и GP129FRT против NRD13 на ткани из аналогичных органов-мишеней в аналогичные моменты времени. В целом, вирус GP129FRT имел образец распространения, который напоминал SG GPCMV в течение первых 12 дней заражения в органах-мишенях легких, печени и селезенки (см. Рис. 9A-9C). Вирусная нагрузка в слюнной железе не оценивалась до 27 дня и была обнаружена как для GP129FRT, так и для SG GPCMV. Вирусная нагрузка в слюнной железе была приблизительно на 1 log выше для SG GPCMV по сравнению с GP129FRT, которая была значительной (p <0,005). Кроме того, на 27-й день SG GPCMV может быть обнаружен в легких органах легких, печени и селезенке, тогда как GP129FRT может быть обнаружен только в селезенке. В целом в целевых органах наблюдалась статистически значимая разница (р <0,05 до <0,005) в вирусной нагрузке между GP129FRT и SG GPCMV, за исключением печени (D4 и D8) и селезенки при D4. Как SG GPCMV, так и GP129FRT демонстрировали сходные уровни виремии на 4, 8 и 12-й день после инфицирования, причем пиковые уровни выявлялись через 8 дней после инфицирования. На 27-й день виремия не обнаружена.

Сравнительное распространение вирусов на органы-мишени. Три отдельных группы (n = 12 на группу) животных были инфицированы либо SG GPCMV, GP129FRT, либо вирусы NRD13 (106 БОЕВО). В различные дни (4, 8, 12 и 27 дней после инфицирования инфекции, DPI) 3 животных на группу оценивали на вирусную нагрузку в органах-мишенях в ПЦР в реальном времени из ткани, экстрагированной ДНК. Вирусная нагрузка нанесена как вирусные копии генома / мг ткани. Слюнная ткань была оценена только на 27-й день. График: A, легкое; B, печень; C, селезенка; D, слюнная железа. Виремия крови у 4, 8, 12 и 27 DPI показана в E для вирусов GP129FRT и SG GPCMV и изображается как копии генома / мл крови. Виремия для NRD13 была ниже уровня обнаружения. Статистический анализ проводился с помощью теста Student t, сравнивающего вирусную нагрузку GP129FRT против SG GPCMV и GP129FRT против NRD. Статистические группы: a) p <0,05; b) p <0,005; c) NS не имеет значения.

В отличие от GP129FRT и SG GPCMV, родительский вирус NRD13 родительского BAC (кодирующий усеченный GP129) был сильно ослаблен на животной модели, см. Фиг. 9. NRD13 был обнаружен в легких, селезенке печени в день 4, 8 и 12 после инфицирования, но при существенно пониженных уровнях по сравнению с GP129FRT и SG GPCMV. Во всех сопоставимых временных точках вирусный титр во всех тканях NRD13 был значительно ниже при p <0,005 по сравнению с GP129FRT (кроме D4 легких и печени, p <0,05). NRD13 не был обнаружен в каких-либо органах-мишенях на 27-й день и не присутствовал в слюнной железе. В отличие от других вирусов, виремия NRD13 во все моменты времени была ниже уровня обнаружения (рис. 9Е). Предположительно, неспособность NRD13 образовать пентамерный комплекс и неспособность заразить более широкий диапазон типов клеток препятствовала способности NRD13 эффективно распространять или копировать в органы-мишени. В целом было сделано заключение о том, что восстановление способности выражать недостающий полноразмерный белок GP129 приводило к вирусу, который мог не только инфицировать эпителиальные клетки в тканевой культуре, но также имел большую патогенность в модели животных по сравнению с родительским вирусом мутантного GP129 ( NRD13). Важно отметить, что вирус GP129FRT способен распространяться на слюнные железы, в отличие от мутантного GP129.

Плацента состоит из эпителиальных и эндотелиальных клеток, улучшенный тропизм вируса GP129FRT для эпителиальных клеток и других типов клеток in vivo также может потенциально увеличивать врожденную скорость передачи вируса по сравнению с родительским вирусом NRD13. Серонегативным беременным плотинам было поставлено 106 pfu NRD13 (группа 1, n = 8) или GP129FRT (группа 2, n = 11) в позднем втором триместре через подкожную инокуляцию, и животным было позволено перейти к термину. Была оценена вирусная нагрузка в органах-мишенях-щенках (печени, легких, селезенке, головном мозге) живых животных или животных, оставшихся в живых животных. В таблице 1 приведен результат смертности для живых животных, которые все еще рождаются у щенков для групп. Таблица 2 имеет вирусную нагрузку в целевых органах щенков (живые и мертвые). В группе GP129FRT (9 щенков, 17,3%) наблюдалось большее количество новорожденных щенков по сравнению с группой NRD13 (2 щенка, 6,5% ).

p = несущественный (точное определение Фишера)

aViral load, выраженная в CMV копиях / мг ткани (№ CMV + / общий образец ткани)

bTransmission rate (GPCMV, обнаруженный по меньшей мере в одном органе) Точный тест Фишера

сравнение образцов CMV + в каждой группе тканей GP129FRT против NRD13 (точный тест Фишера)

В целом было отмечено, что в группе GP129FRT, имеющей положительный результат в отношении вируса, по сравнению с группой NRD13 (р <0,05) наблюдалась большая частота. В последней группе только один мозг был обнаружен положительным для вируса у одного щенка, и все органы были отрицательными у всех других животных. В группе GP129FRT у 20/52 щенков обнаружен вирус в различных органах (мозг, печень, селезенка и легкие). Скорость передачи вируса GP129FRT составила 38,46% по сравнению с 3,2% для вируса NRD13, что было статистически значимым (p = 0,0002). Следует отметить, что ни один из до сих пор не родившихся щенков в группе NRD13 не был положительным для вируса, а их смерть во внутриутробной группе, вероятно, была осложнением беременности и не ассоциировалась с врожденной ЦМВ-инфекцией.

Для оценки вирусной нагрузки было доступно ограниченное число терминальных плаценток (2 для группы GP129FRT и 7 для группы NRD13), но только инфицированные животные GP129FRT имели положительные плаценты CMV (см. Таблицу 2). Присутствие вируса GP129FRT в плаценте (3-й триместр) дополнительной беременной морской свинки оценивали с помощью иммуногистохимии на 22-й день после инфицирования. На фиг.10 показаны результаты иммуногистохимического окрашивания участков криостата плаценты для антигенов GPCMV gB. Присутствие вируса в ткани плаценты также было подтверждено экстракцией ДНК и ПЦР. Рис. 10 На панели А показан мультфильм структуры плаценты и указанных областей, где вирусный антиген обнаружен в срезах криостата (C и D). На панели В показан анализ ПЦР на агарозном геле для ДНК, экстрагированной из инфицированных вирусом эпителиальных клеток или участка плаценты. ПЦР была предназначена для локуса GP128-GP133, и был обнаружен только локус на полную длину (2 kb). Панели C и D представляют собой участки, окрашенные для белка GPCMV gB. Представительные контрольные участки (без первичных антител) показаны на панелях E и F. Вирус в основном был обнаружен в интерфейсе лабиринтной области плаценты. Эти результаты подтверждают наличие вирусных антигенов в плаценте. Мы пришли к выводу, что врожденная скорость передачи GPCMV сильно зависит от вируса, кодирующего функциональный GP129 / PC. По-видимому, более широкий диапазон вирусного клеточного тропизма будет требовать эффективной врожденной передачи плоду, поскольку материнский эмбриональный барьер в плаценте состоит из слоя эпителиальных клеток синцитиотрофобласта [99, 100].

Плаценты собирали из усыпленной беременной (3-й триместр) морской свинки Хартли в 22 дня после заражения с помощью GPCMV129FRT (подкожная инъекция 10 мкг ПФУ). Иммуногистохимию проводили на замороженных секциях криостата (5 мкм), как описано в материалах и методах, и окрашивали для гликопротеина GPCMV gB. A. Мультфильм плаценты морской свинки (на основе ссылки [20]). C и D указывают местоположение обнаруженного gB-антигена (лабиринт) на панелях C и D. B. Агарозный гель ПЦР локуса GP128-133 амплифицирован из ДНК, экстрагированной из клеток EPI или ткани плаценты с праймерами P1 и P2 (рис. 1). Левая полоса SG GPCMV (эпи-клетки) и правая полоса GP129FRT (плацента). C и D. Иммуногистохимическое окрашивание ткани плаценты для GPCMV gB. E и F. Контрольные участки иммунохимии плаценты (только для вторичных антител).

Гистопатологические исследования электронной микроскопии слюнных желез морской свинки (клетки протока) и ткани плаценты (трофобластные клетки) от инфицированных GPCMV животных предположили, что GPCMV может инфицировать эпителиальные клетки [21, 101]. Ретроспективно это были важные наблюдения в контексте вирусного тропизма и недавняя идентификация нового механизма HCMV-инфекции эпителиальных и эндотелиальных клеток и других типов клеток [60, 61, 63, 64]. Наши недавние исследования мутагенеза GPGMV гликопротеинов GPCMV (кодирующие гомологи gB, gH, gL, gO, gM или gN) продемонстрировали сохранение структуры основной функции и образования гомологического гликопротеина (gB, gH / gL / gO и gM / gN) между HCMV и GPCMV [36, 102]. Данное настоящее исследование показало, что гомологический локус UL128-131 (GP129-GP133) [28] необходим для инфицирования GPCMV эпителиальных клеток гвиней в тканевой культуре и что тропизм зависит от способности образовывать пентамерный гомологический комплекс, который структурно присутствует в вирусная частица. Мутагенез GPCMV с нокаутом продемонстрировал, что образование пентамерного комплекса и эпителиальный тропизм зависят от способности вируса экспрессировать GP129, GP131 и GP133 дикого типа, но что GP128 не имеет существенного значения для комплексного образования или эпителиального тропизма. Кроме того, улучшенный эпителиальный тропизм, патогенность и врожденная инфекция в животной модели могут быть установлены для мутантного вируса (мутант GP129 в локусе GP128-133) с помощью эктопической экспрессии кДНК дикого типа GP129 и последующая способность образовывать гомологический пентамерный комплекс. Важно отметить, что образование пентамерного комплекса GPCMV не пригодно для заражения фибробластовыми клетками, как это имеет место для HCMV. Любопытно, что Ауэрбах и др. [90] продемонстрировал усиление фибробластной инфекции GPCMV, связанной с полным локусом GP129-133. Наши исследования как с фибробластовыми клетками GPL, так и с фибробластами эмбриональных эмбриональных эмбрионов в домашних условиях не определяли зависимость от интактного локуса GP128-133 для инфекции фибробластов. Аналогичным образом, Иноуэ и его коллеги [26] не видели зависимости ПК от инфекции первичных или иммортализованных фибробластов морских свинок [28]. Удивительно, но Ауэрбах и его коллеги не смогли продемонстрировать специфический тропизм для эндотелиальных клеток вируса с интактным локусом GP128-133 по сравнению с вирусом с делецией в этом локусе [90]. Исходя из данных эпителиального тропизма и исследований патогенности in vivo, прогнозирование будет состоять в том, что ПК-положительный GPCMV будет проявлять повышенный тропизм до более широкого диапазона типов клеток. Этот увеличенный диапазон будет включать эндотелиальные клетки. HCMV проявляет те же требования к ПК для введения клеток в эпителиальные и эндотелиальные клетки [63, 64]. В дополнение к текущей линии эпителиальных клеток мы недавно выделили две линии эпителиальных клеток, полученных из плаценты морских свинок, которые имеют одинаковую жесткость требований к пентамерному комплексу GPCMV [103]. Важно отметить, что исследования лейкоцитарных клеток морских свинок указывают на то, что ПК необходим для инфицирования этими типами клеток, что является аналогичным требованием для HCMV [93, 104].

Потенциально, в Auerbach et al. исследование [90], популяция эндотелиальных клеток, которые были выделены проточной цитометрией с использованием кросс-реагирующих антител, имело низкий уровень загрязняющих фибробластов, что предотвратило бы контрастное требование для пентамерного комплекса для клеточной инфекции. В нашем исследовании выделение эпителиальных клеток проводили с помощью обычной стратегии клонирования и окрашивания антител клетками для цитокератина. Кроме того, иммортализованные клеточные линии повторно клонировали и охарактеризовали (S3 Fig). Напротив, Auerbach et al. [90], избранный для использования RT-PCR-анализа полного лизата монослоев клеток, чтобы охарактеризовать их первичные эндотелиальные клетки, несмотря на то, что факторное антитело фон Виллебранда успешно используется для идентификации эндотелиальных клеток морской свинки в предыдущих исследованиях [105]. Следовательно, однородность их линии эндотелиальных клеток остается полностью подтвержденной. Важно отметить, что недавно выделенные эпителиальные клеточные линии от плаценты морских свинок демонстрируют, что заражение GPCMV специализированными плацентарными клетками требует ПК [103], что также подтверждает гипотезу о том, что увеличение врожденной передачи зависит от ПК. Это также объясняет повышенную степень врожденной инфекции, наблюдаемую в вирусе, кодирующем полный локус GP128-133 [29, 106].

Переходная экспрессия гомологических компонентов пенатмерного комплекса (gH, gL, UL129, UL131, UL133) в эпителиальных клетках приводила к образованию комплекса в отсутствие других вирусных компонентов, что подтвердило результаты Auerbach et al. [90], который использовал очищенный рекомбинантный бакуловирус, экспрессированный белок, с образованием пентамерного комплекса in vitro. Важно отметить, что естественный C-концевой делеционный мутант белка GP129 (кодоны 102-179) от вируса, лишенного эпителиального тропизма (NRD13), не мог образовать пентамерный комплекс с другими сложными компонентами. Важность C-терминального домена GP129 для стабильного образования ПК в рекомбинантном GPCMV еще предстоит оценить.

В этом текущем отчете исследования мутантов PC были ограничены GP129, но генерация мутантов других компонентов ПК (например, GP131 или GP133) была бы оценена в будущих исследованиях, чтобы помочь в определении критических доменов для комплексного образования. В HCMV взаимодействие белка UL128 с gH / gL является потенциально важным ключевым этапом из-за образования дисульфидной связи с gL [55]. В наших исследованиях GPCMV мы продемонстрировали, что взаимодействие с gL, а также gH важно для формирования ПК (рис. 2 и S7 рис.). Кроме того, встречаются триплексные комплексы gH / gL / GP129 (рис. 4), но образование дисульфидной связи не исследовалось. Скорее всего, сохранение аминокислот цистеина означает, что GP129 имеет возможность взаимодействия с gL одним и тем же специфическим образом. Важно отметить, что мутант GP129 не смог образовать триплексный комплекс с gH / gL. Также можно было продемонстрировать триплексные комплексы с gH / gL и GP131 или GP133. Было продемонстрировано наличие субкомплексного образования для HCMV между различными компонентами ПК [62]. Оценка стехиометрии этих подкомплексов в различных типах клеток может иметь важное значение для определения их влияния на иммунный ответ хозяина. ПК GPCMV представляет собой высокоиммуногенные, но не отдельные уникальные компоненты (GP129, GP131 или GP133) на основе недавно разработанных анализов ELISA [103]. Следовательно, гомологический ПК станет важным целевым антигеном в GPCMV, как это имеет место для ПК в HCMV.

Основной вопрос заключается в том, что диктует образование триплекса gH / gL / gO или пентамера gH / gL / UL128-131 в HCMV и гомологических комплексов в инфицированных GPCMV клетках. В GPCMV GP129, GP131 и GP133 имеют теоретическое преимущество 3: 1 перед gO для взаимодействия с gH / gL, и то же самое будет иметь место для HCMV (UL128, UL130 и UL131). В недавней модели формирования пентамерного HCMV Ciferri и др. [55] предложили, чтобы UL128 и gO ​​каждый конкурировали с образованием дисульфидной связи с gL на кодоне 144 эксклюзивным способом в комплексе gH / gL и что это наиболее важный так как UL130 и UL131 присоединяются к gH / gL через нековалентные связи. Альтернативно, в HCMV был предложен дополнительный белок, кодируемый в ULb’-области (UL148), для регулирования gH / gL / gO или gH / gL пентамерного образования неопределенным образом [107]. Идентификация гомолога UL148 может быть целесообразным исследовать в будущих исследованиях GPCMV, как и оценка способности GP129 связывать gH / gL в конкурентной борьбе в присутствии gO.

Любопытно, что gO в человеческом и животном ЦМВ сильно N-гликозилирован. В предыдущей публикации [36] мы исследовали важность N-гликозилированного или негликозилированного gO-белка в триплетном образовании GPCMV gH / gL / gO. Как дикий тип (N-гликозилированный) gO, так и gO-мутант (без сайтов N-гликозилирования) одинаково способны образовывать триплекс. Кроме того, в клетках GPL, инфицированных GPCMV, gO дикого типа может быть обнаружен как гликозилированный, так и негликозилированный в равных количествах, но в исследованиях экспрессии переходных плазмид может быть обнаружен только N-гликозилированный gO [36]. Потенциально, состояние гликозилирования gO может иметь разветвление для устойчивого состояния gH / gL, доступного для взаимодействия с пентамерными комплексными компонентами. Тяжело N-гликозилированный gO-белок может иметь более эффективное взаимодействие с эндопротезированным ретикулумом (ER) кальнексин-шапероновой белковой системой [108]. Это, в свою очередь, может усилить движение комплекса gO или gH / gL / gO через ER, что приведет к более эффективному созреванию и выходу вирионов. Следовательно, если статус гликозилирования gO в фибробласте по сравнению с эпителиальными клетками был иным, то потенциально это могло бы влиять на способность одного комплекса образоваться над другим и впоследствии увеличивать вирусный тропизм путем изменения триплексного и пентамерного комплекса на внешней стороне вирусной частицы. Однако для более полного изучения этих возможностей в GPCMV потребуется разработка специфического антитела gO для полной оценки этих эффектов.

Исследования патогенности животных показали, что восстановление способности вируса образовывать пентамерный комплекс не только приводило к эпителиальному тропизму, но также увеличивало вирусную патогенность, а также врожденную скорость передачи (рис. 9, таблицы 1 и 2). Эктопическая экспрессия кДНК GP129 приводила к вирусу с аналогичной моделью патогенности с SG GPCMV и, что важно, вирус попадал в слюнные железы. Напротив, родительский вирус GPCMV BAC (NRD13) не обладал виремией и плохо распространялся. Кроме того, вирус GP129FRT имел врожденную скорость передачи 38,4% по сравнению с 3,2% для NRD13. Врожденные исследования на GPCMV обычно проводятся с вирусным запасом, генерируемым серийным прохождением у животного и вирусом, сгенерированным в качестве запаса слюнных желез. Запасы вируса дикого типа SG GPCMV имеют врожденную скорость передачи от 55 до 75% на основе предыдущих публикаций. Потенциально, прохождение GP129FRT у животных для слияния слюнных желез могло бы увеличить врожденную скорость вируса, и эти исследования в настоящее время ведутся.

Основа для затухания вируса, происходящего в клетках фибробластов (мутация локуса GP128-133), не определена. Скорее всего, в клетках фибробластов наблюдается смещение для продуцирования вируса, свободного от клеток, кодирующего триплекс по сравнению с вирусом, который также кодирует пентамерный комплекс. Сплавленный характер кодированных генов GP129 и GP131 может быть фактором, способствующим этапу ограничения скорости на кинетике экспрессии. Альтернативно, статус гликозилирования gO в клетках фибробластов по сравнению с эпителиальными или другими типами клеток может влиять на триплексное (gH / gL / gO) образование. В целом, эти факторы также могут быть основой для быстрой генерации мутантов локуса GP128-133, когда SG GPCMV последовательно пассируется на клетках фибробластов. Однако это еще предстоит изучить и потенциально может потребовать разработки дополнительных эпителиальных и фибробластных клеточных линий, чтобы продемонстрировать, что это явление не ограничивается клеточными линиями, используемыми в этом исследовании.

Таким образом, это исследование показало, что гомологический локус UL128-131 (GP129-GP133) необходим для GPCMV для образования гомологического ПК. Кроме того, потеря GPCMV способности образовывать поврежденный ПК эпителиальный клеточный тропизм и ослабляет вирус в модели животных. Важно отметить, что восстановление эпителиального тропизма GPCMV привело к увеличению патогенности и врожденным скоростям передачи. В целом, эти данные укрепляют морскую свинку как очень важную модель врожденной инфекции HCMV и разработку вакцины CMV или стратегий вмешательства против врожденной инфекции. Кроме того, в этих исследованиях подчеркивается важность ПК для врожденной передачи и настоятельно указывают на то, что вакцина, направленная на предотвращение врожденной инфекции, должна включать пентамерный комплекс в качестве части конструкции вакцины.

GPCMV (штамм 22122, ATCC VR682), вирусы первого и второго поколения GPCMV BAC [26, 27] были размножены на клетках легких фибробластов морских свинок (GPL, ATCC CCL 158) в среде F-12, дополненной 10% фетальной телячьей сывороткой ( FCS, Life Technologies), 10 000 МЕ пенициллина / литра, 10 мг стрептомицина / литра (Life Technologies) и 7,5% NaHCO3 (Life Technologies) при 37 ° C / 5% CO2. Титрование вируса проводили на 6-луночных планшетах. Бляшки окрашивали 10% -ным пятном Гимзы или визуализировали флуоресцентной микроскопией. Вирусы с высоким титром были созданы, как описано ранее [36]. Очищенные запасы сахарозы с градиентом первоначально генерировались как вирус с высоким титром и затем очищались по градиенту сахарозы по ранее описанному протоколу [109]. Эпителиальные клетки свиньи были первоначально выделены в качестве первичных почечных эпителиальных канальцевых клеток из почек морской свинки Хартли обычной процедурой клонирования. Первоначально эпителиальные клетки первоначально поддерживали на покрытых коллагеном (Life Technologies) планшетах в среде для роста эпителиальных клеток (Applied Technology), дополненной 10% FCS (Life Technologies) и антибиотиками, как описано для среды F-12. Трансформированные эпителиальные клетки поддерживали в DMEM с высоким содержанием глюкозы с пируватом натрия (Life Technologies), дополненным 5% FCS (Life Technologies) и антибиотиками, как описано для среды F-12. Эпителиальные клетки поддерживали при 37 ° С / 5% СО2 и характеризовали в качестве эпителиальных клеток характерным мозаичным появлением клеточного монослоя, а также окрашиванием положительным для маркера цитокератина (антитело против панситокератина и антитело против цитокератина 18, клеточная сигнализация). На эпителиальных клетках выделяли культуры культуры GP129FRT и SG GPCMV. Все олигонуклеотиды были синтезированы Sigma-Genosys (The Woodlands, TX) и перечислены в таблице S1.

Первичные эпителиальные клетки почки морской свинки Хартли были выделены в соответствии с протоколом [110]. Затем клетки трансформировали трансдукцией дефектными лентивирусами, кодирующими SV40 TAg или HPV E6 / E7 (Applied Biological Materials Inc.) в соответствии с протоколом производителя. Клетки повторно сеяли на 100-миллиметровые чашки с коллагеновым покрытием и размножали в DMEM с высоким содержанием глюкозы с пируватом натрия (Invitrogen), дополненным 10% эмбриональной телячьей сывороткой и 1X антибиотиком-антимикотиком (Life Technologies) и 37 ° C / 5% CO2. Быстрорастущие колонии выделяли с помощью процедуры клонального кольца и субклонировали на свежие монослои покрытых коллагеном пластин и поддерживали в виде отдельных клеточных линий и аликвот клеток в криоконсервированных средах (Gemini Bioproducts) и хранили в жидком азоте. Трансформированные клетки были проверены как эпителиальные путем позитивного окрашивания для маркера цитокератина путем вестерн-блоттинга или иммунофлуоресцентного окрашивания с использованием анти-панситокератина (технология клеточной сигнализации) и антицитокератина 19 (прикладная технология) с использованием ранее описанного протокола [36]. Трансформированные трансформированные клетки SV40 T плохо поддерживали инфекцию GPCMV и не использовались в опубликованных исследованиях. Трансформированные клетки HPV E6 / E7 поддерживали инфекцию GPCMV и широко применялись в исследованиях.

Исследования на животных морских свинок (Hartley) проводились при одобрении IACUC в Техасском университете A & M, разрешение 2013 № 013. Все процедуры исследования проводились в строгом соответствии с рекомендациями, содержащимися в «Руководстве по уходу и использованию лабораторных животных национальных институтов здоровья». Животных ежедневно наблюдали обученные сотрудники по уходу за животными, а животные, нуждающиеся в уходе, относились к посещение ветеринара для немедленного ухода или эвтаназии. Терминальная эвтаназия проводилась путем летальной передозировки СО2 с последующей дислокацией шейки матки в соответствии с протоколом IACUC и руководящими принципами NIH. Животные, приобретенные в лабораториях Charles River, были проверены как серонегативные для GPCMV с помощью кровотока с помощью гвоздя для ногтей и анти-GPCMV ELISA сывороток, как описано ранее [36].

Серонегативных животных случайным образом делят на три группы (n = 12 на группу): GP129FRT (группа 1); SG GPCMV (группа 2); и NRD13, BAC, полученный GPCMV (группа 3). Животных каждый инокулировали 106 pfu вируса через подкожную инъекцию (либо GP129FRT, SG GPCMV, либо NRD13, в зависимости от их конкретной группы). В различные моменты времени (4, 8, 12 и 27 дней после инфицирования) два человека на группу подвергали эвтаназии, а вирусную нагрузку в ткани-мишени (печень, легкие, селезенку, слюнные железы) и крови определяли с помощью ПЦР в реальном времени.

Серонегативным беременным плотинам было поставлено 106 pfu NRD13 (группа 1, n = 8) или GP129FRT (группа 2, n = 11) в позднем втором триместре через подкожную инокуляцию, и животным было позволено перейти к термину. Вирусную нагрузку в органах-мишенях (печени, легких, селезенки, мозга) живых или все еще рожденных щенков оценивали с помощью ПЦР в реальном времени. Кроме того, для исследований иммуногистохимии инфицированной плаценты одной беременной плотиной была поставлена ​​GP129FRT, как описано выше. Через 22 дня после заражения плотина была подвергнута эвтаназии и получена плацента для оценки вирусной инфекции путем иммуногистохимического окрашивания. Замороженную плаценту разделяли с использованием криостата (толщина 5 мкм). Секции фиксировали и анализировали на присутствие GPCMV с использованием мышиного анти-gB-антитела (29:29) и анти-мышиного IgG-набора ABC (Vectastain) по протоколу производителя.

Кровь и ткани (легкие, печень, селезенка) были собраны у эвтаназированных морских свинок для определения вирусной нагрузки. Для щенков от врожденных инфекционных исследований кровь и ткани (легкие, печень, селезенка, мозг) были собраны в течение 3 дней после рождения. Уплотненную специфическую плаценту собирали и сохраняли для экстракции ДНК, когда это применимо. Для экстракции ДНК ДНК FastPrep 24 (MP Biomedical) использовали для гомогенизации тканей в качестве гомогената массой 20% / объем в матрице Lysing Matrix D (MP Biomedicals). Для получения ДНК из цельной крови в каждую пробирку, содержащую антикоагулянт ACD и 200 мкл крови, в каждую экстракцию собирали 500 мкл крови (путем удаления носа клипа ногтя). ДНК экстрагировали с использованием QIAxtractor (Qiagen) в соответствии с инструкциями изготовителя (кровь) или протоколом ткани. Вирусную нагрузку определяли ПЦР в реальном времени на Lightcycler 480 (Roche Applied Science). Грунты и гидролизный зонд были разработаны с использованием программы Lightcycler Probe Design2 для амплификации продукта из GPCMV GP44 гена: прямой праймер 5’TCTCCACGGTGAAAGAGTTGT; Обратный праймер 5’GTGCTGTCGGACCACGATA; гидролиз 5’FAM-TCTTGCTCTGCAGGTGGACGA-BHQ1. ПЦР-мастер-смесь содержала Lightcycler Probes Master (Roche Life Science), 0,4 мкМ праймеров и 0,1 мкМ зонда, 0,4U урацила N-гликозилазы (UNG) в 25 мкл общего объема реакции, включая 10 мкл ДНК на реакцию. Стандартные элементы управления и элементы управления шаблонами (NTC) выполнялись с каждым анализом для количественной оценки. Параметры амплификации Lightcycler480 были: шаг UNG в течение 10 минут при 40 ° C с последующим включением при 95 ° C в течение 10 минут, затем 45 циклов денатурации при 95 ° C в течение 15 с, отжиг при 56 ° C в течение 15 с, удлинение при 72 ° C на 10 секунд. Данные были собраны «одним» приобретением во время этапа расширения. Стандартную кривую генерировали с использованием плазмиды GPCMV GP44 [33] для количественной оценки и чувствительности анализа. Чувствительность анализа была определена как 5 копий / реакция. Вирусная нагрузка выражалась как количество копий / мл крови или количество копий / мг ткани. Вычисленными результатами были среднее значение трехкратной последовательности ПЦР на образец.

Прогнозируемые последовательности кодирования GPCMV были основаны на полной последовательности вирусного генома 22122 (присоединение Genbank № AB592928.1). Конкретными координатами кодирующей последовательности гена являются: GP74, gO (117, 992-119, 104); GP75, gH, (119, 553-121, 724); GP115, gL, (180, 21-16-180, 992); GP128 (195,713-196,768); GP129 (196,745-197,003, 197,081-197,206, 197,285-197,439); GP131 (197,444-197,780, 197,861-198,102); GP133 (198,102-198485) и GP130 (196 968-197360). Генерация отдельных челночных векторов для специфического выщелачивания гена (или межгенная инсерция GP129) и построение векторов переходных экспрессий описаны более подробно ниже.

Для проведения систематического нокаута генов GPCMV (GP129, GP131 и GP133) синтетические последовательности генов были созданы с уникальными фланкирующими гомологичными областями для рекомбинации с последовательностью генома GPCMV, которая также вводила целенаправленную делецию большей части специфического гена интерес. Были синтезированы два синтетических челночных вектора pSYDGP129 / 131 (последовательность фланкирования GPCMV 197,041-197,291, 198,091-198,300) и pSYDGP133 (фланкирующая последовательность GPCMV 198,178-198,360, 198,490-198720) (DNA2.0) для нокаута GP129 и GP131 или GP133 соответственно. pSYDGP129 / 131 целенаправленное удаление нуклеотидов GPCMV 197,292-198090 (удаление 798 оснований). pSYDGP133 целенаправленное удаление нуклеотидов GPCMV 198 361-198 489 (138 базовых делеций). Транспортные векторы были спроектированы таким образом, чтобы нести сайт BamH I в удаленном локусе. Затем переносные векторы модифицировали путем введения кассеты канамицин / FRT [36] в уникальный сайт BamHI между левым и правым фланкирующими рычагами соответствующих челночных векторов для генерации pSYDGP129 / 131KmFRT и pSYDGP133KmFRT. Для нокаута GP128 полная кодирующая последовательность была амплифицирована ПЦР в виде фрагмента BamHI с набором праймеров GP128F и GP128R (таблица S1) и клонирована в pUC19 для генерации pUCGP128Bm. Канамина канамицин / FRT с фланкирующими сайтами EcoR V клонировали в уникальный сайт EcoR V в кодирующей последовательности GP128 для разрушения ORF на кодоне 176 (pGP128KmFRTEcV). На рисунке S1 показано расположение модификаций последовательности GPCMV в локусе GP128-GP133.

Для эктопической экспрессии GP129myc ORF помещали под контроль промотора SV40, генерировали челночный вектор, который вводил кассету в межгенный локус между GP25 и GP26. Этот локус был выбран, так как оба гена соприкасаются в этом локусе с противоположных направлений, и введение в этот интергенный локус ранее не оказывало влияния на кинетику роста вируса [25]. Сначала локус GP25 / GP26 (GPCMV (штамм 22122) 37,672-38,953) был амплифицирован ПЦР в виде фрагмента EcoR I-Hind III, частично кодирующего GP25 и GP26 с использованием праймеров FGP25 и RGP26 (таблица S1) и клонированных в pUC19 в виде EcoR I / Hind III для генерации pUCGP25 / GP26 (S11 Fig). Затем промотор SV40-промотора / SV40 polyA-последовательности из pSI (Promega) выделяли в виде фрагмента Bgl II / BamH I и клонировали в уникальный сайт BamHI (штамм GPCMV 22122, положение 38538 оснований) в межгенном локусе между GP25 (смысловая цепь ) и GP26 (комплементарные нити) в линеаризованном pUCGP25 / GP26 для генерации pSIGP25 / GP26. Синтетический интрон удаляли из челночного вектора путем коллапса Pst I / Sal I полилинкера и вставки линкерной последовательности 50 б.п. (ссылка 1, см. Таблицу S1) для получения pGP25 / 26Link1, который теперь имел уникальные сайты Bgl II и BamH I. Фрагмент BamH I GP129myc клонировали в Bgl II pGP2526Link1 для генерации pGP129Link1. Затем кассету BamH I Km [36], фланкированную сайтами FRT, клонировали в pGP129link, разрезанный BamH I, для получения pGP129limkKmFRT, который был последним ретрансляционным челночным вектором, экспрессирующим GP129. Нуклеотидная последовательность локуса GP25 / GP26 и стратегия клонирования для генерации рекомбинационного шаттл-вектора и модификаций локусов показаны на S10 Fig и S11 Fig.

GH (GP75), gL (GP115) и gO ​​(GP74) ORF дополнительно клонировали отдельно в векторы экспрессии, которые также маркировали С-концевой домен для легкого обнаружения рекомбинантного белка в трансфецированных клетках. Для GFP с меткой gH ORF GP75 (отсутствующий стоп-кодон) была амплифицирована ПЦР в виде фрагмента BamH I с использованием праймеров FgHBm и RgHBmNostop (таблица S1) и клонированного интерферона в вектор экспрессии гена GFP pAcGFP-N1 (Clontech), разрезанный с помощью BamH I. Это ввело тег GFP в кадр в C-терминальный домен gH ORF и поместил GP75 под контролем промотора HMM HCMV. Эта модифицированная плазмида была обозначена как pAcGFPNgH. Для mKherry tagged gL ORF GP115 (отсутствующий стоп-кодон) была амплифицирована ПЦР в виде фрагмента Hind III с использованием праймеров FgLHd и RgLHdNostop (таблица S1) и клонированного интерферона в экспрессирующий вектор mCherry слияния pmCherry-N1 (Clontech), разрезанный с Hind III. Это ввело метку mCherry в кадр в C-терминальный домен gL ORF и поместило GP115 под контролем промотора HCMV MIE. Эту модифицированную плазмиду обозначали pmCherryNgL. Вектор с меткой GP128 FLAG генерировали с помощью ПЦР, используя набор праймеров GP128F и GP128R (таблица S1), клонированный как фрагмент BamH I в pCMV3Tag (технология Agilent). PCR GP128 ORF не содержала стоп-кодон и клонированное клонирование сайта BamH I, которое вводило тэг 3xFLAG в C-конец GP128 (pFLAGGP128).

В качестве синтетических генов (DNA2.0 Inc.) на основе определенной кодирующей последовательности GenBank: KC503762.1 генерировались C-концевые эпитопы с метками версий GP129 (3xmyc), GP131 (3xHA), GP133 (3xFLAG) и GP130 (3xFLAG) кДНК. AB592928.1 и клонировали под контролем промотора MMS HCMV в векторе высокой плотности плазмиды (pJ603, DNA2.0 Inc).

Синтетический ORF GP129 был сгенерирован для естественного усеченного C-концевого мутанта NRD13 (кодон 102-179 удален). Также был сгенерирован химерный гибридный мутант GP129 / UL128 HCMV, который кодировал терминальные 48 кодонов HCMV (штамм Мерлина) UL128 вместо кодонов 128-179 GP129. Оба мутанта GP129 были отмечены myc.

Индуцируемую систему рекомбинации ET (GeneBridges) вводили в бактериальные клетки DH10B, содержащие плазмиду второго поколения GPCMV BAC [26, 27], используя ранее описанный протокол [32]. Отдельные выходы гена GPCMV, нацеленные на челночные векторы, линеаризировали с помощью уникального рестрикционного фермента, вырезающего вне фланкирующей последовательности гена-мишени. Линеаризованные ДНК-плазмиды или ПЦР-продукты были выделены полосками и были модифицированы концентрации ДНК, чтобы ввести 1 мкг линейной ДНК в каждую реакцию трансформации посредством электропорации [32]. Рекомбинантные бактериальные колонии мутантов GPCMV BAC были выделены путем выбора хлорамфеникола (12,5 мкг / мл) и выбора канамицина (20 мкг / мл) в бактериальных чашках Петри LB-агара. Бактериальные планшеты сначала инкубировали при 39 ° С для удаления плазмиды рекомбинации ts ET (Genebridges). ДНК мутантного GPCMV BAC очищали с помощью набора максипрепа (Qiagen) и анализировали отдельными рестрикционными расщеплениями EcoR I и Hind III для проверки точности предсказанной конфигурации генома после мутации [26, 27]. Вставка кассеты резистентной резистентности к канамицину (Km) в вирусный геном вводила новый сайт рестрикционного фермента Hind III в месте мутации, чтобы обеспечить проверку модификации локуса. Специфические модификации генов были подтверждены сравнительным ПЦР-анализом между БАК BAT и мутантными GPCMV с использованием общих фланкирующих праймеров. Вывод гена для мутантов далее проверяли путем секвенирования продукта ПЦР. Чтобы включить второй раунд мутагенеза GPCMV BAC, оригинальную кассету Km, вставленную в геном, удалили с помощью стратегии рекомбиназы FLP, если кассета Km была фланкирована сайтами FRT. Рекомбинацию FLP осуществляли путем трансформации BAC-положительных бактерий с экспрессией FLP-экспрессирующей суицидной плазмидой (p707, GeneBridges) (разрешающие условия с тетрациклином (3 мкг / мл) при 31 ° C) и индукцией рекомбиназы и удалением кассеты FRTKm, выполненной по протоколу производителя , Затем второй цикл рекомбинации можно было бы провести на ВАС GPCMV, как описано выше.

Гены GPCMV GP128, GP129, GP131 и GP133 были индивидуально удалены путем целевого мутагенеза ВАК GPCMV в бактериях с использованием челночных векторов, несущих маркер устойчивости к лекарственным средствам Km, чтобы нарушить каждую ORF. Целевой рекомбинационный нокаут генов GPCMV был выполнен во втором поколении GPCMV BAC [27]. На рисунке 1 показана компоновка локуса GP128-133. На фиг. 5 показана аннотированная нуклеотидная последовательность локуса GP128-133 с расположением генов, затененных, и конкретные делеции, введенные для указанных GP129-GP131 или GP133. Мутант GP129 / GP131 генерировали с помощью введения BamHI FRT Km между фланкирующей последовательностью на челноке синтетического удаления pSYDGP129 / 131, который удалял нуклеотиды GPCMV 197,292-198,090 (удаление 798 bp в кодирующей последовательности GP129-GP131, см. S1 рис.). Мутант GP133 генерировался введением BamH I FRT Km между фланкирующей последовательностью на челночном векторе синтетической делеции pSYDGP133, который удалял нуклеотиды GPCMV 198 361-198 489 (138 базовых делеций, которые включали стартовый кодон GP133 (S1 Fig). Ген GP128 был модифицирован путем введения кассеты EcoR V FRT Km на уникальном сайте EcoR V (нуклеотид GPCMV 196,234) в гене GP128 челночного вектора GP128 (pGP128KmFRTEcV), который нарушил ORF GP128 у кодона 176. Мутантные GPCMV BAC анализировали с помощью ограничения анализ ферментного профиля, как описано ранее [36]. Вставка кассеты резистентной резистентности КМ в вирусный геном вводила новый сайт рестрикционного фермента Hind III в месте мутации, чтобы обеспечить проверку модификации локуса. Модифицированные геномы GPCMV анализировали отдельно EcoR I и анализ профиля рестрикционного фермента Hind III. Чтобы ограничить избыточность, профили, показанные для каждого мутанта, представляют собой анализ Hind III или EcoR I. Добавление один друг, два клоновых мутанта были созданы для каждого нокаута, но описывается только один. Сравнительные профили рестрикционных фрагментов генома генома дикого типа и мутантного генома GPCMV правильно продемонстрировали специфическую модификацию субгеномного фрагмента для всех мутантов. Назначенная номенклатура полос рестрикционных фрагментов GPCMV, описанная Гао и Изомом [111], использовалась для определения специфических сдвигов полосы, за исключением того, что терминальные терминалы 5 ‘и 3’ были связаны в ковалентном замкнутом круге [26]. S12 На фиг. Показан профиль мутантного профиля EcoR I GP128 и профили Hind III для мутантов GP129-131 и GP133 по сравнению с профилями BAC GPCMV. Специфические модификации локуса гена были дополнительно проверены методом ПЦР-анализа и секвенирования, как описано ранее [36]. Ген GP128, кодированный геномным фрагментом EcoR I GPCMV 4,9 т.п.н. (192, 215-197, 167), был модифицирован мутантом GP128 путем введения кассеты с диаметром 1,1 кбит, который сдвинул фрагмент до 6 кб (S12 Рис.). Гены GP129, GP131 и GP133 кодируются в геномном фрагменте Hind III GPCMV 19,7 kb, и целенаправленный нокаут этих генов вводит новый сайт Hind III, закодированный во вставленном марке Km. Мутантный фрагмент Hind III GP129-GP131 был модифицирован от 19,7 до 5 кб и приблизительно 15 кб (S12 Рис.). В мутанте делеции GP133 геномный фрагмент Hind III GPCMV 19,7 kb был модифицирован до 6 kb и 14,9 kb фрагментов (S12 Fig).

Мутантные GPCMV BAC были независимо подвергнуты дополнительному циклу мутагенеза, чтобы ввести кДНК GP129 (myc tagged) дикого типа в интергенный локус GP25 / 26 под контролем промотора SV40, как описано в предыдущем разделе для эктопической экспрессии GP129. Это потребовало удаления кассеты Km FRT из первоначально мутированного локуса рекомбиназой Flp, как описано (см. Выше раздел). Иссечение кассеты Km было подтверждено путем исправления колоний для устойчивости к резистентности к потерям и целостности ВАХ GPCMV, подтвержденной анализом профиля рестрикции (S12 Fig.). GPCMV BAC сохраняли сайт FRT в исходном месте удаления. E.coli (DH10B), несущие соответствующие мутанты GPCMV BAC, подвергали индукции рекомбинации ET и целенаправленной модификации с помощью челночного вектора pGP129limkKmFRT, как описано выше. Мутанты локуса GP25 / GP26 (несущие кДНК GP129myc) выделяли с помощью введения маркера Km, как описано выше. Клоны полной длины GPCMV BAC идентифицировали с помощью анализа профиля рестрикции EcoR I (S12 Fig) и затем подтверждали с помощью ПЦР локуса GP25 / GP26 и секвенирования (S11 Fig). Мутанты, несущие кДНК GP129 в локусе GP25 / GP26, были обозначены: (1) GP129FRT (wc GPCMV BAC); (2) GP128FRT / GP129Link (мутант GP128); (3) GP129-GP131FRT / GP129Link (мутант делеции GP129-GP131); (4) GP133FRT / GP129Link (мутант делеции GP133). Что касается эктопической вставки кДНК GP129 в межгенный локус GP25 / GP26, модификация генерировала характерный измененный профиль GPCMV EcoR I. Геномный фрагмент GPCMV EcoR I 5,2 т.п.н. (нуклеотиды 35 537-40 739), содержащий локус GP25 / GP26, был модифицирован путем введения промотора SV40-промотора / GP129-полимеразы / SV40 polyA-последовательности и маркера Km в сайт Bam H I (нуклеотид 38538). Модифицированная последовательность также представила два новых сайта EcoR I. Как и было предсказано, исходный геномный фрагмент 5,2 кб был модифицирован до двух новых фрагментов (3,5 и 3,9 т.п.н.). S12 На рисунке показаны модифицированные профили для мутантов GPCMV, GP128 и GP129-131 (GP128FRT / GP129Link и GP129-GP131FRT / GP129Link соответственно), но не мутант GP133 для ограничения избыточности. Дополнительный мутант GPCMV BAC был сконструирован в GPAC GP129FRT GPCMV, который вводил кассету Km в ген GP74 (гликопротеин gO), как описано ранее [36]. Это сгенерировало мутант GPCMV BAC, который кодировал кДНК GP129 в локусе GP25 / 26 (Km заменен только сайтами FRT) и нокаут GP74 путем введения кассеты Km, которая нарушила ORF на кодоне 110 [36] (двойной мутант был обозначен GP129FRT / GP74Km). Мутация GP74 была подтверждена профильным анализом EcoR I генома GPCMV BAC. Исходный 18 kb EcoR I геномный фрагмент (нуклеотиды 102,796-120,821), который кодировал локус GP74, был увеличен в размере на 1,1 т.п.н. путем введения кассеты Km, которая изменила размер фрагмента до 19,1 kb, см. S12 Рис.

Мутант нокаута gB (GP55) был сгенерирован на фоне GPAC GPK9FRT GPCMV. Ген GP55 (94,164-96,869) был выбит путем введения кассеты Km, которая нарушила ORF на кодоне 528, как описано ранее [36]. Вставка кассеты Km модифицировала размер подгоночного фрагмента 4470 EcoR I (91, 190-95, 659) примерно на 1 кб, создавая новый рестрикционный фрагмент EcoR I приблизительно 5,5 кб на профиле GPC9FRT / GP55km GPCMV BAC EcoR I. Положения рестрикционных фрагментов дикого типа и мутанта EcoR I указаны в S12 (vii).

Для получения рекомбинантных вирусов крупномасштабная ДНК GPCMV BAC очищалась от штамма DH10B E. coli с использованием набора макси-плазмид (Qiagen). ДНК BAC трансфицировали на клетки GPL в шести луночных планшетах с использованием Lipofectamine 2000 (Invitrogen), как описано ранее [33]. Трансфекции GPCMV BAC проводили с двумя независимыми клонами для каждого нокаута гена. Для образования вирусных бляшек в течение по крайней мере 3-4 недель проводили трансфекции. Посредством микроскопии были обнаружены положительные вирусные бляшки GFP [33]. Неинфекционные мутанты продуцировали только отдельные положительные клетки GFP, которые не прогрессировали до вирусных бляшек. GPCMV мутантные BAC-трансфекции выполнялись несколько раз (минимум 6 раз) для каждого клона. Иссечение плазмиды BAC из рекомбинантного вирусного генома осуществляли путем совместной трансфекции ДНК BAC с плазмидой, кодирующей рекомбиназу CRE (pCRE), щедрым подарком от доктора Майка Маквоя (Университет штата Вирджиния). Вырезанный вирус BAC также потерял кассету-репортер GFP, закодированную на плазмиде BAC, и поэтому отрицательные бляшки GFP подтвердили успешное удаление плазмиды BAC. Крупномасштабные вирусные запасы были получены, как описано ранее [33], и дополнительно эпитропные вирусы были получены в виде запасов вируса на эпителиальных клетках в соответствии с той же процедурой. Аварийный вирус gB с нокаутом (GP129FRT / GP55km) был получен путем совместной трансфекции BAC GP129FRT / GP55km с помощью спасательной плазмиды GP55, как описано ранее [36].

Рекомбинантные дефектные аденовирусы (серотип 5), кодирующие отдельные эпитопные меченые компоненты пентамерного комплекса, были получены в виде высокотермитных запасов Welgen Inc. на клетках HEK293. C-концевые эпитопы, меченные ORF из плазмид pAcGFPNgH, pmCherryNgL, pGP129myc, pGP131HA, pGP133FLAG, были помещены под контролем промотора энхансера HCMV MIE в локус E1 дефектных векторов Ad с использованием вектора челночного E1 (Welgen Inc.) для генерации рекомбинантного дефектного аденовирусы, обозначенные AdgHGFP, AdgLmCherry, AdGP129myc, AdGP131HA, AdGP133FLAG соответственно. Дефектная векторная кодировка GFP (AdGFP) также использовалась в исследованиях контрольных выражений [36].

Образцы временной точки отбирали из GPL-клеток, инфицированных GPCMV дикого типа, в 6-луночном планшете (moi = 1 pfu / cell) при 48-часовой пост-инфекции. RT-PCR выполняли, по существу, как описано в Coleman et al. [36]. Исходя из первоначального анализа локуса GP128-133 полной длины [28, 87], существует пять генов, обозначенных GP128, GP129, GP130, GP131 и GP133. На основе колинейности с HCMV, а также кодированных белков два из этих генов являются прямыми гомологами HCMV UL128 (GP129) и UL130 (GP131) [28]. GP133 имеет слабую гомологию с UL131 [90]. Экспрессия гена в локусе GP128-133 на поздней стадии заражения SG GPCMV была исследована методом RT-PCR, как описано ранее [36], используя следующие пары праймеров: RTGP128F / RTGP128R; RTGP129F / RTGP129R; RTGP130F / RTGP130R; RTGP131F / RTGP131R; RTGP133F / RTGP133R и управлять GAPDH (GAPDHRTF / GAPDHRTR), как описано в таблице S1. Результаты показали, что ранее идентифицированные гены были все выражены в клетках, инфицированных SG GPCMV (S2 ​​Fig).

Анализы иммунопреципитации (IP) проводили на трансфицированных или рекомбинантных трансформированных плазмид клетках фибробластов с использованием коммерческого реагента GFP-ловушки (ChromoTek) или RFP-ловушку (ChromoTek) в соответствии с протоколами производителя и включении коктейля ингибитора протеазы (Pierce) в клеточные лизаты. Образцы затем анализировали с помощью SDS-PAGE (4-20% градиентного геля) и вестерн-блоттинга с использованием специфических антител к антителам против эпитопа: HA (Novus Biologicals); FLAG (Novus Biological); GFP (Santa Cruz Biotechnology); Myc-c (Novus Biologicals); и mCherry (Clontech Laboratories). Соответствующий вторичный конъюгат против мышиного или антикробидного HRP (технология клеточной сигнализации) также применяли в соответствии со стандартным вестерн-блот-протоколом, как описано ранее [36].

Пользовательские антитела к GPCMV gH, IE2 и GP131 были получены Genescript для специфических пептидных последовательностей (поликлональный кролик) или очищенного рекомбинантного (E.coli) белка (мышиного моноклонального). Кроличьи поликлональные антитела были раздельно выращены против gH и IE2 с использованием пептидного иммуногена RTDLSSPTEELTSP (для gH) или CRKTRPAKRPRSNDE (для IE2). Моноклональное антитело мыши к GP131 генерировалось против рекомбинантного очищенного белка и гибридомного антитела, скринированного на активность с GP131. Кролик или мышиный IgG очищали колонкой и ресуспендировали в концентрации 100 мкг / мл. Специфичность антитела проверяли как вестерн-блоттингом, так и методом иммунофлуоресценции транзиторно экспрессируемых белков (gH, IE2 или GP131) в клетках фибробластов / эпителия с использованием подходящих векторов экспрессии плазмиды для gH, IE2 или GP131 в соответствии со стандартными протоколами [36].

Эпителиальные клетки или фибробластные клетки GPL на покровных стеклах с шестью лунками предварительно обрабатывали полной средой, содержащей 0 или 50 нМ бафиломицин A1 (Sigma) в течение 1 часа при 37 ° C с последующей вирусной инфекцией с использованием вируса FRTGP129 (MOI = 1pfu / cell) в течение 1 часа при 37 ° C. Все дальнейшие инкубации проводили при той же концентрации, что и предварительная обработка в полной среде. Клетки фиксировали при 24-часовой после инфекции в 100% метаноле при -20 ° С и иммунизировали для белка IE2 и цитокератина, как описано в материалах и методах. Графы были сделаны из положительных клеток IE2 в случайных полях. Статистический анализ проводили с использованием студенческого Т-теста на процент клеток, инфицированных в тридцати случайных полях зрения, каждый из которых содержал ~ 100 клеточных ядер для каждого состояния. Количество инфицированных инфицированных клеток было представлено в виде процента от числа инфицированных необработанных клеток. Результаты, показанные на S15 Рис.

В исследованиях патогенности вирусная нагрузка в подобной органной ткани от инфицированных GPCMV животных в течение специфических дней после инфицирования сравнивалась по t-критерию Стьюдента (GP129FRT против SG GPCMV и GP129FRT против NRD13). В врожденных исследованиях результат щенка и скорость передачи сравнивались с точным тестом Фишера. Вирусную нагрузку GPCMV в конкретных целевых органах щенков сравнивали по t-критерию Стьюдента. Все сравнения были двухсторонними. Анализ t-теста у студентов также проводился для вирусной инфекции клеток в исследованиях на входе в клетки bafilomycin virus (S15 Fig).

(DOCX)

Щелкните здесь для получения дополнительных данных.

(DOCX)

Щелкните здесь для получения дополнительных данных.

GPCMV GP128-134 на основе GenBank Accession # AB592928.1. Координаты нуклеотидов GPCMV указаны в скобках. GP128 (195,713-196,768) выделены синим цветом; GP129 (196 745-197 439 дополнений) выделены зеленым цветом; GP131 (197,444-198,102), выделенные оранжевым цветом; GP133 (198,102-198,485), выделенные желтым GP134 (198 579-199,262 дополн.), Выделены серым цветом. Праймеры P1 / P2 (таблица S1), используемые для проверки неповрежденной или удаленной области GP129-133, выделены полужирным шрифтом черного цвета. Удаленная область (1,6 т.п.н.) лабораторно адаптированного вируса подчеркнута (196,925-198557). Удаление последовательности для мутантного GP129-GP131 (197,292-198,090) начальная и конечная последовательность удаления, обозначенные квадратом (□). Удаление последовательности для GP133-мутанта (198 361-198 489) начальная и конечная последовательности, обозначенные кружком (○). Для мутантного GP128 сайт EcoR V (196,234-196,239) в GP128 был местом вставки кассеты Km (GATATC), которая нарушила ORF.

(TIF)

Щелкните здесь для получения дополнительных данных.

Индивидуальные наборы праймеров RT-PCR (см. Материал и методы и таблица S1) были разработаны для GP128, GP129, GP130, GP131 и GP133 на основе определенных последовательностей. RT-ПЦР выполняли, как описано ранее [36]. Продукты RT-PCR анализировали электрофорезом в агарозном геле. Дорожки: 1-3, GP128; 4-6 GP129; 8-10 GP130; 11-13, GP131. Lanes 1, 4, 8, 11 и 16 SG GPCMV инфицированных клеток. Lanes 2, 5, 9, 12 и 17 mock инфицированных клеток (контроль). Дорожки 3, 5, 9, 12 и 18 не контролируют РНК. Лестницы 7,14 и 15,100 б.п. лестницы (NEB).

(TIF)

Щелкните здесь для получения дополнительных данных.

(я). GPL фибробласт против эпителиального клеточного вестерн-блота для цитокератина 18. Клеточные лизаты из ~ 1 × 106 клеток GPL и EPI анализировали с помощью вестерн-блоттинга с использованием 4-20% SDS-PAGE-геля и зондировали с помощью мышиного mAb против кератина 18 (DC10) (Cell Signaling ) и вторичный конъюгат против мышиного IgG-HRP. (II). Иммунофлуоресценция для экспрессии цитокератина в клетках EPI. Монослои EPI (изображения A, B & C) и GPL (изображения D, E & F) клетки иммуноокрашивали с использованием mAb (кетонов) канадского (C11) мыши (изображения A и D), как описано в материалах и методах. Клетки также окрашивали высокоаффинным зондом F-актина, антифаллоид-Alexa Fluor 568 (ThermoFisher Scientific) (изображения B и E). Клетки контрастировали с DAPI (объединенные изображения C и F). Изображения снимали при 40X с использованием конфокального микроскопа Olympus IX81.

(TIF)

Щелкните здесь для получения дополнительных данных.

Клетки EPI и GPL инфицировали в moi 1 pfu / cell. Через 48 часов после инфицирования клетки фиксировали и окрашивали для вирусных (IE2) и маркеров эпителиальных клеток, как описано в материалах и методах. Иммунофлуоресцентные изображения клеток EPI: A, IE2; B, панкератин; C, объединены A и B с окрашиванием DAPI. Иммунофлуоресцентные изображения клеток GPL: D, IE2; E, пан-кератин; F, объединили E и F с окрашиванием DAPI. Изображения при x60 магизации.

(TIF)

Щелкните здесь для получения дополнительных данных.

(i) Компоненты пентамерного комплекса (gH, gL. GP129, GP131 и GP133) были индивидуально клонированы как C-концевые эпитопы с мечеными ORF в рекомбинантные дефектные переносчики аденовирусного вируса и рекомбинантные вирусы, генерируемые для каждого компонента. Гены выражали в экспрессии HCMV MIE, как показано. Прогнозируемый кодированный белок указывается для каждой конструкции. (ii) Сокалокация сотовых клеток пентамерных комплексных компонентов в эпителиальных клетках морских свинок в отсутствие других белков GPCMV. ЭПВ-клетки трансдуцировали с дефектными рекомбинантными конструкциями Ad (П) из пентамерного комплекса, как описано в материалах и способах. gH, обнаруженной при флуоресценции (gHGFP). gHGFP (панели A, E и I), gL-экспрессия, обнаруженная при флуоресценции (gLmCherry). gLmCherry (панели B, F и J). GP129myc локализация с использованием иммунофлуоресцентного анти-myc антитела / Cy5 (панель C). GP131HA с использованием анти-HA-антитела / Cy5 (G). GP133FLAG с использованием анти-FLAG-антитела / Cy5 (K). Панель D (объединенная A, B & C) для gH, gL и GP129, панель H (объединенная E, F & G) для gH, gL и GP131. Панель L (объединенная I, J & K) для gH, gL и GP133. Объединенные изображения также контрастируют с DAPI.

(TIF)

Щелкните здесь для получения дополнительных данных.

Преходящую экспрессию GP129, GP131 и GP133 оценивали в присутствии или отсутствии лечения туникамицином. Отдельные 6-луночные планшеты эпителиальных клеток трансдуцировали рекомбинантными векторами Ad, кодирующими GP129, GP131 или GP133. Экспрессия происходила в присутствии или отсутствии туникамицина, как описано выше (36). После экспрессии в течение ночи монослои либо собирали для анализа вестерн-блоттинга (A-C), либо фиксировали для иммунофлуоресцентного анализа (D-I). Вестерн-блот-анализы (A-C). Дорожки: 1, 4 и 7 ложных инфицированных клеток; 2 и 3 клетки, трансдуцированные AdGP129myc; 5 и 6 AdGP131HA; 8 и 9 AdGP133FLAG. Дорожки 3, 6 и 9 представляют клетки, обработанные туникамицином. Иммунофлуоресцентные анализы: D и G, AdGP129myc; E и H, AdGP131; F и I, AdGP133FLAG. Туникамицин обработанные монослои (G, H и I). Для анализов вестернов и иммунофлюоресценции обнаружение белка с меченым эпитопом проводили, как описано в материалах и методах с использованием соответствующих первичных антител мыши (анти-мик, анти-НА или анти-FLAG).

(TIF)

Щелкните здесь для получения дополнительных данных.

GPCMV PC IP через ловушку RFP, направленную на gLmCherry. (i) — (ii) Вестерн-блот-анализ иммунопреципитированного ПК GPCMV. Иммунопреципитация через ловушку RFP, направленную на gLmCherry в клетках, трансдуцированных дефектными рекомбинантными Ad-векторами для всех компонентов ПК, как описано в материалах и методах. Иммунопреципитированные белки, обнаруженные вестерн-блоттингом с использованием эпитоп-специфических антител. Дорожки: 1-4, анти-GFP для gH; 5-7, anti mCherry для gL; 8-11, анти-MYC для GP129 12-14, анти-HA для GP131; 15-17, анти-FLAG для GP133. Дорожки 2, 5, 9 12 и 16 представляют собой полный клеточный лизат. Дорожки 4, 7, 11 14 и 17 являются иммунопреципитацией. Дорожки 3, 6, 10 13 и 16 — промывка после связывания. Дорожки 1 и 8 представляют собой ложные данные об общем количестве лизатов клеток. (iii) — (iv) Контроль IP пентамерного комплекса в отсутствие gLmCherry с замещенным контролем mCherry в присутствии gH, GP129, GP131, GP133. Управляющие IP-вестерн-блот-полосы: 1-4, анти-GFP; 5-7, anti-mCherry (для mCherry); 8-11, анти-MYC; 12-14, анти-НА; 15-17, анти-FLAG. Полный клеточный лизат (дорожки 2, 5, 9, 12 и 15). Поток промывочного связывания (полосы 3, 6, 10, 13, 16). Утечка иммунопреципитации (дорожки 4, 7, 11, 14 и 17). Моноклитированный общий лизат клеток (дорожки 1 и 8).

(TIF)

Щелкните здесь для получения дополнительных данных.

Выравнивание BLAST (MacVector) C-концевых областей мутанта GP129 (NRD13 и GP129UL128) в соответствии с предсказанной аминокислотной последовательностью GP129 дикого типа. NRD13 представляет собой естественно выбранную мутацию GP129, обнаруженную во втором поколении GPCMV BAC GP129UL128, является мутантом делеции C-конца, который кодирует 48 кодонов из C-конца UL128 HCMV (Merlin).

(TIF)

Щелкните здесь для получения дополнительных данных.

GP129, GP131, GP133 и gO ​​оценивали на способность образовывать триплексные комплексы с gH и gL. Переходная экспрессия эпителиальных клеток с gHGFP, gLmCherry, GP129myc, GP131HA и GP133FLAG была такой же, как описано в материалах и методах. Оценка образования триплексов осуществлялась путем клекальной колокализации или методом иммунопреципитации ловушки GFP (см. Рис. 3). На этом рисунке показаны полноразмерные вестерн-блоты результатов на рис. 3. Вестерн-блотты триплексных иммунопреципитаций: (E) gHGFP / gLmCherry / GP129myc; (J) gHGFP / gLmCherry / GP131HA триплекс; (O) gHGFP / gLmCherry / GP133FLAG триплекс; (T) gHGFP / gLmCherry / gOFLAG триплекс. Дорожки: 1, 4 и 7 общий лизат клеток; 2, 5 и 8 промывают поток; 3, 6 и 9 иммунопреципитация. Определенные белки, определенные в скобках под каждым пятном. Обнаружение с помощью соответствующего первичного антитела: gHGFP (анти-GFP); gLmCherry (anti-mCherry); GP129myc (анти-myc); GP131 (анти-НА); GP133 (анти-FLAG).

(TIF)

Щелкните здесь для получения дополнительных данных.

GPCMV GP25-26 последовательностей на основе GenBank Accession # AB592928.1. GP25 фланкирующая последовательность (желтый); GP26 фланкирующая последовательность (зеленый). Уникальный сайт BamH I (полужирный / синий) для сайта SV40 promoter / SV40 polyA. Стоп-коды для GP25 и GP26 находятся в красном тексте.

(TIF)

Щелкните здесь для получения дополнительных данных.

(i) Расположение локуса GP26 / GP26 в карте генома GPCMV Hind III. Увеличенная область показывает область GP25 / GP26, амплифицированную с помощью ПЦР (координаты генома 37,672-38953) с использованием праймеров GP25 / GP26 (таблица S1) и клонированных в pUC19 в виде фрагмента EcoRI / HindIII размером 1,3 т.п.н. для генерации pUCGP25 / 26. Сайт BamHI в межгенном сайте был дополнительно модифицирован. (ii) Для создания pSIGP25 / 26 (1) была вставлена ​​промотор SV40 / полиА-кассета. Затем кДНК GP129myc клонировали под контролем SV40 для получения pGP129Link1 (2). Затем была создана кассета КМ после последовательности полиаварии SV40 для генерации pGP129LinkKmFRT (3). Этот челночный вектор использовали для рекомбинации с ВАС GPCMV, как описано в материалах и методах. Модифицированный локус GP25 / GP26 в геноме GPCMV BAC можно было идентифицировать с помощью ПЦР (3,7 т.п.н. PCR). Локус GPCMV BAC можно дополнительно модифицировать, чтобы удалить кассету Km с помощью рекомбиназы FLP (4). (iii) ПЦР-анализ различных мутантов GPC GPCMV, описанных на S12 Fig, с измененным локусом GP25 / GP26. ПЦР-анализ с праймерами GP25 / GP26 (таблица S1). Продукты ПЦР анализировали электрофорезом в агарозном геле. Дорожки: 1) лестница kb (NEB); 2) NRD13 (вес локуса GP25 / GP26); 3) модифицированный локус NRD13, кодирующий GP129 и Km (см. Диаграмму 3, раздел (ii) S11 Fig); 4) модифицированный локус NRD13, кодирующий GP129 с Km вырезанным (см. Диаграмму 4, раздел (ii). BAC и вирус, генерируемый GP129FRT; 5) мутант GP128; 6) мутант GP131; 7) мутант GP133; 8) GP129FRT / GP74Km; 9) GP129FRT / GP55Km.

(TIF)

Щелкните здесь для получения дополнительных данных.

Дикий тип GPCMV BAC был мутирован для генерации серии мутантов GP128-GP133. По меньшей мере два независимых мутанта анализировали на один нокаут гена, но только один мутант показан на рисунке. Для каждого мутанта были проведены анализ профиля рестрикции EcoR I (Ec) и Hind III (Hd), но для каждого мутанта для уменьшения повторения показан только один профиль. Специфические сдвиги полосы обозначены как исходная группа дикого типа (желтый) и модифицированная мутантная полоса (красный). (i) — (iii) профили рестрикции отдельных мутантов. Дорожки: 1, мутант; 2, BAC типа GPCMV дикого типа. Профили: (i) GP128Km; (ii) GP129-131Km; (iii) GP133Km. (iv) — (v) Профиль рестрикции двойного мутанта GP128FRT / GP129LinkKm (iv) и GP129-131FRT / GP129LinkKm (v). Двойные мутанты содержат дополнительную модификацию с эктопической вставкой кДНК GP129myc в межгенный локус GP25 / GP26. Профили по сравнению с GPC дикого типа GPCMV или GP129FRTKm GPCMV BAC (вставка GP129 в локус GP25 / GP26). Профили BAC. Дорожки: 1, двойной мутант; 2, GP129FRTKm; 3, GPCMV дикого типа. Модифицированный локус GP25 / GP26 показан. (vi) Генерация мутантного нокаута GP74 на положительном фоне GP129. Профиль ограничения NBGP129FRT / GP74Km (дорожка 1) по сравнению с BAC дикого типа GPCMV (дорожка 2). Указан измененный локус GP74. (vii) Генерация мутантного GP55 на положительном фоне GP129. GPCMV BAC Анализ профиля EcoRI: Дорожки: 1, GP129FRT / GP55km; 2, GP129FRT; 3, NRD13 (исходный BAC). Отображена группа дикого типа (желтая точка) и измененная полоса (красная точка).

(TIF)

Щелкните здесь для получения дополнительных данных.

(i) Кривая роста различных GPCMV GP128-GP133-мутантов на клетках GPL. Moi на мутантный вирус составлял 1 pfu / cell. Образцы, взятые через 1-10 дней после заражения, и титровали в двух экземплярах на клетках GPL, как описано в материалах и методах. GPCMV GP128-133 мутанты локуса: мутант GP128 (GP128FRT / GP129Link); GP133-мутант (GP133FRT / GP129Link); GP131-мутант (GP131FRT / GP129Link); Мутант GP129 (NRD13). (ii) Сравнительный рост мутантов GP131 и GP133 на клетках GPL и EPI. GPL (панели A и C) и EPI (панели B и D) были инфицированы в moi 1pfu / cell соответствующими мутантными вирусами: GP133-мутант, панели A & B; GP131, группы C & D. Рост вируса на клетках, оцененный приблизительно через 3 дня после заражения для экспрессии генов-репортерного GFP и счетчик клеток, окрашенных для клеточных ядер с DAPI. Исследование кривых роста, проведенное с использованием обработанных КК BAC вырезанных вирусных запасов и исследований флуоресценции вируса GFP (ii), проведенных с запасами вируса GFP + non cre exciced.

(TIF)

Щелкните здесь для получения дополнительных данных.

PC + / gO + / gB отрицательный мутант GPCMV BAC (GP129FRT / GP55Km), трансфецированный на эпителиальные клетки, не смог вызвать инфекционный вирус (A). Одиночные трансфецированные клетки, идентифицированные экспрессией генов-репортеров GFP; gB спасение (спасение GP129FRT / GP55Km). Мутант gB BAC (GP129FRT / GP55km) был совместно трансфицирован на клетки GPL с фрагментом спасения GP55 для восстановления эпителиального тропизма. Распространение вируса, обнаруженное экспрессией GFP-репортерного гена на 12-й день после восстановления трансфекции (B).

(TIF)

Щелкните здесь для получения дополнительных данных.

Клетки EPI или GPL не обрабатывали или предварительно обрабатывали 50 нМ бафиломицином A1 в течение 1 часа до инфицирования GPCMVGP129FRT (MOI = 1pfu / cell). (i) Вирусная инфекция клеток EPI в присутствии или отсутствии бафиломицина. Изображения случайных полей клеток, иммуноокрашенных для цитокератина и белка IG2 GPCMV. Изображения клеток: ложно инфицированные клетки ЭПИ, обработанные 50нМ бафиломицином А1 (изображения А-С); необработанные клетки EPI, инфицированные вирусом FRT (изображения D-F); предварительно обработанный 50 нМ бафиломицином А1 (изображения G-I). Клетки, иммуноокрашенные, как описано в материалах и методах: антитело против пан-кератина с вторичным антимышиным IgG-TritC (A, D и G) и антителом против IE2 со вторичным IgG-FitC (B, E, ЧАС). Клетки контрастировали с DAPI (C, F и I). Изображения были сделаны при 40-кратном увеличении с помощью конфокального микроскопа с вращающимся диском (Olympus). (ii) Процент инфицированных GPCMV клеток (GPL или EPI) либо обработанный bafilomycin, либо необработанный. Вирус, обнаруженный экспрессией антигена IE2 с помощью иммунофлюоресцентного анализа с использованием антитела против IE2, как описано в материалах и методах. Были подсчитаны тридцать случайных полей для каждых 3 независимых экспериментов на лечение. Статистический анализ проводился с t-критерием ученика.

(TIF)

Щелкните здесь для получения дополнительных данных.

Авторы хотели бы поблагодарить Джима Чой и Дарихану Хорват за отличную техническую помощь. Авторы благодарны д-ру Марку Шляйсу (Университет Миннесоты) за поставку GPCMV слюнной железы (штамм 22122). Авторы также благодарны доктору Майку Маквою (Университет штата Вирджиния, VA) за предоставление второго поколения GPCMV BAC и доктору Бритту (UAB) за подарок антитела gB. Мы также благодарны доктору Гриффиту (Йельский университет, КТ) за передачу информации, относящейся к этим исследованиям.

Комментариев нет.

Добавить комментарий

Ваш e-mail не будет опубликован. Обязательные поля помечены *