Нажмите "Enter", чтобы перейти к контенту

Обнаружение инфекционного вируса ларинготрахеита с помощью ПЦР в реальном времени в естественных и экспериментально зараженных цыплятах

Detection of Infectious Laryngotracheitis Virus by Real-Time PCR in Naturally and Experimentally Infected Chickens
Источник: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3695875/

Конкурирующие интересы: авторы заявили, что конкурирующих интересов не существует.

Задуманные и разработанные эксперименты: YW YZ. Выполняли эксперименты: YZ CK XZ. Проанализированы данные: YZ SH LH. Используемые реагенты / материалы / инструменты анализа: HC XS. Написал газету: YZ XC.

Инфекционный ларинготрахеит (ИЛТ) представляет собой острое, очень заразное инфекционное заболевание верхних дыхательных путей цыплят. В этом исследовании был разработан метод ПЦР в режиме реального времени для быстрого и точного обнаружения и количественного определения ДНК ILTV цыплят, экспериментально инфицированных штаммом ILTV LJS09 и естественно зараженных цыплят. Нижний предел обнаружения анализа составлял 10 копий ДНК. Не было никаких перекрестных реакций с ДНК и РНК вируса инфекционной бурсальной болезни, вируса куриной анемии, вируса ретикулоэндотелиоза, вируса птичьего гриппа, вируса болезни Ньюкасла и вируса болезни Марека. ПЦР в реальном времени была воспроизводимой, поскольку коэффициенты вариации воспроизводимости внутрианализа и интервала были менее 2%. ПЦР в реальном времени использовали для определения уровней ДНК ILTV в тканях цыплят, свободных от патогенов (SPF), инфицированных ILTV в разное время после инфицирования. ДНК ILTV была обнаружена ПЦР в реальном времени в сердце, печени, селезенке, легком, почках, гортани, языке, тимусе, железистом желудке, двенадцатиперстной кишке, поджелудочной железе, тонком кишечнике, толстой кишке, слепой кишке, слепой миндалине, бурсе Фабрициуса, и мозг цыплят в группе заражения и группе контакта-воздействия. Чувствительность, специфичность и воспроизводимость анализа ПЦР в реальном времени ILTV показали его пригодность для обнаружения и количественного определения ILTV в образцах от клинически и экспериментально зараженных ILTV цыплят.

Инфекционный ларинготрахеит (ИЛТ) представляет собой острое, очень заразное инфекционное заболевание верхних дыхательных путей цыплят, которое впервые было описано в США в 1925 году [1]. Симптомами ILT являются назальные выделения, конъюнктивит, сокращение производства яиц, задыхание, кашель, отхаркивание кровавой слизи и выраженная одышка, которая может привести к удушью. Это заболевание приводит к экономическим потерям в птицеводстве во всем мире [2]. Галлид герпесвирус 1, который также называется инфекционным вирусом ларинготрахеита (ILTV), является членом семейства Herpesviridae в соответствии с Девятым Международным комитетом по таксономии вирусов (ICTV) [3]. Хотя для обнаружения ILTV используется изоляция вирусов, это требует много времени. Серологические тесты, включая метод флуоресцентных антител (FAT) [4], непрямую иммунофлуоресценцию (IIF) [5], традиционный иммуноферментный анализ с ферментным связыванием (ELISA) [6], нейтрализацию сыворотки (SN) [7] и иммунодиффузию агарового геля ( AGID), но они, как правило, имеют низкую чувствительность и трудоемкость. Обнаружение ДНК с помощью обычной полимеразной цепной реакции (ПЦР) или ПЦР в реальном времени стало предпочтительным методом диагностики вирусов [8], [9], [10], [11]. ПЦР в режиме реального времени получила широкое признание благодаря своей высокой быстроте, чувствительности, воспроизводимости и уменьшенному риску загрязнения переноса [12].

В этом исследовании был разработан и оценен быстрый и чувствительный анализ ПЦР в реальном времени для обнаружения и количественного определения ILTV. Было доказано, что чувствительность, специфичность и воспроизводимость анализа ПЦР в реальном времени ILTV пригодны для обнаружения и количественного определения ДНК ILTV. Используя эту методику, определяли и количественно определяли уровни ДНК ILTV в тканях цыплят, инфицированных ILTV в разное время и в клинических случаях.

Эксперименты на животных были одобрены Комитетом по этике животных Харбинского института ветеринарных исследований Китайской академии сельскохозяйственных наук (CAAS) и выполнены в соответствии с руководящими принципами по этике животных и утвержденными протоколами. Номер утверждения Комитета по этике животных был SYXK (Hei) 2011022.

Штамм ILTV LJS09 хранился в Харбинском ветеринарном научно-исследовательском институте CAAS. Инфекционный вирус бурсальной болезни (IBDV), вирус куриной анемии (CAV), вирус ретикулоэндотелиоза (REV), вирус репродукции (ARV), вирус болезни Ньюкасла (NDV) и вирус болезни Марека (MDV) были предоставлены другими лабораториями инфекционных заболеваний птиц Харбинский ветеринарный научно-исследовательский институт CAAS.

В 2009 году штамм ILTV LJS09 был изолирован от шестинедельных слоев желтой ноги на ферме в провинции Цзянсу в Китае. Эти цыплята не были вакцинированы против ILT, и они испытали ажиотаж и приступ кашля до смерти. Были собраны ткани гортани и казеозные экссудаты. Все образцы гомогенизировали, замораживали-размораживали три раза и обрабатывали пенициллином (500 МЕ / мл) и стрептомицином (500 МЕ / мл). Образцы инокулировали на хориоаллантоидные мембраны (САМ) 9-дневных куриных эмбрионов, не содержащих специфических патогенов (SPF), которые инкубировали при 37 ° С и ежедневно исследовали в течение 5 дней, после чего САМ и аллантоидные жидкости были собирают, гомогенизируют и замораживают-размораживают три раза. Образцы инокулировали на клетки почек куриного эмбриона (CEK) и через 48 ч после инфицирования клетки CEK обрабатывали фиксацией, дегидратацией, встраиванием, полимеризацией и затем разрезали на секции размером 50 нм, которые окрашивали 1% арахинатом уранила и 1 % цитрата свинца для просвечивающей электронной микроскопии (Hitachi H-7650, Япония). Между тем ДНК извлекали из инфицированных образцов клеток CEK для ПЦР-анализа с использованием пары праймеров gB Forward / Reverse, разработанных на основе гена gB ILTV.

Штамм ILTV LJS09 инокулировали на САМ 9-дневных эмбрионов курицы SPF, как описано ранее [13], [14], которые инкубировали при 37 ° С и ежедневно исследовали в течение 5 дней до тех пор, пока не были собраны САМ и аллантоидные жидкости , Титр вируса титровали путем инокуляции на САМ по меньшей мере из шести различных разведений инокуляции (четыре яйца на разведение). Инокулированные яйца исследовали на инокуляции после пятого дня, и титр вычисляли по методу, описанному Ридом и Мюнхом [15].

Геномную ДНК ILTV экстрагировали в соответствии с инструкциями производителя набора ДНК TIAamp Genomic DNA (TIANGEN, Пекин, Китай). Геном штамма LJS09 амплифицировали с помощью обычной ПЦР, и в общей сложности 102 пары праймеров (данные не показаны) были сконструированы в соответствии с ILTV-штаммом Serva (номер доступа HQ630064), а пары соседних праймеров были перекрыты. Последовательности ДНК были собраны с использованием программы Seqman (DNASTAR, Madison, WI). Полная последовательность ILTV LJS09 была депонирована в GenBank.

Геномную ДНК и РНК из эталонных вирусов, включая IBDV, CAV, REV, ARV, NDV и MDV, экстрагировали с использованием набора ДНК-геномной ДНК TIANamp (TIANGEN, Пекин, Китай) и простого экстракта РНК (BioFlux, Hangzhou, China) в соответствии с инструкции производителя.

Пара праймеров (gB-S: 5 ‘CAGTATCTGGCATCGCCTCAT 3’; gB-A: 5 ‘CCTGGGAACAGAACCTGAACT 3’) и зонд (5 ‘FAM-CTAACCCGTTCG CCGCACTCG-BHQ-1 3’) для ПЦР в реальном времени были разработаны на основе в высококонсервативной области гена gB (присоединение GenBank no: EU104985) для амплификации фрагмента 148 п.н. Обычные ПЦР-праймеры (gB Forward: 5 ‘TTCCGAGATCGAAGAAGTGAG 3’; gB Реверс: 5 ‘ACTCTGGTGGCAAGTATCCTGT 3’) были сконструированы в соответствии с консервативной областью гена gB (присоединение GenBank no: EU104985) для амплификации фрагмента 567 пар оснований. Праймеры и зонд были разработаны с использованием программного обеспечения Primer Premier (версия 5.0). Все праймеры и зонд были синтезированы Invitrogen (Пекин, Китай).

Фрагмент гена gB 148 п.о. амплифицировали с помощью ПЦР из ДНК штамма ILTV LJS09 с помощью праймеров gB-S и gB-A, клонировали в pMD18-T-вектор (TaKaRa, Далянь, Китай) и трансформировали в DH5α E. coli клетки. Рекомбинантную плазмидную ДНК экстрагировали с использованием набора для экстракции ДНК биоспина плазмиды (BioFlux, Hangzhou, China) и подтверждали секвенированием, который был назван pT-gB. Концентрацию ДНК pT-gB определяли спектрофотометрией при 260 нм и чистоту подтвердили с использованием отношения 260/280. Число копий плазмиды рассчитывали с использованием уравнения: копии плазмиды / мкл = [количество плазмиды (г / мкл) × (6,02 × 1023)] / [длина плазмиды (bp) × 660]. Серийные разведения стандартной ДНК использовали для всех анализов количественного анализа.

Реакции ПЦР на 25 мкл содержали 2,5 мкл 10 × PCR-буфера (Mg2 + Plus) (TaKaRa, Далянь, Китай), 2 мкл dNTP (2,5 мМ каждый), 0,2 мкл ДНК-полимеразы Taq (5 U / мкл) (TaKaRa, Далянь, Китай), 1 мкл каждого праймера (праймеры gB Forward / Reverse) (10 пмоль / мкл) и 1 мкл ДНК-матрицы (7,75 × 10-2 нг / мкл до 7,75 × 10-8 нг / мкл, 7,75 ng равно 2,5 × 109 копий). Реакционную смесь инкубировали при 95 ° С в течение 3 мин, затем подвергали 40 циклам 94 ° С в течение 10 с, 60 ° С в течение 20 с и 72 ° С в течение 20 с и, наконец, инкубировали при 72 ° С в течение 5 мин , Продукты ПЦР анализировали электрофорезом.

ПЦР в реальном времени проводили с использованием LightCyclerR480 (Roche Diagnostics GmbH, Мангейм, Германия). Условия ПЦР, включая концентрации праймеров и зонда, были оптимизированы для получения оптимальных специфических флуоресцентных сигналов. ПЦР в реальном времени проводили в общем объеме 20 мкл, содержащем 10,0 мкл 2 × Premix Ex Taq (TaKaRa, Далянь, Китай), 0,4 мкл каждого праймера (2,5, 5, 10, 15 и 20 пмоль / мкл) (gB-S / A), 0,8 мкл зонда (2,5, 5, 10, 15 и 20 пмоль / мкл), 2 мкл ДНК-матрицы (3,1 × 10-2 нг / мкл до 3,1 × 10- 8 нг / мкл, 3,1 нг равно 109 копий) и 6,4 мкл ddH2O. Реакцию проводили с предварительной денатурацией при 95 ° С в течение 30 с, затем 40 циклов денатурации при 95 ° С в течение 5 с и отжигом / удлинением при 60 ° С в течение 20 с. Флуоресцентные сигналы измеряли в конце этапа отжига / удлинения. Отрицательный контроль был установлен путем замены шаблона ДНК на ddH2O. Условия были выбраны для обеспечения того, чтобы значения Ct были самыми низкими, и кривые поглощения флуоресценции были устойчивыми к каждой концентрации ДНК. В каждом прогоне была также включена серия разведений стандартной плазмидной ДНК вместе с образцами ДНК. Данные количественного определения в терминах значений Ct были определены с использованием Abs Quant / Fit Points программного обеспечения LightCycler, версия 1.5.0.39 (Roche Diagnostics GmbH, Мангейм, Германия).

Последовательные разведения рекомбинантной плазмидной ДНК pT-gB в диапазоне от 107 копий / мкл до 101 копий / мкл были сделаны в стерильном ddH2O. Для генерации стандартных кривых разведения тестировали в трех повторах и использовали в качестве стандартов количественной оценки для построения стандартной кривой путем построения логарифма числа копий с плазмидой относительно измеренных значений Ct. Программное обеспечение LightCycler использовалось для создания стандартной кривой и вычисления коэффициента корреляции стандартной кривой.

Чувствительность ПЦР в реальном времени определяли с использованием серийно разведенной рекомбинантной плазмидной ДНК pT-gB от 107 копий / мкл до 101 копий / мкл в оптимизированных условиях и сравнивали с обычной ПЦР. Предел обнаружения обычной ПЦР определяли на основе копий ДНК с положительным результатом, продуцирующим фрагмент 148 п.о. на агарозном геле. Предел обнаружения ПЦР в реальном времени определяли на основе самого высокого разведения с наличием значения Ct.

Чтобы оценить специфичность ПЦР в реальном времени для обнаружения ILTV, образцы ДНК и РНК из других вирусов птиц, включая IBDV, CAV, REV, ARV, NDV и MDV, были протестированы с ДНК-матрицей штамма ILTV LJS09 в качестве положительного контроля и ddH2O в качестве отрицательного контроля.

Для оценки воспроизводимости ПЦР в реальном времени проводили внутрипросветные и меж-аналитические тесты в трех повторностях путем тестирования четырех разведений образцов ДНК, экстрагированных из штамма ILJ LJS09 в течение одного и того же цикла, и независимо друг от друга в трех разных сериях. Все тесты проводились три раза. Оценивали среднее значение CT и коэффициент вариации (CV).

Десять клинических образцов были собраны из шести провинций Китая с 2011 по 2012 год. Все образцы гомогенизировали, замораживали-размораживали три раза, центрифугировали, а затем инокулировали на САМ 9-дневных эмбрионов курицы SPF для выделения вируса и идентификации ПЦР как описано ранее. ДНК из десяти изолятов экстрагировали из супернатанта аллантоидной жидкости и гомогенатов CAM. Все образцы были протестированы в три раза по ПЦР в реальном времени. Информация из десяти образцов приведена в таблице 1.

Пятьдесят 10-недельных цыплят SPF из Экспериментального Центра животных Харбинского Ветеринарного Исследовательского Института CAAS, Китай, были случайным образом разделены на три группы и подняты в двух отрицательных изоляторах давления. Вкратце, 25 цыплят инокулировали интратрахеально с помощью 104 EID50 штамма ILTV LJS09 (названная инфекционная группа), а еще 15 — в одном и том же отрицательном изолирующем слое (называемом контактной группой). Десять цыплят были подняты в отдельном отрицательном изоляторе давления (названная контрольная группа). Клинические симптомы наблюдались ежедневно. Три цыплята из группы заражения, две цыплята из группы контакта и воздействия, а также одна из контрольной группы подвергались эвтаназии в каждый момент времени. Образцы ДНК, выделенные из сердца, печени, селезенки, легких, почек, гортани, языка, тимуса, железистого желудка, двенадцатиперстной кишки, поджелудочной железы, тонкого кишечника, толстой кишки, слепой миндалины, бурсы Фабриция и мозга анализировались в режиме реального времени ПЦР на 1, 3, 7, 14 и 28 дней после инокуляции (dpi). Образцы тканей собирали у цыплят и замораживали при -80 ° С. Один грамм каждого образца ткани взвешивали, добавляли в 1 мл забуференного фосфатом физиологического раствора (PBS, pH 7,4) и гомогенизировали. ДНК экстрагировали из 200 мкл гомогенизированных образцов ткани с использованием набора ДНК геномной ДНК TIANamp (TIANGEN, Пекин, Китай) и элюировали в 50 мкл ddH2O. Вирусную нагрузку определяли количественно с помощью ПЦР в реальном времени с использованием 2 мкл ДНК. Все образцы испытывали в трех повторах. Концентрации вируса были выражены как среднее число копий генома вируса в 1 г испытуемых образцов.

Все ткани из группы инфекции, группы контакта и воздействия и контрольной группы были собраны в каждый момент времени наблюдения. ИЛТ-иммуногистохимию проводили на 4 мкм участках фиксированной формалином, содержащей парафин ткани (FFPE). Секции тканей блокировали 5% БСА при 37 ° С в течение 30 мин и инкубировали с 1:10 разбавленными первичными поликлональными антителами ILTV при 4 ° С в течение ночи. Затем секреты тканей инкубировали с биотин-конъюгированным козьим анти-куриным IgY-вторичным антителом (Santa Cruz Biotechnology Inc., Santa Cruz, CA). Связывание антител визуализировали с помощью стрептококкового комплекса авидин-биотин (SABC) (BOSTER, Ухань, Китай). Окрашивание проводили с помощью DAB и контрастировали с гемалумом.

У ткани гортани инфицированного цыпленка ILTV было полно казеозных экссудатов (рис.1), что соответствовало клиническим признакам до смерти. CAMs куриных эмбрионов SPF исследовали на прививку после пятого дня. Зараженные CAM были утолщены и имели белые непрозрачные бляшки. Сильная гиперемия появилась у инфицированных эмбрионов. Электронная микроскопия клеток почек куриного эмбриона, инокулированных образцами, показала, что вирионы ILTV были распределены в цитоплазме (рис.2). Продукт ПЦР, амплифицированный с использованием праймеров gB с шаблонами геномной ДНК, имел длину 567 п.о. (данные не показаны).

Горечь инфицированного цыпленка, зараженного ILTV, была заблокирована желтыми казеозными сгустками. Вырезая гортань открытой, просвет гортани был узким, и весь просвет был покрыт желтой казеозной мембраной.

Почечные клетки куриного эмбриона, инокулированные образцами ILTV в течение 48 часов, обрабатывали путем фиксации, дегидратации, встраивания, полимеризации, разрезания на участки размером 50 нм, а затем окрашивали 1% уранилацетата и 1% свинцового цитрата для просвечивающей электронной микроскопии. Вирионы ILTV были распределены в цитоплазме клеток почек куриного эмбриона. Шкала в правом нижнем углу изображения составляла 2 мкм.

Размер генома ILTV LJS09 составлял 153 013 bp, при этом содержание G + C составляло 48,1%. Геномная последовательность штамма ILTV LJS09 была депонирована в GenBank (№ присоединения JX458822).

Концентрация рекомбинантной плазмидной ДНК pT-gB составляла 60,25 нг / мкл, а отношение A260 / A280 составляло 1,85. Число копий конверсии плазмидной ДНК pT-gB составляло 1,93 × 1010 копий / мкл. После оптимизации конечное общее количество каждого праймера составляло 4 пмоль, а зонд составлял 8 пмоль. Короче говоря, ПЦР в реальном времени в 20 мкл реакционном объеме содержала 10,0 мкл 2 × Premix Ex Taq, 0,4 мкл каждого праймера (10 пмоль / мкл) (gB-S / A) и 0,8 мкл зонда ( 10 пмоль / мкл), 2 мкл ДНК-матрицы (3,1 × 10-2 нг / мкл до 3,1 × 10-8 нг / мкл, 3,1 нг равно 109 копий) и 6,4 мкл ddH2O.

Кривые амплификации ПЦР в реальном времени и стандартные кривые были получены путем использования серийно разведенной плазмидной ДНК pT-gB от 107 до 101 копий / мкл и детектировали в ПЦР в реальном времени в оптимизированных условиях (фиг.3А). Значения порогового цикла (Ct) были затем нанесены на график с известным номером копии стандартных элементов управления. Значение ошибки (0,0644) было ниже 0,2 (фиг.3В), что было приемлемо в соответствии с инструкциями LightCycler 480. Эффективность составила 1,952, наклон составлял -3,442, а перехват Y — 42,76. Мы количественно подсчитали количество неизвестных образцов, используя следующую формулу: Y = -3.442X + 42.76 (Y = пороговый цикл, X = начальное количество журнала).

A: Кривые усиления. В качестве стандартных контролей использовались десятикратные разведения стандартной ДНК от 107 копий / мкл до 101 копий / мкл. B: стандартная кривая (Y = -3,442X + 42,76) (ошибка = 0,0644 и эффективность = 1,952) была проанализирована с помощью программного обеспечения LightCycler 480 1.5.0.39. Концентрация относится к числу экземпляров шаблона для каждой реакции. Стандарты ДНК обозначены по оси x, тогда как соответствующие значения порога цикла (Ct) представлены на оси y.

Последовательные разведения рекомбинантной плазмидной ДНК pT-gB в диапазоне от 107 до 101 копий / мкл тестировали с помощью установленной ПЦР в реальном времени для оценки чувствительности. Нижний предел обнаружения составлял 10 копий на реакцию (фиг.3А), тогда как для обычной ПЦР было 103 копии ДНК (фиг.4). Эти результаты показали, что ПЦР в реальном времени была в 100 раз более чувствительной, чем обычная ПЦР.

Для определения чувствительности обычной ПЦР использовали десятикратные разведения стандартной ДНК от 107 копий / мкл до 101 копий / мкл. Продукты ПЦР окрашивали бромидом этидия. N: H2O; M: ДНК-маркер DL2000.

Специфичность ПЦР в реальном времени была протестирована с использованием стандартной ДНК плазмиды pT-gB, ДНК и образцов РНК, экстрагированных из ILTV, IBDV, CAV, REV, ARV, NDV и MDV, а также пустого контроля с водой. GB-специфический зонд обнаружил IL-образный штамм LJS09 и стандарт плазмиды, но никаких детектируемых флуоресцентных сигналов не наблюдалось для других вирусов птичьего гриппа и пустого контрольного образца (фиг.5), предполагая, что установленный анализ ПЦР в реальном времени был очень специфичным.

Шесть других патогенов птиц были использованы для теста специфичности. Размерами 105, 104, 103, 102 были стандартная ДНК; 1: ДНК штамма ILTV LJS09; 2-7: образцы ДНК и РНК IBDV, CAV, REV, ARV, NDV, MDV; 8: H2O.

Воспроизводимость ПЦР в реальном времени для обнаружения ДНК, экстрагированной из 10-кратных серийно разведенных вирусных суспензий штамма ILTV LJS09, определяли три раза как для внутри-, так и для интер-анализов. Средние коэффициенты вариации (CVs) внутри-анализа и интер-анализа были ниже 2%. Внутренние аналитические CV составляли 0,51-1,28%, тогда как интервал анализа составлял 0,73-1,68% (таблица 2).

Примечание. Четыре разведения штамма ILTV LJS09 были обнаружены во внутри- и меж-аналитических тестах. Коэффициенты вариации (CVs) обоих тестов были ниже 2%.

ДНК, извлеченная из клинических образцов инфицированных ILTV цыплят, была обнаружена ПЦР в реальном времени. Все десять образцов были положительными на ILTV. Значения Ct этих образцов составляли от 27 до 34 (табл. 1).

ДНК ILTV в тканях цыплят определяли с использованием установленной ПЦР в реальном времени, а число копий ДНК каждого образца конвертировалось в число копий на грамм, используя рассчитанное значение Ct, определенное на стандартной кривой. Динамическое распределение ILTV в тканях из группы инфекции, группы контакта и воздействия и контрольной группы определяли номерами копий. Коэффициенты обнаружения ДНК ILTV в каждой ткани в разные дни после инфицирования показаны в таблице 3. Все ткани в группе инфекции и группе контакта-воздействия, включая сердце, печень, селезенку, легкие, почки, гортань, язык, тимус, железистый желудок, двенадцатиперстная кишка, поджелудочная железа, тонкая кишка, толстая кишка, слепой миндалины, бурса Фабриция и головного мозга, были положительными на 3, 7 и 14 точек на дюйм. Однако положительные коэффициенты обнаружения отдельных тканей в группе инфекции при 1 и 28 т / д были между 33-66%, тогда как все ткани были отрицательными в группе контакта с контактом при 1 dpi.

Примечания. Десятинедельные цыплята SPF инокулировали внутритрахеально с помощью 104 EID50 штамма ILTV LJS09. Ткани с положительной частотой обнаружения менее 100% в ПЦР в режиме реального времени ILTV были подчеркнуты; ткани из контрольной группы были отрицательными (не показаны);

: I = группа инфекций;

: C = группа контакта;

: — / — означает, что ДНК не была обнаружена в этот момент времени.

Количество копий ДНК ILTV в каждой ткани из группы инфицирования колебалось между 103-108 копий / г во всех точках наблюдения. Число копий ДНК ILTV большинства тканей достигло максимума в 7 точек на дюйм, а легкая и гортань при 3 dpi имели значительно более высокие номера копий (107-108 копий / г) ДНК ILTV, чем другие ткани (105-106 копий / г). Количество копий ДНК ILTV уменьшилось с 14 точек на дюйм, а уровень ДНК ILTV значительно снизился при 28 dpi (фиг.6A). Интенсивность флуктуации ДНК ILTV в группе контакта-воздействия показана на фиг.6В. Количество копий ДНК ILTV в каждой ткани достигло максимума в 7 точек на дюйм, а затем уменьшилось с 14 точек на дюйм. Уровень ДНК ILTV в группе контакта с контактом был в 10-100 раз ниже, чем в группе инфицирования в каждой точке наблюдения, за исключением 28 dpi, при которой уровень ДНК ILTV в обеих группах был почти одинаковым ( Фиг.6В). Цыплята в группе заражения представили клинические признаки ILT при 3-7 dpi, в которых наблюдались слизистые носовые выделения, задыхания и приступы кашля. Тем не менее, клинические симптомы цыплят в группе контакта с контактом были относительно умеренными и появились на 2 или 3 дня позже, чем инфицированные цыплята. Кроме того, цыплята в контрольной группе не показали никаких положительных результатов в любой момент времени или в любых тканях (данные не показаны).

Десятинедельные цыплята SPF инокулировали внутритрахеально с помощью 104 EID50 штамма ILL LJS09. Вирусные нагрузки были указаны как количество копий ДНК ILTV на г в каждой ткани. Ткани включали сердце, печень, селезенку, легкие, почки, гортань, язык, тимус, железистый желудок, двенадцатиперстную кишку, поджелудочную железу, тонкую кишку, толстую кишку, слепую кишку, слепую миндаль, бурсу Фабриция и мозг. A: средняя вирусная нагрузка трех цыплят в группе заражения и стандартное отклонение для каждой временной точки. B: средняя вирусная нагрузка двух цыплят в группе контакта контакта и стандартное отклонение для каждой временной точки.

Результаты иммуногистохимического окрашивания показали, что большинство тканей в группе инфекции и группе контакта-воздействия, включая сердце, печень, селезенку, почку, гортань, тимус, тонкую кишку, толстую кишку, бурсу Фабриция и головного мозга, были положительными на 3, 7 и 14 точек на дюйм (рис.7). Некоторые ткани, включая легкие, язык, железистый желудок, двенадцатиперстную кишку, поджелудочную железу, слепую кишку и слепую миндалину, были отрицательными (данные не показаны).

A: Ткани из группы инфекции. B: Ткани из группы контакта-воздействия. Результаты иммуногистохимического окрашивания показали, что ILTV был обнаружен в тканях, включая сердце, печень, селезенку, почку, гортань, тимус, тонкую кишку, толстую кишку, бурсу Фабрициуса и мозг в группе инфекции и группу контакта. 1. Сердце: ILTV находился среди сердечного мышечного волокна; 2. Печень: ILTV находился в гепатоцитах; 3. Селезенка: ILTV проживал в спленоцитах; 4. Почки: ILTV проживал в почечных трубчатых эпителиальных клетках; 5. Ларинкс: ILTV находился под слизистой оболочкой гортани; 6. Тимус: ILTV находился в мозговом мозге; 7. Тонкий кишечник: ILTV находился в эпителиальных клетках кишечной железы; 8. Толстая кишка: ILTV располагался в клетках внутреннего слоя ламиновой пробы, эпителиальных клеток слизистой оболочки кишечника и эпителиальных клеток кишечной железы; 9. Бурса Фабрициуса: ILTV проживал в эпителиальных клетках бурсы Фабриция; 10. Мозг: ILTV проживал в коре головного мозга.

Вирусная изоляция и серологические тесты были использованы для диагнозов ILTV [4], [5], [6], [7]. Однако эти методы являются трудоемкими и трудоемкими, а их чувствительность низкая. Для обнаружения ILTV было разработано несколько ПЦР и методов ПЦР в реальном времени [9], [10], [11], [16], [17]. ПЦР в реальном времени стала потенциально мощной методикой в ​​микробиологической диагностике из-за ее простоты, быстроты, воспроизводимости и высокой чувствительности по сравнению с другими диагностическими методами. В этом исследовании мы сообщаем о ПЦР-анализе в реальном времени для обнаружения и количественного определения ДНК ILTV у инфицированных ILTV цыплят и в клинических образцах.

Последовательность генома ILTV составляет приблизительно 150 кб в длину, состоящую из 79 открытых рамок считывания [18], [19], [20]. Некоторые высококонсервативные гены в герпесвирусах были отобраны для установления ПЦР в реальном времени в предыдущих исследованиях, таких как гены gG и TK [21], [22], [23] и ген UL15a [11], [24], [ 25]. В этом исследовании были проанализированы последовательности гБ генов многочисленных штаммов ILTV из GenBank и сходство составило 99,2-100%. Таким образом, ПЦР в реальном времени с высокой специфичностью и чувствительностью для обнаружения ILTV была разработана на основе пары праймеров и специального зонда, разработанного в соответствии с высококонсервативной областью гена ILB ILTV. Условия ПЦР в реальном времени были оптимизированы для получения высокоспецифичных флуоресцентных сигналов.

Стандартные кривые в этом исследовании были получены с использованием серийно разведенных плазмид pT-gB от 107 копий / мкл до 101 копий / мкл, что поддерживало линейность на семь порядков с эффективностью 1,952 (максимальная эффективность равна 2). Эффективность в этом исследовании составила 97,6%, что было несколько выше, чем в двух предыдущих исследованиях. Стандартная кривая поддерживала линейность по крайней мере на пять порядков с общей эффективностью 94,54% в исследовании Callison [16], в то время как линейность поддерживалась на семь порядков со средней эффективностью 96,36% в исследовании Махмудяна [11].

В реальном времени количественный анализ ПЦР обычно обеспечивает более высокую чувствительность, чем обычная ПЦР, и шаг обработки после ПЦР избегают, что позволяет сэкономить как время, так и реагенты. Чувствительное обнаружение и количественное определение ДНК ILTV является ключевым экспериментом in vitro и in vivo. Нижний предел обнаружения ПЦР в реальном времени составил 10 копий на реакцию, что в десять раз более чувствительно, чем в предыдущих исследованиях [11], [16] и в 100 раз более чувствительны, чем обычные ПЦР. Кроме того, анализ ПЦР в реальном времени позволяет одновременно обнаруживать и количественно определять ДНК, и для этого требуется меньше времени для проведения и обеспечивает более объективный конечный анализ по сравнению с обычной ПЦР. Это также полезно для понимания механизмов передачи вируса путем исследования вирусной динамики [12]. Высокая специфичность этого метода была подтверждена отрицательными сигналами обнаружения ДНК и РНК других вирусов птиц, такими как IBDV, CAV, REV, ARV, NDV и MDV. Он показал высокую воспроизводимость с менее чем 2% -ным внутри- анализом и изменчивостью между исследованиями.

Было также установлено, что анализ ПЦР в реальном времени был очень воспроизводимым на протяжении всего исследования и был способен определить уровень вирусной ДНК в разных тканях инфицированных ILTV цыплят в разное время после инфицирования. Результаты экспериментальной инфекции показали, что ДНК ILTV во всех семнадцати тканях из группы инфицирования и группы контакта-контакта были положительными при 3, 7, 14 dpi. Уровень ДНК ILTV в гортани из группы инфицирования при 3 dpi составлял 1,51 × 108 копий / г, что в 10-100 раз превышало другие ткани в то же время. Однако уровень ДНК был снижен до 3,27 × 106 копий / г 7 т / д. Предыдущие отчеты показали, что ILTV в трахее может быть восстановлен на 3-4 dpi и заметно уменьшен на 6-й день после инокуляции [21], [26], [27], что согласуется с результатами этого исследования. На ранних стадиях заражения цыплят уровни ДНК ILTV в гортани и легких были относительно выше, чем в других тканях, что было аналогично тому, как это было описано Tripathy (1998). Пик ДНК ILTV в трахее совпал с тяжелыми симптомами верхних дыхательных путей. Уровень ДНК ILTV в гортани группы контакт-облучения достиг пика с разрешением 7 точек на дюйм со средним числом копий 3,99 × 105 копий / г, но время было отложено, а уровень ДНК был почти таким же, как и у инфицирующей группы, поскольку эти цыплята были заражены контактом с зараженными цыплятами.

В предыдущих эпидемиологических исследованиях трахеи гортани обычно собирались для изоляции и идентификации вируса. При обнаружении подозреваемых инфицированных ILTV клинических образцов из поля мы обнаружили, что ILTV также был обнаружен в почках. Многие цыплята с респираторным заболеванием верхних дыхательных путей имели очень похожие клинические симптомы. Хотя об этом ранее не сообщалось, на основе этих наблюдений мы решили проанализировать распределение ткани ILTV у экспериментально инфицированных цыплят, потому что было бы более удобным для обнаружения инфицированных ILTV клинических образцов, если бы ткани, кроме тканей верхних дыхательных путей, могли быть используется для обнаружения и изоляции ILTV. Интересно, что ПЦР в реальном времени, разработанная в этом исследовании, может быть использована для обнаружения ДНК ILTV во всех собранных тканях инфицированных ILTV цыплят от 1 до 28 т / д. Он предположил, что все эти ткани, испытанные в этом исследовании, пригодны для выявления вирусов с использованием высокочувствительного анализа ПЦР в реальном времени, особенно гортани на ранних стадиях инфекции. Для сравнения, ILTV были обнаружены иммуногистохимическим анализом в 10 из 17 тканей в группе инфицирования и группе контакта с контактом при 3, 7 и 14 dpi. Он предположил, что ПЦР в реальном времени гораздо более чувствительна, чем иммуногистохимический анализ для выявления ILTV в тканях.

Анализ ПЦР в реальном времени, разработанный в этом исследовании, впервые был применен к анализу распределения ILTV в тканях экспериментально инфицированных цыплят. Его можно использовать в качестве быстрого метода для подтверждения диагноза ILTV в поле и полезно для скрининга клинических образцов в эпидемиологических исследованиях. Методы ПЦР, разработанные для обнаружения ILTV до сих пор, не могут использоваться для дифференциации штаммов вакцины ILTV от полевых вирулентных вирусных штаммов из-за высокого сходства нуклеотидных последовательностей между ними. Наиболее эффективным молекулярным методом для дифференциации ILTV является ПЦР с последующим полиморфизмом длины рестрикционного фрагмента, но даже полиморфизм длины рестрикционного фрагмента не может дифференцировать все тестируемые штаммы вакцины ILTV от полевых штаммов [23], [28] — [31]. Поэтому ПЦР и методы ПЦР в реальном времени по-прежнему являются очень полезными и практичными методами обнаружения ILTV в экспериментальных инфекциях и полевых случаях.

В этом исследовании был разработан и оценен быстрый и чувствительный анализ ПЦР в реальном времени для обнаружения и количественного определения ILTV. Чувствительность, специфичность и воспроизводимость анализа ПЦР в реальном времени ILTV показали его подходящее применение для обнаружения и количественного определения ILTV у экспериментально инфицированных цыплят и клинических случаев. Уровни ДНК ILTV в тканях цыплят, инфицированных ILTV в разное время, определяли и количественно определяли. Результаты этого исследования могут помочь нам понять закономерность распределения ILTV in vivo.

Комментариев нет.

Добавить комментарий

Ваш e-mail не будет опубликован. Обязательные поля помечены *