Нажмите "Enter", чтобы перейти к контенту

Ингибиторы Hsp90 эффективны против саркомы Капоши, усиливая деградацию основного вирусного гена LANA, вирусного корецептора EphA2, а также других белков-клиентов

Hsp90 Inhibitors Are Efficacious against Kaposi Sarcoma by Enhancing the Degradation of the Essential Viral Gene LANA, of the Viral Co-Receptor EphA2 as well as Other Client Proteins
Источник: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3510261/

Авторы заявили, что не существует никаких конкурирующих интересов.

Задуманные и разработанные эксперименты: WC DPD BD. Выполнили эксперименты: WC S-HS. Проанализированы данные: WC DPD BD S-HS. Добавленные реагенты / материалы / инструменты анализа: KWW. Написал газету: WC DPD BD.

Ингибиторы протеинов с тепловым шоком 90 (Hsp90) проявляют активность против рака человека. Мы оценили ряд новых, обладающих биодоступностью, химически разнообразных ингибиторов Hsp90 (PU-H71, AUY922, BIIB021, NVP-BEP800) против саркомы Капоши (KS). Все ингибиторы Hsp90 проявили наномолярную EC50 в культуре, а AU9922 уменьшили нагрузку на опухоль в модели ксенотрансплантата KS. KS ассоциируется с KS-ассоциированным герпесвирусом (KSHV). Мы идентифицировали связанный с вирусом латентный ядерный антиген (ЛАНА) в качестве нового клиентского белка Hsp90 и продемонстрировали, что ингибиторы Hsp90 снижают уровень ЛКА через протеасомальную деградацию. Эти ингибиторы Hsp90 также снижают уровни белка EphA2 и эфрин-B2. LANA имеет важное значение для обслуживания вирусов, и недавно было показано, что EphA2 способствует инфицированию KSHV; что, в свою очередь, обеспечивает скрытую настойчивость. Кроме того, обе молекулы необходимы для образования опухолей KS, и обе они были подавлены в ответ на ингибиторы Hsp90. Это обеспечивает обоснование клинического тестирования ингибиторов Hsp90 в раковых заболеваниях, связанных с KSHV, и на уничтожение латентных резервуаров KSHV.

Белки теплового шока, такие как Hsp90, помогают сгибать белки. Они, по-видимому, необходимы для поддержания роста раковых клеток. Ингибиторы Hsp90 находятся в клинических испытаниях для многих видов рака, но со смешанными результатами, по-видимому, поскольку у этих белков много клиентов. Механизм эффективности лекарственного средства и вариации опухолевого типа в ответах не понят. Здесь мы показываем, что в случае саркомы Капоши и первичной эффузионной лимфомы, являющейся раком, вызванным ассоциированным с Karosi саркомой вирусом герпеса (KSHV / HHV8), основной вирусный белок LANA связывается с Hsp90 и является клиентом Hsp90. Различные ингибиторы малых молекул Hsp90 уменьшают экспрессию LANA. В то же время они уменьшают экспрессию вновь обнаруженного корецептора KSHV ephA2, Akt, cdc2 и ephrin-B2. Поскольку LANA требуется для поддержания вируса, скрытого во всех опухолевых клетках, процесс, который периодически поддерживается инфекцией de novo, эти ингибиторы мешают основным компонентам вирусного патогенеза и росту опухоли in vivo.

Тестовый белок 90 (Hsp90) является консервативным молекулярным шапероном, который облегчает созревание широкого спектра белков и помогает в правильной складчатости и продуктивной сборке клеточных белков и мультимерных белковых комплексов в нормально растущих клетках [1], [2]. Hsp90 также играет важную роль в поддержании трансформированного фенотипа раковых клеток. Сверхэкспрессия Hsp90 была обнаружена при различных раковых заболеваниях [3], [4], [5]. Hsp90 необходим для правильной фальцовки своих «клиентских белков», многие из которых являются эффекторами основных путей передачи сигналов, контролирующих рост клеток, дифференцировку, ответ на повреждение ДНК и выживаемость клеток [6]. Раковые клетки критически пристрастились к шаперонному механизму Hsp90, активность которого защищает массив мутированных и сверхэкспрессированных онкобелков и других белков клеточного клиента от неправильного образования и деградации [7], [8].

Hsp90 является новой терапевтической мишенью для рака [8], [9], [10]. Более новый класс ингибиторов Hsp90 связывается с АТФ-связывающим мотивом Hsp90 и ингибирует его белкопрядильную активность, что приводит к неправильной памяти, последующей деградации клеточных белков-клиентов и, в конечном счете, к гибели опухолевых клеток [4], [7], [11], [12]. Ингибиторы Hsp90 являются селективными для опухолевых клеток, поскольку для большинства опухолевых клеток необходима функция шаперонизации Hsp90. Несмотря на то, что новые ингибиторы очень селективны для Hsp90, Hsp90 имеет множество клиентских белков, каждый из которых может способствовать трансформированному фенотипу. Например, Hsp90 участвует в активации NFκB IKK [13] в клетках нормали и лимфомы, в том числе в клеточных линиях лимфомы, связанных с саркомой, связанных с кароси (KSHV) [14], [15]. Кроме того, растворимый внеклеточный Hsp90 был вовлечен в поддержку инфекции de novo KSHV [16].

Мы сосредоточили наше внимание на (i) эфринах и эфриновых рецепторах из-за их связи с саркомой Капоши (KS) и саркомой, связанной с каросией (KSHV), и (ii) на ядерном антигене KSHV, связанном с латентностью (LANA), который необходим для поддерживая вирус KSHV и тем самым трансформированный фенотип [17]. Саркома Капоши (KS) — это рак эндотелиальных клеток; на самом деле, KS является одним из наиболее сосудистых заболеваний человека.

Взаимодействие Эфрина может вызывать широкий спектр клеточных ответов, включая клеточную адгезию, образование границ и отталкивание [18]. Например, Ephrin-A1 был обнаружен как TNF-индуцибельный белок в клетках HUVEC. Эфрины связаны мембраной с помощью гликозилфосфатидилинозитола (GPI) в случае эфрина-A1-A5 и трансмембранного домена в случае эфрина-B1-B5. Они образуют пары рецепторных лигандов с рецепторами эфрина.

Ephrin-B2 играет важную роль в созревании сосудов. Он экспрессируется на эндотелиальных клетках, артериальных ангиобластах и ​​периваскулярных мезенхимальных клетках. Эфрин-B2 экспрессируется на значительных уровнях в клеточных линиях KS, KS, трансформированных лимфатических эндотелиальных клетках (LEC / HHV-8) и в ткани KS [19], [20]. Продолжающееся присутствие KSHV и экспрессия вирусных белков необходимы для развития KS, и KSHV может перепрограммировать первичные эндотелиальные клетки, чтобы продлить их продолжительность жизни и получить признаки трансформации [21], [22], [23], [ 24], [25], [26], [27]. Ephrin-B2 сигнализирует через рецептор EphB4.

EphA2 является рецептором эфрин-A1 [28]. Эфриновые рецепторы являются рецепторными тирозинкиназами. Ранее EphA2 был идентифицирован как белок клиента Hsp90 [29], [30]. Он сверхэкспрессируется во многих злокачественных новообразованиях человека и поддерживает опухолевый ангиогенез [29], [30]. Ориентация взаимодействий рецептора эфрин-эфрина с помощью антител, siRNA или растворимых лигандов (например, растворимый EphB4, рецептор эфрина-B2, слитый с альбумином [31]) нарушает функцию эндотелиальных клеток и сосудистую сеть опухоли [32], [33]. В настоящее время разрабатываются первые клинические исследования, нацеленные на взаимодействие эфрина. Это устанавливает эфрины как ключевые регуляторы опухолевого ангиогенеза и роста эндотелиальных клеток.

EphA2 также имеет новую идентифицированную прямую роль в заражении KSHV эндотелиальными клетками. EphA2 был установлен как корецептор KSHV, связываясь с вирусными gH и gL-белками [34], и как медиатор индуцированной KSHV сигнализации [35]. Поскольку первоначальная инфекция эндотелиальных клеток с помощью KSHV является предпосылкой для того, чтобы они в конечном итоге стали опухолевыми клетками KS, и поскольку периодическая реинфекция, по-видимому, способствует поддержанию вируса и прогрессированию опухоли, любой препарат, который мешает латентности (посредством таргетинга LANA) и понижает -инфекция (посредством таргетинга на эфрин) значительно повлияет на патогенез KS.

Как и другие герпесвирусы, KSHV демонстрирует две различные фазы в своем жизненном цикле, латентную и литическую репликацию. Во время скрытой инфекции в опухолевые клетки KS экспрессируется только малая часть вирусных белков, главным образом связанный с латентностью ядерный антиген (ЛАНА) [36], [37]. LANA необходим и достаточен для сохранения эписомы KSHV [38]; это необходимо для выживания опухолевых клеток [17]. LANA может взаимодействовать с множеством партнеров [39], [40], [41], [42], [43], включая белки супрессоров опухолей, что приводит к ингибированию апоптоза и дисрегуляции клеточного цикла [44], [ 45], [46]. Эти действия способствуют выживанию опухолевых клеток и пролиферации клеток. Таким образом, вирусные латентные белки являются высокоспецифичной мишенью для терапии рака КС.

В настоящей работе мы обнаружили, что Hsp90 является важным регулятором LANA, ephA2 и ephrin-B2. Для лечения опухолевых линий PEL и KS использовали множественные, высокоспецифичные, химически отличные и пероральные биодоступные ингибиторы Hsp90. Это ускорило деградацию ЛКА через протеосомный путь и снизило уровни эфрина В2. Результатом было ингибирование роста в культуре при наномолярных концентрациях и замедление опухоли в модели ксенотрансплантации КС.

BJAB, BJAB-LANA и KSHV-положительные клеточные линии PEL BC-3, BCP-1, BCBL-1 и BC-1 культивировали в среде RPMI 1640 (Cellgro), содержащей 2 мМ L-глутамина, 10% фетальной бычьей сыворотки , пенициллин G (100 ед / мл) и сульфат стрептомицина (100 мкг / мл) и дополняют 0,05 мМ 2-меркаптоэтанолом (Sigma), 0,075% бикарбоната натрия (Life Technologies) и 1 ед / мл человеческого интерлейкина-6 (IL -6) (Roche). SLK, SLK-KSHV, L1T2, TIVE-L1, KS-IMM и HeLa культивировали в DMEM (Cellgro), дополненной стрептомицином 100 мкг / мл, 100 мкг / мл пенициллина G (Life Technologies, Carlsbad, CA, USA) , и 10% FBS при 37 ° С в 5% СО2. Клетки SLK-KSHV (дар доктора Дон Ганем [47]) поддерживались с дополнительным пуромицином (1 мкг / мл, Invitrogen).

Крыса анти-LANA моноклональная LN53 была приобретена у Advanced Biotechnology Inc., антисыворотка кроликов анти-LANA против LANA YT041 снова была снова повторена в регионе LANA [48], а мышь anti-LANA (13B10) была получена от Leica Biosystems Newcastle Ltd. Кролик, сколоченный PARP (Asp214, D64E10), Cleaved caspase-3 (Asp175, 5A1E), кролик Anti-Akt и фосфо-Akt (Ser473, D9E) были приобретены у Cell Signaling. Мышь Anti-β-Actin, мышиный антигемагглютинин (анти-HA, клон HA-7) и мышиные антитела против FLAG (клон M2) были приобретены у Sigma Inc. Антитело против эфрина B2 было приобретено у R & D Systems (номер каталога : AF496, Миннеаполис, MN). Мышь anti-Cdc-2 p34 (17, sc-54) и кроличьи антитела против EphA2 (C-20, sc-924) были получены от Санта-Крус. Мыши анти-Hsp90β (SPA-842) и антитела против Hsp90 (Ab1429) были приобретены у Stressgen и Abcam Inc соответственно. Ингибитор Hsp90 17-DMAG был получен от Invivogen Inc .; и PU-H71 от Sigma Inc. BIIB021, NVP-AUY922 и NVP-BEP800 были приобретены у Selleck.

FLAG-tagged LANA (любезно предоставленный доктором Кен Кей [42]) клонировали в pcDNA3, чтобы получить pDD1946 (aa1-1162). Экспрессирующая конструкция с центральным повторением с отметкой Flag-HA (1-329 + 928-1162aa) была клонирована в pcDNA3, чтобы получить pDD1945 следующим образом: центральный повторный LANA-мутант pMF-24 был любезно предоставлен доктором Дайан Хейуорд [45] , Оба меченых мутанта LANA трансфицировали в клетки BJAB с липофектамином 2000 (Invitrogen). Стабильные клетки BJAB были выбраны с помощью G-418 (1 мг / мл, Gibco). Приблизительно 5 × 109 клеток собирали после крупномасштабной культуры. Ядерную экстракцию клеток BJAB (FLAG-LANA) проводили, как описано ранее, с последующими двумя хроматографическими колонками Sepharose 6B и Heparin FF [48]. Выделенные образцы из хроматографических колонок дополнительно очищали еще одним двухстадийным иммуноаффинитическим методом, сначала инкубированием с 50 мкл EZ наблюдали аффинную смолу с анти-FLAG M2 (Sigma) в TBS (10 мМ Трис-HCl, 100 мМ NaCl [pH 8,0]), в течение ночи при 4 ° С, затем FLAG-меченный белок элюировали 200 мкл 150 мкг / мл 3 × FLAG-пептида (Sigma), промывали три раза и разбавляли холодным буфером RIPA (150 мМ 150 мМ NaCl, 0,5% NP- 40, 50 мМ Трис-HCl [рН 8,0], 1 мМ ЭДТА, 0,5 мМ ДТТ, 0,5 мМ PMSF, 0,5% ингибитора коктейльного белка (Sigma)). Наконец, крысиный анти-LANA (клон LN53) или мышиный анти-HA (клон HA-7) использовали для дальнейшей очистки комплексов LANA, для контроля (Sigma) использовали IgG крысы. Очищенные белки разрешали от 8 до 16% градиента SDS-PAGE и окрашивали коллоидным синим (Invitrogen). Видимые полосы были разрезаны и дополнительно подвергнуты масс-спектрометрии в основном корпусе Университета Северной Каролины-Чапел-Хилл.

Ряд полноразмерных или FLAG-LANA-мутантных экспрессирующих плазмид (pDD1928 (aa1-329), pDD1931 (aa930-1162) и pDD775) были получены от доктора Дайан Хейворд [45], [49]. Они вместе с HA-Hsp90 [50] совместно трансфицировали в клетки HeLa и собирали через 48 часов. Mab мышиные анти-HA и анти-FLAG использовали в анализе иммунопреципитации, как описано ранее [48]; IgG мыши использовали в качестве контроля. Образцы промывали холодным буфером RIPA (150 мМ 150 мМ NaCl, 0,5% NP-40, 50 мМ Tris-HCl [pH 8,0], 1 мМ EDTA, 0,5 мМ DTT, 0,5 мМ PMSF, 0,5% ингибитор коктейльного белка), затем путем анализа SDS-PAGE и переносится в мембраны Hybond P (Amersham), вторичные антитела, конъюгированные с пероксидазой хрена (HRP) (1:000 антимышиных IgG (Vector Labs), 1:000 анти-кроличьих IgG (Vector labs)), были инкубировали и подвергали воздействию X-пленки (Genesee).

Клетки TIVE-L1 культивировали в течение ночи на стеклянных покровных стеклах в 6-луночных планшетах. После фиксации 3% параформальдегидом в течение 20 мин и пермеабилизации 0,2% Triton X-100 в течение 15 мин клетки инкубировали в блокирующем буфере (TBS + 10% лошадиной сыворотки), следуя кроличьему анти-LANA YT041 (разведенному 1:500) или мышь anti-Hsp90 (разведенная 1:500). Слайды затем инкубировали с соответствующим вторичным антителом против кролика Техас красного конъюгированного или антимышиного FITC-конъюгированного (векторная лаборатория) и контрастировали с DAPI. Изображения были получены с использованием микроскопа Leica DM4000B со 100-кратным увеличением; программное обеспечение, SimplePCI версии 6.2).

Твердые опухоли фиксировали в 10% нейтральном буферном формалине в течение 2 дней и вставляли парафин. Следуя описанным ранее процедурам [51], слайды сначала депарафинизировали с использованием гистостатического очищающего агента (Sigma), а затем регидратировали. Активность эндогенной пероксидазы гасили 3% H2O2 в 10% метаноле, затем секции блокировали в растворе B (10% лошадиной сыворотки [Vector Laboratory], 5% BSA и 0,3% Triton X-100 в PBS) в течение 1 часа при RT, с последующей инкубацией в течение ночи при 4 ° C с первичными антителами: фосфо-Akt (S473, 1:100), LANA (ABI, 1: 2) и эфрин B2 (1:100); раствор В использовался как отрицательный контроль. После промывки в PBS секцию инкубировали с соответствующими биотинилированными вторичными антителами с последующим введением Авидина DH (Vectastain ABC kit, Vector Laboratory), после чего участки окрашивали подложкой Vector NovaRed (векторная лаборатория). Слайды контрастировали с гематоксилином (Sigma), обезвоживали с использованием градуированных спиртов, очищали в ксилоле и устанавливали в Permount (Sigma). Изображения наблюдались с использованием гистологического микроскопа Leica DM LA, оснащенного цифровой апертурой 10 × / 0,25 или объективом с числовой апертурой 40 × 0,75 и камерой Leica DPC 480.

Два открытых вектора вируса pLKO.1 (TRCN000008749, Целевая последовательность: 5′-CGCATGATCAAGCTAGGTCTA и TRCN000008750, Целевая последовательность: 5′-CCAACTCATGTCCCTCATCAT), нацеленная на Hsp90 (NM_007355), была получена от Open Biosystems / Thermo Inc. Реконструированные лентивирусы были получены Ленти -shRNA Core Facility Университета Северной Каролины. Клетки BC-1 и BCBl-1 (5 × 105) выращивали в 6-луночных планшетах, инфицированных лентивирусами отдельно, добавляя полибрен в конечной концентрации 10 мкг / мл и инкубировали при 37 ° С в течение 6 часов. После инфицирования клеточная среда BC-1 и BCBL-1 была заменена новым RPMI 1640, дополненным 10% эмбриональной бычьей сывороткой. На второй день в среду добавляли пуромицин (5 мкг / мл). Наконец, все клетки собирали после заражения в течение четырех дней. В качестве контролей использовали пустые лентивирусы (shRNA) или необработанные клетки BC-3.

В реальном времени рост адгезивных клеток контролировался системой xCELLigence (Roche Diagnostics, Indiana, IN). 2500 клеток L1T2, KS-IMM, SLK и SLK-KSHV высевали на специализированные микропланшеты, которые содержат микроэлектронные сенсорные матрицы на дне колодцев. Различные концентрации ингибиторов Hsp90 (17-DMAG, PU-H71, NVP-AUY922, BIIB021 и NVP-BEP800) или носители добавляли к пластинке после 20 часов клеточного роста. Двухкратные серийные разведения 17-DMAG, PU-H71, BIIB021, NVP-BEP800 (0, 10, 20, 40, 80, 160, 320 и 640 нМ) или NVP-AUY922 (0, 2, 4, 8, 16, 32 и 64 нМ). IC50 определяли в течение 72 или 96 часов в зависимости от типа клеток после роста в течение 120 часов. Каждый эксперимент повторяли дважды. Живые клетки, которые прилипают к нижней части лунки, приводят к более высокому сопротивлению (индекс клеток), а умирающие клетки теряют контакт, тем самым снижая индекс клеток. Влияние лекарственной терапии на клетки KS определяли путем мониторинга электронного импеданса каждые 30 мин в течение 120 часов. Кривые роста и графики IC50 были получены с использованием RTCA Software v1.2 (ACEA Bio. Inc.).

400 клеток L1T2 высевали после подсчета в 10 см планшете с питательной средой (как указано выше), дополненной либо транспортным средством, либо лекарствами в последовательно разведенных концентрациях (0, 10, 20, 40 и 80 нМ для 17-DMAG, PU-H71 и BIB021; 0, 20, 40, 80 и 160 нМ для NVP-BEP800, 0, 1, 2, 4 и 8 нМ для AUY922). Мониторинг роста колонии наблюдался в течение 2-х недель. В конце анализа колонии окрашивали Magic Blue Stain (3 г кристаллического фиалка и 0,92 г оксалата аммония в 20% этаноле) и оценивали визуально, подсчитывая количество образованных колоний. Каждый эксперимент повторяли три раза.

0,5 мкМ 17-DMAG добавляли в клетки PEL (BC-3, BCP-1, BCBL-1 и BC-1) и клетки собирали после 0, 12 и 24 часов. Общая РНК была выделена TRI REAGENT (Sigma, Saint Louis, MO) и очищена системой очистки мРНК Oligotex (Qiagen, CA) в соответствии с протоколом поставщика. Обратную транскрипцию проводили с помощью 0,5 мкг случайных гексануклеотидных праймеров (Amersham Pharmacia Biotech). В реальном времени qPCR использовался для обнаружения вирусного генома, как описано ранее [52]. Значения относились к гену GAPDH для домашнего хозяйства. Праймеры использовались как перечисленные: LANA forward (5′-3 ‘): CGAGAGGAAGTTGTAGGAAACG, LANA reverse (5′-3′): CTTCCAGGTATAGGCAAGGTG; Rta forward (5’-3 ‘): TGTAATGTCAGCGTCCACTC, Rta reverse (5′-3′): ATTGCTGGGCCACTATAACC; GAPDH вперед (5’-3 ‘): ACATCGCTCAGACACCATG, GAPDH reverse (5′-3’): TGTAGTTGAGGTCAATGAAGGG.

Для анализа клеточного цикла клетки, закрепленные в 70% этаноле, ресуспендировали в забуференном фосфатом физиологическом растворе с 20 мкг / мл пропидиевого йодида, 200 мкг / мл РНКазы А и 0,1% Тритона Х-100. Для анализа апоптоза клетки окрашивали конъюгированным FITC антителом против аннексина V. Анализ проточной цитометрии проводили с использованием CyAn (Beckman-Coulter, Fullerton, CA). Дальнейший анализ проводился с FlowJo (версия 7.6.5, Tree Star, Inc., Ashland, OR) и R версии 2.15.1 (2012-06-22).

1 × 105 клеток L1T2 подсчитывали после промывки PBS один раз, разбавляли в 100 мкл PBS и смешивали с 100 мкл с уменьшенным фактором роста Matrigel (BD Biosciences, Bedford, MA). 1 × 105 клеток вводили подкожно во фланг мышей SCB C.B.-17 (Jackson Laboratory, Bar Harbor, MN) после наших ранее подтвержденных процедур [53]. Для эксперимента и контроля использовались две группы; в каждой группе было 6 мышей. Мышей наблюдали каждые один или два дня за присутствие осязаемых опухолей. Через три дня после инъекции однократно вводили 50 мг / кг AUY922 или носитель интраперитонеально, как описано ранее [54]. Диаметры опухоли определялись измерениями суппорта. Объем опухоли рассчитывали как V = a * b * c, где a, b и c — три диаметра (длина, ширина и ширина) опухоли. Опухоли вырезали из места инъекции и фиксировали в формалине (Fisher Diagnostics, Middletown, VA).

LANA имеет важное значение для поддержания скрытого KSHV, что является предпосылкой для опухолевого генеза PEL и KS. Таким образом, постоянный интерес представляет идентификация партнеров по связыванию со связями LANA. Ранее мы очищали аутентичные комплексы LANA из линии клеток PEL BC-3 [40]. В контексте PEL (и KS) большая часть LANA привязана к вирусному эпизоду. Чтобы идентифицировать партнеров по связыванию LANA, которые важны для созревания белка и в функциях LANA, которые не тесно связаны с связыванием ДНК, мы стабильно выражаем FLAG-маркированную LANA или мутант в KSHV-отрицательных клетках BJAB (
Рисунок 1А
). Затем мы использовали двухступенчатую хроматографическую изоляцию (Sepharose 6B и Heparin FF) с последующей последовательной иммуноаффинной очисткой (Tag-TAP) с двумя различными моноклональными антителами; мышь против FLAG против метки N-концевого эпитопа и анти-LANA крысы (против повторного эпитопа EQEQE) против центральной области повторения (изложена в
Рисунок 1B
). Ранее мы обнаружили, что гепарин FF связывает интактные комплексы LANA [48] в соответствии с его установленным применением в качестве начального этапа во многих ранних исследованиях выделения факторов транскрипции. Связывающие белки LANA были разрешены на 8-16% градиенте SDS-PAGE (
Рисунок 1С
) и подвергали воздействию MS / MS. Мы идентифицировали белок теплового шока Hsp90-beta (NP_0310381). Мы также обнаружили несколько других белков теплового шока, таких как белок HSPA9 (AAH30634), и теплоизоляцию 71 кДа белковой изоформы1 (NP_006588) (
Таблица 1
). Это подтверждает нашу предшествующую работу, где мы совместно очистили HSP как один из многих партнеров по связыванию подлинной полной длины LANA в PEL [40]. Чтобы подтвердить наши эксперименты и из-за потенциальных неспецифических взаимодействий с центральной областью повтора, мы создали стабильную линию клеток BJAB, экспрессирующую мутантный белок LANA, который имел удаление центральной области повторения и который был спроектирован так, чтобы иметь как FLAG, так и HA на N-конце (
Рисунок 1А
). Снова мы выполнили очистку Tag-TAP на ядерных экстрактах (
Рисунок 1D
), разрешали индивидуально связанные белки на SDS-PAGE (
Рисунок 1E
) и идентифицировали видимые полосы MS / MS. Результат подтвердил связь с членами семейства Hsp (
Таблица 2
). Эти три независимые биохимические очистки с использованием различных антител и различных конструкций «приманки» демонстрируют, что ЛАНА ассоциируется с белками теплового шока в клетке и что это взаимодействие происходит независимо от других вирусных белков или вирусной ДНК.

(A) Схема биохимической очистки приманок, все из которых снесены Hsp90; (1.) немодифицированный LANA дикого типа; (2.), используемого для получения партнеров, перечисленных в таблице 1; (3.), используемый для получения партнеров, перечисленных в таблице 2. Аббревиатуры обозначают эпитопы: F для DYKDDDDK, HA для YPYDVPDYA и EQEQE, которые повторяются в центральном домене LANA. (B) Схематическая процедура очистки комплексов LANA с использованием приманки 2. Образцы элюировали из колонок Sepharose 6B и Heparin FF для очистки отдельно, с последующей иммуноаффинной очисткой с помощью аффинного геля с антигенами M2 мыши и иммунопреципитировали с использованием анти-LANA mab. (C) Анализ SDS-PAGE проводили с помощью градиентного геля 8-16% и окрашивали коллоидным синим. (D) Схематическая процедура очистки мутантных комплексов LANA с использованием приманки 3. (E) Анализ SDS-PAGE проводили с помощью градиентного геля 8-16% и окрашивали коллоидным синим. Со-IP, иммунопреципитация; M, молекулярная масса (в кДа).

HSP: семейство белков теплового шока.

TR: ранее было идентифицировано как связывание KSHV TR [91], [92].

HSP: семейство белков теплового шока.

TR: ранее было идентифицировано как связывание LANS-TR KSHV [91], [92].

RIBO: ранее идентифицировано как привязка LANA в PEL [40].

Чтобы исследовать взаимодействие между LANA и Hsp90, мы использовали WT FLAG-tagged LANA и FLAG-меченные производные, N-терминалы или C-терминалы LANA (или оба). После совместной трансфекции полноразмерных FLAG-меченых LANA (или LANA-мутантов) и HA-tagged-Hsp90 в клетках HeLa иммунопреципитацию проводили с анти-FLAG-антителом для наживки комплексов Hsp90; комплексы, разделенные SDS-PAGE и ассоциированным белком, обнаруженные анти-HA-антителом. Мы обнаружили, что LANA полной длины привязана к Hsp90 и что N-терминал LANA, но не C-терминал, взаимодействует с Hsp90 (
Рисунок 2A
). Обратный иммунопреципитационный анализ показал, что Hsp90 связывается с полноразмерным LANA (
Рисунок 2B
). Этот эксперимент подтвердил, что N-терминальная LANA ассоциируется с Hsp90.

(A) Взаимодействие между Hsp90 и LANA или соответствующими LANA-мутантами в клетках HeLa. HA-меченный Hsp90 был совместно трансфицирован с Flag-tagged полноразмерным LANA (aa1-1162) или указанными мутантами: Flag-tagged LANA-N (aa1-329, pDD1928), отмеченный флагом LANA-C (aa930-1162, pDD1931), или с меткой LANA N + C (aa1-329 и 928-1162, pDD775). Экстракты белков были иммунопреципитированы антителом против Flag с последующим иммуноблоттингом с антителами против HA, IgG использовали в качестве контроля. Входные образцы были получены из супернатантов клеточных лизатов. Маркеры MW в kD указаны слева. (B) Обратное иммунопреципитация. HA-tagged Hsp90 вместе с Flag-tagged LANA ко-трансфицировали в клетки HeLa, для контроля использовали пустой вектор pcDNA. Экстракты белков были иммунопреципитированы антителом против HA и иммуноблоттированы антителом против LANA. Входные образцы были получены из супернатанта клеточного лизата. (C) Анализ локальной локализации LANA и Hsp90. Иммунофлуоресцентный анализ проводили после фиксации и пермеабилизации клеток TIVE-L1, инкубировали с первичными антителами против LANA и мышиных антител против Hsp90 к кролику и антителами против антител против кроликов Texas (красный) и против мышиных FITC (зеленых), соответственно. Ядерные фракции окрашивали DAPI, изображения наблюдались под флуоресцентным микроскопом.

Поскольку локализация LANA строго ограничена ядром, тогда как Hsp90 распределяется в цитоплазме, а в инфицированных вирусом клетках также наблюдается в ядре [55], мы исследовали, как обе локализуются оба белка. Мы использовали KSHV положительную эндотелиальную опухолевую клетку TIVE-L1 [23]. Клетки инкубировали с кроличьим анти-LANA и мышиным антителом против Hsp90 и визуализировали с использованием соответствующих вторичных антител (конъюгированных с Texas Red или FITC) (
Рисунок 2C
). LANA находилась в ядрах клеток TIVE-L1 (красный) в характерном шаблоне пунктуации. Часть Hsp90 была распределена в ядрах, как описано ранее [56], и большая часть из них в цитоплазме (Green). Доля LANA и Hsp90, локализованная в ядре (желтый). В настоящее время неясно, представляют ли эти ко-локализующие комплексы функциональные комплексы привязки эписомы или тупиковые сложенные скопления.

Чтобы запросить функциональную значимость взаимодействия LANA-Hsp90, мы использовали химические ингибиторы Hsp90. Ингибитор Hsp90, 17-диметиламиноэтиламино-17-демэтоксигельданамицин (17-DMAG) разрушает комплексы Hsp90-client и снижает уровень белка клиента, например. REV1, BCL6 или FANCA, после последующей протеасомной деградации [56], [57], [58]. Мы предположили, что 17-DMAG также может нарушить взаимодействие между LANA и Hsp90. Чтобы проверить эту гипотезу, мы обработали клетки BCBL-1 0,5 мкМ 17-DMAG в 0, 3, 6, 12, 24 часа, затем иммунопреципитировали LANA с использованием моноклонального антитела крысы с последующим иммуноблоттинговым анализом антителом против Hsp90. LANA отсоединяли от Hsp90 после инкубации с 17-DMAG в течение 6 часов (
Рисунок 3A
). В 24 часа мы впервые наблюдали снижение входных уровней LANA, преимущественно в нижних полосах. Это ожидается из-за длительного периода полураспада LANA. Более выраженные эффекты на общие уровни LANA наблюдаются только через 48 часов (рисунок 4). Сроки экспериментов с цитотоксическим ингибитором несколько сложны, поскольку мы пытаемся измерить биохимический эффект при наивысшем ингибировании Hsp90, но в то время, когда клетки уже не мертвы.

(A) клетки BCBL-1 собирали после обработки 0,5 мкМ 17-DMAG в течение 0, 3, 6, 12, 24 часов отдельно, лизаты клеток иммунопреципитировали с моноклональным антителом против LANA крыс с последующим иммуноблоттинговым анализом с помощью мышиного анти- Hsp90 и анти-LANA-антитела. Входные образцы были получены из супернатантов лизированных клеток. (B) клетки BCBL-1 собирали после обработки 0, 10, 100 и 1000 мкМ AUY922 отдельно в течение 24 часов, клеточные лизы использовали для иммунопреципитации с помощью антител против Hsp90 и антител против p53, а затем иммуноблоттинг-анализ с анти- LANA. (C) клетки Hela трансфицировали вектором LANA, обработанным без лекарственного средства (ДМСО) или 0,1 мкМ AUY922 в течение 24 часов. Иммунопреципитацию проводили с крысиным анти-LANA-антителом с последующим иммуноблоттинговым анализом с анти-LANA и антителами против Hsp90; IgG использовали в качестве контроля.

Чтобы подтвердить результаты 17-DMAG, мы использовали новый высокоспецифичный ингибитор АТФ-Hsp90 AUY922 [54], [59], [60], [61], [62], [63]. Клетки BCBL-1 обрабатывали AUY922 в течение 24 часов при возрастающих концентрациях с последующим иммунным осаждением с использованием антитела против Hsp90 и иммуноблоттингом с анти-LANA-антителом. AUY922 нарушили комплексы LANA-Hsp90 в клетках BCBL-1 при 10-100 нМ (
Рисунок 3B
). Мы и другие ранее показали, что LANA связаны p53 [46], [48], [64]. Как и ожидалось, комплексы LANA: p53 также уменьшались в том же диапазоне концентраций.

Чтобы продемонстрировать независимость этих взаимодействий от других вирусных белков и вирусной ДНК, мы провели переходные трансфекции. Клетки HeLa трансфицировали вектором экспрессии LANA в течение 24 часов, после чего AUY922 добавляли в течение 5 часов после трансфекции. Снова ингибитор Hsp90 дезассоциировал Hsp90 из комплексов LANA (
Рисунок 3C
). В этих экспериментах использовали неспецифический IgG в качестве контроля. Это демонстрирует, что функциональное ингибирование Hsp90 приводит к нарушению комплекса Hsp90-LANA.

Известно, что 17-DMAG ускоряет деградацию клиентских белков Hsp90 [57], [58]. Чтобы проверить гипотезу о том, что 17-DMAG оказывает аналогичное влияние на стабильность ЛАНА, мы контролировали уровни белка ЛАНА после блокирования синтеза белка de novo с циклогексимидом (CHX). Поскольку Hsp90 связывается с N-терминалом LANA, но не с C-терминалом (
Рисунок 2A
), мы сначала определили период полураспада N- и С-концевых белков LANA. Используя переходную трансфекцию в клетках Hela, мы определили, что N-концевой домен LANA был значительно более стабильным, чем C-терминальный домен LANA (
Рисунок 4A
), что согласуется с нашей гипотезой о том, что связывание Hsp90 с N-терминальным доменом способствовало общей стабильности. Затем мы сравнили период полураспада транзисторно трансфицированного полноразмерного LANA после лечения 17-DMAG для лечения транспортным средством. 17-DMAG уменьшил период полураспада LANA на несколько часов по сравнению с контролем транспортного средства (
Рисунок 4B
), не влияя на уровни актина. Эти данные были количественно оценены, как показано на рисунке 4, панели C и D. Это устанавливает LANA в качестве клиентского белка Hsp90.

(A) Анализ полужизни в терминах LANA. N- или C-концы векторов LANA, помеченных флагом, трансфицировали отдельно в клетки HeLa в течение 16 часов с последующей обработкой циклогексимидом (CHX) в течение 0, 3, 6, 12, 24 и 48 часов. Лизаты целых клеток иммуноблоттировали антителом против Flag. Для контроля загрузки использовался β-актин. (B) Деградация LANA, вызванная 17-DMAG. Клетки HeLa трансфицировали полноразмерным LANA в течение ночи с последующей инкубацией с носителем или 0,5 мкМ 17-DMAG в присутствии 50 мкг / мл циклогексимида в течение 0, 3, 6, 12, 24 и 48 часов соответственно, лизаты целых клеток были иммуноблоттинг с анти-ЛАНА. (C-D) Количественный анализ приведенных выше результатов. (E-F) деградацию LANA, ингибированную MG-132 или лактацистином. После трансфекции с помощью ЛАНА-вектора клетки Hela обрабатывали без лекарственного средства или 17-DMAG (1 мкМ) в течение 24 часов в отсутствие (-) или присутствия (+) ингибитора протеасомы MG-132 (10 мкМ) в течение последних 6 часов или лактацистина (10 мкМ) в течение 24 часов, лизы целых клеток иммуноблоттировали антителом против LANA. (G) Протеазомальная деградация LANA в клетках BCBL-1. BCBL-1 обрабатывали в течение 24 часов без лекарственного средства или AUY922 (0,1 мкМ) в отсутствие (-) или присутствия (+) ингибитора протеасомы MG-132 (10 мкМ) в течение последних 6 часов, лизаты целых клеток были иммуноблоттированы анти-LANA-антитела. (H) Полиубиквитинированная деградация ЛАНА. Клетки HeLa трансфицировали LANA с последующей обработкой без лекарственного средства или 1 мкМ 17-DMAG в течение 24 часов в присутствии ДМСО или 10 мкМ MG-132 в течение последних 6 часов. Клеточные лизаты иммунопреципировали крысиным анти-LANA-антителом с последующим иммуноблоттингом с кроличьими антителами против ubiquitin и ant-LANA, в скобках показан поли-убиквитинированный LANA (Ub-LANA). (I) Иммунофлуоресцентный анализ деградации ЛАНА. Клетки L1T2 обрабатывали без лекарственного средства или 1 мкМ 17-DMAG в течение 48 часов, инкубировали с первичным анти-LANA (кроликом) и после фиксации и пермеабилизации, окрашивали антителами против кроликов Техас-Красного конъюгата (красный, LANA), ядрами окрашенных DAPI.

Как ухудшилась ЛАНА после торможения Hsp90? LANA, накопленный после лечения протеасомными ингибиторами Lactacystin и MG-132 в присутствии 17-DMAG (
Рисунок 4E-F
). В качестве контроля использовали cdc2, который является установленным клиентским белком Hsp90 [65]. MG-132 также увеличивался в эндогенных уровнях LANA в клеточной линии PBL BCBL-1 после лечения AUY922 (
Рисунок 4G
). Уровни ЛАА не влияли на ингибитор аутофагии 3-метиладенин (данные не показаны). Эти эксперименты сложны, так как они требуют титрования двух препаратов против двух белков, cdc2 и LANA, с разными периодами полураспада и различными зависимостями от Hsp90. Тем не менее они предполагают, что LANA, как и другие клиентские белки Hsp90, деградирует по протеосомному пути.

Чтобы независимо подтвердить этот эксперимент, мы исследовали поли-убиквитинилирование LANA в ответ на 17-DMAG, что представляет собой один из признаков входа в протеосомный путь деградации. Клеточные лизаты полноразмерных LANA-плазмид-трансфецированных клеток HeLa, обработанных 17-DMAG или контрольным аппаратом в присутствии MG-132, использовали для иммунопреципитации антителом против LANA. Иммунопреципитаты подвергали SDS-PAGE с последующим иммуноблоттингом с анти-LANA или антителом против ubiquitin. Следует отметить, что сам LANA является очень большим белком и работает на вершине даже с низким процентом гелей SDS-PAGE. Некоторые убиквитинированные ЛАНА присутствовали в клетках после лечения только MG132, но ингибирование Hsp90 резко увеличивало поли-убиквитинирование ЛАНА, как обнаружено мазком в присутствии 17-DMAG (
Рисунок 4H
). Это демонстрирует, что Hsp90 нацеливает Miss-folded LANA на деградацию через протеосомный путь на основе ubiquitin.

Ингибирование Hsp90 изменило характерный образец ядерного акцента LANA. Когда мы добавляли 17-DMAG в клетках L1T2 в течение 48 часов при концентрации 0,5 мкМ, специфическое окрашивание LANA изменялось от пунктирной структуры на более мелкие точки, нерегулярно распределенные по всему ядру (
Рисунок 4I
). Этот результат подтверждает наши биохимические эксперименты и предполагает возможность того, что активность Hsp90 требуется для поддержания мультимерных комплексов LANA.

Чтобы определить, влияют ли ингибиторы Hsp90 на транскрипцию LANA, мы исследовали уровни мРНК LANA. BC-3, BCBL-1, BCP-1 и BC-1 обрабатывали 0,5 мкМ 17-DMAG на 0, 12 и 24 часа, а уровни мРНК измеряли qPCR в реальном времени. Относительная экспрессия была рассчитана путем сравнения с генным оператором GAPDH. Уровни мРНК LANA не изменялись при ингибировании Hsp90 (данные не показаны). Мы также исследовали уровни мРНК RTA, необходимого немедленного раннего гена KSHV. Уровни RTA также не изменились. Это продемонстрировало, что LANA и Rta не были подвержены влиянию ингибирования Hsp90 на уровне транскрипции, что означает, что снижение уровня белка LANA не вызвано репрессией транскрипции после лечения наркотиками.

Вирус Эпштейна-Барра (EBV) кодирует функциональный, но не гомологичный последовательности для LANA, ядерный антиген EBV 1 (EBNA1). Оба белка имеют много общих черт: оба ответственны за привязку вирусного эпизода к ДНК хозяина в инфицированных клетках, и оба белка имеют уникальный центральный повторный домен, который связывает N-конец с C-терминальной ДНК-связывающей областью. EBNA1 содержит повтор Gly-Ala, который опосредует усиление экспрессии EBNA1 Hsp90 [66]. LANA имеет кислотную область повторного центрального повторения (CR), насыщенную QED, которая служит в качестве соединителя. Поэтому мы сравнили эффект ингибирования Hsp90 на LANA на EBNA1 в транзиторно трансфецированных клетках HeLa. Уровни белка LANA постепенно снижались в дозозависимом режиме после лечения 17-DMAG в течение 48 часов. Здесь cdc2 был выбран в качестве клеточного контроля, так как он является известным субстратом Hsp90 [65] (
Рисунок 5A
). Уровни белка EBNA1 также быстро снижались даже при очень низких концентрациях 17-DMAG (
Рисунок 5B
). Важно отметить, что уровни белков LANA-мутанта, в которых был удален кислотный центральный повтор (LANA Mu (N + C)), также уменьшались после лечения 17-DMAG (
Рисунок 5C
). Мы использовали актин в качестве контроля загрузки, а cdc2 — как контроль ингибирования Hsp90. Это показывает, что центральный регион LANA не опосредует взаимодействие Hsp90. Это согласуется с нашими данными сопоставления, которые показали, что Hsp90 связал N-терминальный домен LANA. Это говорит о том, что молекулярный механизм Hsp90-опосредованной стабилизации LANA отличается от молекулярного механизма опосредованной Hsp90 стабилизации EBNA1.

(A-C) HeLa трансфицировали плазмидами, включая полноразмерный LANA, LANA-мутант (удаленный повторный центральный домен) и EBNA1, соответственно, в 6-луночные планшеты с последующей обработкой 17-DMAG в концентрациях 0, 0,1, 0,5, 2,5 и 10 мкМ в течение 48 часов. Лизаты целых клеток каждого образца иммуноблоттировали антителами против LANA и анти-Flag, Cdc2 и β-актином использовали в качестве контролей.

Продемонстрировав, что Hsp90 является важным молекулярным шапероном LANA, мы исследовали потенциал ингибиторов Hsp90 как анти-PEL-опухолевую терапию. Мы использовали расщепленный каспазу-3 в качестве маркера для гибели клеток. Мы обрабатывали клетки PEL ингибитором Hsp90 17-DMAG в разных концентрациях (0,01, 0,5 и 2,5 мкМ) в течение 48 часов. Клетки BC-3 и BCBL-1 были более чувствительны к 17-DMAG по сравнению с BCP-1 и BC-1. Появление расщепленной каспазы-3 в качестве маркера апоптоза было при более низких концентрациях 500 нМ и 100 нМ в BC-3 и BCBL-1 соответственно (
Рисунок 6

A и C). Выражение ЛАНА также было легко уменьшено при субмикромолярных концентрациях ингибитора. Апоптоз в PEL включает p53, и этот фенотип коррелирует с состоянием p53 [67]. BC3 и BCBL-1 имеют функциональный p53 дикого типа и более чувствительны к 17-DMAG, BCP-1 и BC-1 имеют мутант p53 и менее чувствительны к 17-DMAG. Конечно, статус p53 не является единственным отличием среди этих [68]. Они потребовали 2,5 мкМ 17-DMAG для индуцирования расщепления каспазы-3.

(A-D) ингибиторы Hsp90 подавляют экспрессию LANA в клетках PEL. Клетки PEL, включая клетки BC-3, BCP-1, BCBL-1 и BC-1, обрабатывали 17-DMAG в концентрациях 0, 0,1, 0,5, 2,5 и 10 мкМ и через 48 часов лизаты целых клеток были иммуноблоттированы в качестве контролей использовали анти-LANA, анти-Hsp90, анти-Akt и анти-расщепленные антитела каспазы-3, Cdc2 и β-актин. (E-G) Апоптоз. Клетки PEL, включая клетки BC-3, BCP-1, BCBL-1 и BC-1, обрабатывали соответственно ингибиторами Hsp90 17-DMAG и PU-H71 в концентрациях 0, 1 и 10 мкМ и 10 мкМ или 0 , 0,1 мкМ AUY922 в течение 24 часов, процент апоптоза анализировали после того, как клетки PEL собирали и окрашивали.

В качестве дополнительного клеточного контроля Hsp90 мы исследовали Akt, который является известным клиентским белком Hsp90. Сигналы Akt и Akt / mTOR необходимы для роста PEL [51], [69]. Акт снижался во всех клетках ПЭЛ дозозависимым образом после 17-DMAG-лечения, как и cdc-2. Опять же, в BC-3 и BCBL-1 экспрессия cdc-2 была отменена при ингибировании 100 нМ, тогда как 500-2500 нМ были необходимы для того, чтобы показать аналогичную понижающую регуляцию cdc-2 в клетках BCP-1 и BC-1 (
Рисунок 6 A-D
). В целом, многочисленные белки-клиенты Hsp90 деградируют при экспонировании PEL до 17-DMAG, многие из которых (LANA, K1 [50], Akt) с известными онкогенными ролями в опухолегенезе PEL.

Чтобы расширить наши наблюдения в отношении терапевтического потенциала ингибиторов Hsp90 для PEL, мы обработали несколько линий клеток PEL тремя различными ингибиторами Hsp90 в разных концентрациях в течение 24 часов, как указано, и измеренный апоптоз проточной цитометрией для аннексина V (
Рисунок 6E-G
). Мы использовали 17-DMAG, AUY922 и третий, новый АТФ-конкурентный ингибитор Hsp90 PU-H71 [70]. Все индуцированные апоптоз дозозависимым образом (p≤5 * 10-16, по ANOVA). Наиболее чувствительный бета-3 р53 р53-типа был самым чувствительным, а мутантный р53-мутант BCP-1 — наименее чувствительной клеточной линией, не зависящей от лекарственного средства и концентрации (p≤0,015 для BCP-1, p≤0,003 для BC3, на основе ANOVA. BCP-1 и BC3 были p≤0,000001 на основе теста Tukey-HSD). Клетки BC-3 показали 38,7% апоптоза, тогда как клетки BCP-1 показали только 18% апоптоза при лечении 10 мкМ 17-DMAG. Все линии PEL выглядели более чувствительными к AUY922, чем к двум другим препаратам, хотя это не достигало уровня статистической значимости при 95% -ном уровне доверия к семье (
Рисунок 6F
). Как и во всех исследованиях химического ингибитора, мы не можем исключать, что дифференциальная чувствительность зависит от различного поступления и выхода препарата из клетки. В целом, установленные и новые ингибиторы Hsp90 ингибируют рост клеток и апоптоз в клетках PEL.

Для защиты от нежелательных эффектов химических ингибиторов Hsp90 мы использовали рекомбинантные лентивирусы. Два вектора Sh-A и Sh-B, которые нацеливают Hsp90, трансдуцируют в BCBL-1; в качестве контролей использовали пустой лентивирус или необработанные клетки. Уровни белка Hsp90 были значительно снижены по сравнению с необработанными клетками при специфической трансдукции shRNA либо sh-A, либо sh-B, но не имели никакого отношения к контролю (
Рисунок 7
). После истощения Hsp90 уровни белка LANA и белков-контрольных белков-хозяев Akt уменьшались по сравнению с контрольными. Лентивирус Sh-A был несколько более эффективным, чем Sh-B, а также использовался в клетках BC-1 с тем же результатом: при уменьшении Hsp90 уровень ЛАНА также уменьшался. В то же время уровни экспрессии как расщепленных PARP, так и Caspase-3 были увеличены, что свидетельствует об апоптозе. Это демонстрирует, что Hsp90 необходим для выживания PEL и что прямое ингибирование Hsp90, а не от целевого эффекта лекарств, обеспечивает терапевтическую эффективность ингибиторов Hsp90 против PEL.

Клетки BCBL-1 и BC-1 были инфицированы рекомбинантными лентивирусами, нацеленными на Hsp90 в 6-луночные планшеты; в качестве контролей использовали пустой лентивирусный вектор и необработанные клетки. Образцы собирали через 4 дня и иммуноблоттировали антителами против LANA, анти-Hsp90 и анти-Akt соответственно. Апоптоз оценивали с помощью иммуноблоттинга с помощью анти-расщепленных антител PARP и Caspase-3 отдельно. В качестве контроля загрузки использовался β-актин.

В дополнение к PEL, который является В-клеточной лимфомой, KSHV также связан с развитием KS, опухоли эндотелиальной линии. Чтобы исследовать потенциал ингибиторов Hsp90 в качестве новой анти-KS-терапии, мы использовали культуру KS и модели животных. Линия клеток L1T2 была установлена ​​из KSHV-положительных клеток L1-TIVE [23]. Он более агрессивен, чем родительская линия, и легко вызывает опухоли у мышей SCID (Roy и Dittmer, представленные). Клетки L1T2 обрабатывали с увеличением дозы AUY922 в течение 48 часов (
Рисунок 8A
). Иммуноблоттинг подтвердил, что уровни белка ЛАНА были снижены дозозависимым образом. Уровни белка Cdc2 использовали в качестве контроля ингибирования Hsp90, а также снижали дозозависимым образом. Уровни белка Actin использовали в качестве контроля для загрузки и оставались постоянными независимо от дозы AUY922. При такой же концентрации, что уровни cdc2 снижались, уровни Akt и фосфорилированного белка Akt были снижены. Это подтвердило специфичность ингибитора для Hsp90. Расщепленная каспаза-3 была увеличена. Аналогичные результаты наблюдались в другой модели клеток KS после лечения другим ингибитором Hsp90. SLK-KSHV [47] обрабатывали 17-DMAG различными дозами (0, 0,1, 0,5, 2,5 и 10 мкМ) и раз (0, 12, 24, 48, 72 и 96 ч), а уровни белка ЛАНА были снижены в зависимость от дозы и времени (
Рисунок 8
ДО НАШЕЙ ЭРЫ
). Обратите внимание, что в этой модели рост клеток не зависит от LANA, который поддерживает понятие LANA как прямой целевой Hsp90.

(A) Клетки L1T2 обрабатывали AUY922 при концентрациях 0, 0,02, 0,1, 0,5 и 2,5 мкМ в течение 48 часов, лизаты целых клеток иммуноблоттировали анти-LANA, анти-Hsp90-антителами, анти-EphA2, анти-эфрин- B2 и анти-Akt (общий), и антитела против pAkt (S473) отдельно. Апоптоз оценивали с помощью анти-расщепленных PARP и анти-расщепленных антител Caspase-3, Cdc2 и β-актин использовали в качестве контролей. (B-C) SLK-KSHV обрабатывали 0,5 мкМ 17-DMAG в течение 0, 12, 24, 48, 72 и 96 часов или в концентрациях 0, 0,1, 0,5, 2,5 и 10 мкМ в течение 48 часов отдельно клеточные лизаты иммуноблоттировали антителом против LANA, в качестве контролей использовали анти-EphA2, анти-EphrinB2, Cdc2 и β-актин.

KS-опухолегенез является более сложным, чем опухолевый генез PEL, поскольку перевоспитание KSHV, по-видимому, способствует преобразованному фенотипу [47]. Недавно тирозинкиназа рецептора EphA2 была включена в качестве корецептора для KSHV [34], [35]. Hsp90 является важным регулятором стабильности EphA2 [71]. Поэтому мы протестировали гипотезу о том, что EphA2 также является клиентским белком Hsp90 в KS. Экспрессия EphA2 была уменьшена в двух клеточных линиях KS (L1T2, SLK-KSHV) после лечения двумя различными ингибиторами Hsp90 (
Рисунок 8
). Снижение EphA2 было как зависимым от дозы, так и зависящим от времени, подтверждая, что в KS, как и в других раках, EphA2 является клиентом Hsp90.

KS также экспрессирует ephrin-B2, но не его рецептор EphB4. Ephrin-B2 имеет решающее значение для выживания опухолевых клеток KS, в то время как EphB4 снижает активность KSHV-инфекции [19], [20], [72]. Поэтому мы протестировали гипотезу о том, что на ephrin-B2 также влияет ингибирование Hsp90 в KS. Уровни белка EphrinB2 уменьшались в различных линиях клеток KS после лечения ингибиторами Hsp90 в зависимости от дозы и времени (
Рисунок 8
). Это первое исследование, предполагающее, что ephrin-B2 является потенциальным клиентом Hsp90. Как и PEL ранее, мы также обнаружили, что общий уровень белка Akt и фосфорилированный Akt (S473) были уменьшены в клетках L1T2 при воздействии AUY922. Это коррелирует с зависящим от времени увеличением уровней расщепленных PARP и каспазы-3, которые являются маркерами апоптоза (рис. 9A). Это демонстрирует, что ингибирование Hsp90 снижает уровень клиентских белков вирусной (LANA) и хозяина (EphA2, ephrin-B2, Akt) в KS, что приводит к гибели клеток.

(A) Анализ образования колоний клеток L1T2 после лечения наркотиками. 400 клеток L1T2 высевали в 10 см-чашки с последующим добавлением двухкратно разведенных последовательно ингибиторов Hsp90; 17-DMAG, PU-H71, AUY922, BIIB021 и NVP-BEP800, соответственно, в течение двух недель. Колонии подсчитывали после инкубации с Magic Blue Staining, каждый эксперимент повторяли три раза. (B) Ингибиторы Hsp90 индуцируют остановку G0 / G1 клеток L1T2. Клетки L1T2 обрабатывали 0,5 мкМ 17-DMAG, PU-H71, NVP-BEP800, BIB021 или 0,05 мкМ AUY922 в течение 24 часов, в качестве контроля использовали ДМСО-обработку. После того как клетки фиксировали и окрашивали иодидом пропидия, анализ клеточного цикла проводили с использованием проточной цитометрии. Показаны проценты клеток на разных этапах клеточного цикла (G0 / G1, S, G2 / M). (C) Кривые роста объема опухоли. 105 клеток L1T2 вводили подкожно в мышей CB-17 SCID со смешанным Matrigel (1:1) в течение трех дней с последующей интраперитонеальной инъекцией AUY922 в дозах 50 мг / кг NVP-AUY922 в течение трех недель (три раза в неделю) измеряли и анализировали объемы опухолей SCID-мышей. Были проанализированы две группы и каждая группа имела шесть мышей, в качестве контроля использовали мышей, обработанных методом лечения.

Чтобы расширить наши наблюдения, мы измерили влияние ингибиторов Hsp90 на рост клеток KS. Во-первых, мы использовали систему xCELLigence для измерения пролиферации в реальном времени, и мы добавили два дополнительных ингибитора Hsp90, BIIB021 и NVP-BEP800. SLK-KSHV, L1T2, SLK и KS-IMM обрабатывали отдельно с помощью 17-DMAG, PU-H71, AUY922, BIIB021 и NVP-BEP800. Значения IC50 определялись на основе кривых роста в реальном времени с использованием системы XCelligence (
Таблица 3
). Все ингибиторы Hsp90 имели наномолярные IC50. AUY922 был наиболее эффективным среди этих пяти препаратов. Он имел одиночный наномолярный или даже субнамомолярный IC50 против всех клеточных линий, который был на порядок ниже IC50 для других ингибиторов Hsp90. NVP-BEP800 был наименее эффективным, возможно, из-за слабой растворимости [73].

Все концентрации находятся в nM и результат серии титрования с 7 концентрациями препарата каждый в n = 2 индивидуальных экспериментах по титрованию. Также показан диапазон отношений для IC50 для SLK по сравнению с изогенными клетками SLK-KSHV. Это можно интерпретировать как показатель селективности KSHV-положительного по сравнению с отрицательными клетками KSHV.

Результаты также показали, что каждый ингибитор Hsp90 был более эффективным в KSHV-положительных клетках SLK по сравнению с изогенными KSHV-отрицательными клетками SLK. Это количественно определено в таблице 3, где показан диапазон отношений, сравнивающих IC50 клеток SLK с клетками SLK, несущими KSHV. Это демонстрирует, что опухоли KS / эндотелиальной линии чрезвычайно чувствительны к ингибированию Hsp90, и что часть этого фенотипа может быть отнесена к присутствию латентных белков KSHV.

Чтобы независимо проверить эффективность ингибиторов Hsp90, мы провели клонирование образования колонии. Все препараты ингибировали рост клеток с помощью наномолярных IC50. AUY922 снова был наиболее эффективным среди пяти препаратов в этих анализах, с IC50 2 нМ (
Рисунок 9A
).

В-третьих, мы провели анализ клеточного цикла. Клетки L1T2 обрабатывали 500 нМ 17-DMAG, PU-H71, BIIB021, NVP-BEP800 или 50 нМ AUY922 в течение 24 часов и подвергали профилированию клеточного цикла с использованием окрашивания пропидиум йодидом. В качестве контроля использовали ДМСО-обработку. Клетки прекращали циклирование с уменьшением S-фазы, что составляло 20,47% для контроля и <9,5% для каждого из пяти образцов, обработанных лекарственным средством. В то же время доля клеток G0 / G1 увеличилась с 58,77% для контроля до 69,19% -73,67% в каждой из пяти клеток, обработанных лекарственным средством. AUY922 был столь же эффективен, как и другие четыре ингибитора, даже если он использовался в 10-кратной более низкой концентрации ( Рисунок 9B ). В целом, ингибиторы Hsp90 подавляют пролиферацию опухолевых клеток KS в наномолярных концентрациях.

Чтобы дополнительно исследовать противоопухолевую активность AUY922, мы подкожно вводили SCID-мыши с KSHV-инфицированными клетками L1T2 (105 / мышь), как было опубликовано ранее [53]. При развитии осязаемых опухолей мышей были рандомизированы на две группы и с AUY922 (50 мг / кг) в течение трех недель (три раза в неделю) или на транспортном средстве. Все животные были принесены в жертву через 21 день в соответствии с положениями IACUC. AUY922 значительно замедляет рост опухоли по сравнению с мышами, обработанными ими (p≤0,05 путем повторного анализа дисперсии (ANOVA)) (
Рисунок 9C
).

Чтобы продемонстрировать молекулярную активность AUY922 in vivo, мы измерили уровни белка клиента Hsp90 в опухолевых трансплантатах путем иммунной гистохимии (
Рисунок 10
). Никакое окрашивание не наблюдалось без первичных антител. (i) Как и ожидалось [74], [75] фосфорилированный Akt обнаруживался во всех жизнеспособных опухолевых клетках (за исключением тех, которые были в сжиженных или некротических зонах). Уровень фосфорилирования Akt был значительно снижен после обработки AUY922. (ii) LANA была обнаружена в ядрах опухолей ксенотрансплантата KS, а уровни ЛАНА были уменьшены после лечения. (iii) экспрессия ephrin B2 экспрессировалась на значительных уровнях во всех клеточных линиях KS, и наши иммуногистохимические результаты выявили эфрин B2, в сосудистых структурах и опухолевых клетках в опухолях ксенотрансплантата KS. Уровни Ephrin B2 были значительно уменьшены после лечения AUY922. Эти эксперименты подтверждают, что LANA, AKT и ephrinB2 являются доброкачественными мишенями Hsp90 в опухолях KS in vivo и обеспечивают доказательство принципа использования ингибиторов Hsp90 в качестве потенциальной анти-KS-терапии.

Твердые опухоли вырезали из ложных или обработанных лекарственными средствами мышей с последующим окрашиванием иммуногистохимическим методом с использованием антител, специфичных для p-Akt, LANA и Ephrin B2. Для контроля не использовалось никаких конкретных первичных антител. Изображения были сделаны с увеличением 100 × и 400 ×.

Это исследование показывает, что KSHV LANA является новым клиентским белком Hsp90. Hsp90 ассоциируется с N-концом LANA. АТФ-конкурентные ингибиторы Hsp90 нарушают это взаимодействие и уменьшают период полураспада LANA, ускоряя опосредованную ubiquitin, протеасомальную деградацию LANA. LANA играет важную роль в сохранении генома KSHV и опухолегенезе KS [38], [76]. Химическое ингибирование истощения Hsp90 или Hsp90 с использованием shRNAs привело к быстрому апоптозу опухолевых клеток KS и ингибировало рост Xenograft KS у мышей. В дополнение к LANA мы проверяли cdc2, Akt, EphA2 и ephrin-B2 как мишени Hsp90 в KS. В более ранних исследованиях были выявлены дополнительные клиенты Hsp90 в PEL [14], [15], [77]. Это устанавливает Hsp90 как новую мишень для антивирусных и противоопухолевых стратегий в KS и PEL.

Зависимость от Hsp90 распределяется между KSHV LANA и EBV1 EBV1 [66]. Поскольку LANA и EBNA-1 не имеют сходства последовательностей, но они являются структурными и функциональными гомологами, механизм взаимодействия Hsp90 отличается для обоих белков. В случае EBNA1 центральный домен Gly-Ala повторяется для ингибирования Hsp90 [66]; в случае LANA N-терминальный домен опосредует взаимодействие Hsp90, хотя центральная область повторения также может способствовать общей стабильности. EBNA1 деградирует посредством аутофагии после ингибирования Hsp90; LANA деградировали по пути ubiquitin / proteosome. Существует также вопрос о клеточной локализации. Sun et al. [66] не нашел прямого взаимодействия EBNA1: Hsp90 и, следовательно, не запрашивал, где произошло взаимодействие EBNA1: Hsp90. Они сосредоточили свои усилия на трансляции EBNA1 и элегантно показали, что перевод повторения Gly-Ala требует Hsp90 в реакции перевода in vitro. Наши исследования показывают, что LANA влияет на общую стабильность LANA, но также свидетельствует о ядерном взаимодействии. Hsp90 может присутствовать как в цитоплазме, так и в ядре [78], [79], [80], возможно выполняя разные роли в любом отсеке. Совсем недавно ядерные BRCA1 и ДНК-PKA были подтверждены как новые клиентские белки Hsp90 [81], [82], которые вливают Hsp90 в ответ на повреждение / восстановление ДНК. Независимо от механизма, взаимодействие LANA: Hsp90 может быть использовано для уничтожения связанных с KSHV опухолей.

Ингибиторы Hsp90 представляют собой перспективные препараты для лечения рака, и многие из них перешли в клинические испытания фазы I. Ранее мы включили ингибитор Hsp90 17-DMAG в качестве шаперона для белка KSHV K1 и показали, что он обладает активностью против клеток PEL [50]. 17-DMAG и родственные соединения 17-AAG / Tanespimycin и geldanamycin имели различную эффективность в ранних клинических испытаниях из-за токсичности, выбора типа рака-мишени и, возможно, из-за того, что эти соединения являются субстратами для отходящего насоса P-гликопротеина и имеют суб- оптимальная фармакокинетика у людей (обзор в [8]). Кроме того, Hsp90 выполняет важнейшие функции в нормальных клетках, жизненном цикле EBV [66] и фактически литическую репликацию других вирусов (см. [83], [84], [85]). Поэтому было опасение, что очень мощные ингибиторы Hsp90 будут влиять на основные функции клеток неспецифично, и поэтому их индекс селективности будет низким. Например, Hsp90 был вовлечен в созревание сердечного канала калия; однако сердечная токсичность не проявлялась как ограничение дозы в исследованиях фазы I. 17-DMAG и другое производное бензохинона вызывают токсичность печени. Этот фенотип не был связан с ингибированием Hsp90 и побудил экран к ингибиторам Hsp90 второго поколения, которые мы исследовали здесь. Другим потенциальным приложением является, по крайней мере, гипотетически, лечение нейродегенеративных заболеваний, которые приводят к накоплению слитых белков. Требование к Hsp90 в раковых клетках, вирусно инфицированных клетках или клетках, которые накапливают несоизмеримые белки, кажется настолько глубоким, что оно приводит к селективности в клинических условиях для ингибиторов Hsp90 второго поколения; альтернативно было высказано предположение о том, что многобелковый комплекс hsp90 отличается между опухолевыми клетками и нормальными клетками и что это приведет к увеличению доступа к лекарственным средствам к сайтам связывания АТФ Hsp90. На сегодняшний день более 20 различных ингибиторов Hsp90 прошли доклинические исследования токсичности и продвинулись в клинические испытания фазы I [85].

Наши исследования выходили за рамки первого класса 17-DMAG / 17-AAG / geldanamycin структурного класса ингибиторов hsp90 и оценивали четыре новых, полностью синтетических, химически различных АТФ-конкурентных ингибитора: PU-H71, AUY922, BIIB021, BEP800. Все ингибировали рост опухолей KS и PEL при низких концентрациях наномолекул и все уменьшали уровни других известных Hsp90-белков-клиентов, таких как cdc2 и Akt [5]. В то время как все PEL были восприимчивы к ингибиторам Hsp90, мы наблюдали изменение клеточной линии. Этого ожидают, поскольку эти клеточные линии ПЭЭ накапливают как общие, так и клеточные линии геномных изменений [68]. Мы и другие наблюдали аналогичные изменения в других целевых препаратах ранее [51], [64], [67], [69], некоторые из вариантов можно объяснить статусом р53, другие специфические для лекарственного средства изменения еще не определены. Это общий эффект, наблюдаемый практически во всех исследованиях, в которых для чтения используются клеточные линии, а не одна клеточная линия. AUY922 имел самый низкий IC50 (2 нМ) против батареи клеточных линий KS. Это продукт оптимизированной по структуре оптимизации соединений 4, 5-диарилизоксазола, которые блокируют АТФ-связывающий карман Hsp90 [54], [86]. AUY922 ингибировал рост опухоли в модели опухоли ксенотрансплантата KSHV с аналогичной эффективностью, как сообщалось ранее для других анти-KS-соединений [54]. Недавние исследования показали, что в качестве ингибитора малых молекул AUY922 демонстрирует перспективный терапевтический потенциал при различных раковых заболеваниях, таких как рак легких, глиобластома, миелома и т. Д. [59], [60], [61], [63] , KS и PEL теперь могут быть добавлены в список и должны быть включены в ранние фазы клинических исследований этого соединения.

Вероятно, что выраженный противоопухолевый эффект ингибиторов Hsp90 обусловлен снижением регуляции множественных мишеней: LANA, который необходим для поддержания вируса [17], cdc2, Akt, который трансдуцирует сигналы паракрина и аутокринного роста в PEL, KS и другие раковые опухоли [51], активаторы NFkB [15], ephrin-B2 и EphA2, которые поддерживают повторное заражение эндотелиальных клеток KSHV и, таким образом, поддержание опухоли и даже мишени поверхностного Hsp90 [16].

Эфрин и эфриновые рецепторы являются ключевыми молекулами в пролиферации эндотелиальных клеток, опухолегенезе и существенных кофакторах для инфекции KSHV [34], [35]. Эринин-рецепторные тирозинкиназы и их эфриновые лиганды трансформируют сигналы в зависимости от клетки-клетки. Их экспрессия в эндотелиальных клетках способствует ангиогенезу [18], [87], [88]. Мы обнаружили, что две разные молекулы в этой сети являются клиентскими белками Hsp90 в KS: EphA2 и ephrin-B2. Киназу EphA2-рецептора ранее идентифицировали как клиент Hsp90 [29], [30]. Наши исследования показали, что EphA2 экспрессируется в клетках L1T2, SLK-KSHV и KS-IMM и что ингибиторы Hsp90 уменьшают экспрессию EphA2. Ephrin-B2 также играет несколько ролей в созревании сосудов и выражен на значительных уровнях в KS [19], а также в моделях опухолей KS, которые мы исследовали в этом исследовании. Инфекция эндотелиальных клеток KSHV индуцирует экспрессию Ephrin-B2, а Ephrin B2 необходим для выживаемости KS [19]. Блокирование передачи сигналов Ephrin-B2 с внеклеточным доменом EphB4, слитым с человеческим сывороточным альбумином (sEphB4-HSA), подавляло большое количество опухолей, включая KS [19], [20], [31], [89], [90] , Мы обнаружили, что ингибиторы Hsp90 значительно уменьшают экспрессию Ephrin-B2 в множественных опухолевых моделях KS (L1T2, SLK-KSHV), что свидетельствует о том, что подавление эфрин-взаимодействий через ингибиторы Hsp90 способствует их эффективности в опухоли эндотелиальной линии KS.

Мы благодарим лаборатории Dittmer и Damania за критическую дискуссию и советы.

Комментариев нет.

Добавить комментарий

Ваш e-mail не будет опубликован. Обязательные поля помечены *