Нажмите "Enter", чтобы перейти к контенту

Беспристрастный мутагенез MHV68 LANA раскрывает домен привязки ДНК, необходимый для функции LANA In Vitro и In Vivo

Unbiased Mutagenesis of MHV68 LANA Reveals a DNA-Binding Domain Required for LANA Function In Vitro and In Vivo
Источник: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3435236/

Авторы заявили, что не существует никаких конкурирующих интересов.

Задуманные и разработанные эксперименты: CRP JCF SHS. Выполняли эксперименты: CRP JCF. Проанализированы данные: CRP JCF SHS. Используемые реагенты / материалы / инструменты анализа: SAT JCF. Написал документ: CRP SHS.

Ядерный антиген, связанный с задержкой (LANA), кодируемый ORF73, является консервативным геном среди γ2-герпесвирусов (радиновирусов). Саркома-ассоциированный герпесвирус (KSHV) Kaposi последовательно выражен в ассоциированных с KSHV злокачественных новообразованиях. В случае грызуна γ2-герпесвируса, мышиного гамма-вируса 68 (MHV68), гомолог LANA (mLANA) необходим для эффективной репликации вируса, реактивации из латентности и иммортализации мышиных эмбриональных B-клеток. Чтобы узнать о функциях (-ях) mLANA, зная, что KSHV LANA связывает ДНК и может модулировать транскрипцию различных промоторов, мы искали и идентифицировали mlANA-реагирующий промотор, который отображает терминальный повтор (TR) MHV68. Примечательно, что mLANA сильно подавляет активность этого промотора. Мы расширили эти анализы, чтобы продемонстрировать прямое, последовательно-специфическое связывание рекомбинантной ДНК mLANA с TR ДНК с помощью ДНКазы I. Чтобы оценить, важна ли функция связывания ДНК и / или транскрипции в известных фенотипах mLANA, мы создали несмещенную библиотеку точечных мутантов mLANA с использованием ПЦР с ошибкой и скринировали большую группу мутантов для подавления реакции, чувствительной к mLANA промотор для определения потери функциональных мутантов. Примечательно, что среди мутантных белков mLANA многие из мутаций находятся в предсказанной ДНК-связывающей ДНК, подобной EBNA-1. В соответствии с этим прогнозом испытуемые демонстрировали потерю активности связывания ДНК. Мы разработали шесть из этих mLANA-мутантов в геном MHV68 и протестировали полученные мутантные вирусы для: (i) пригодности репликации; (ii) эффективность создания задержек; и (iii) реактивация из латентности. Интересно, что каждый из этих мутантных вирусов mLANA обнаруживал фенотипы, сходные с мутантным вирусом mLANA-нуль, что указывает на то, что связывание ДНК имеет решающее значение для функции mLANA.

Вирусы вируса гамма-вируса человека вируса Эпштейна-Барра (EBV) и связанного с саркомой вируса Капоши (KSHV) тесно связаны с рядом различных видов рака. К сожалению, из-за их очень узкого тетризма хозяев, характеризующих патогенез этих вирусов, было трудно. Инфекция лабораторных мышей геномным гамма-герпесвирусом, мышиным gammaherpesvirus 68 (MHV68), оказалась отличным подходом для понимания того, как эти вирусы вызывают заболевание. Один из кодированных MHV68 белков, который также обнаружен в KSHV, называется LANA, а в случае KSHV-ассоциированных заболеваний LANA-экспрессия последовательно обнаруживается в инфицированных клетках. Здесь мы показываем, что MHV68 LANA разделяет ключевую функцию с гомологией KSHV, а именно, модулируя экспрессию генов. Используя протокол случайного мутагенеза, мы идентифицировали мутантов mLANA, которые потеряли регуляторную активность транскрипции. Мы создали эти мутации обратно в вирус, использовали вирусы для заражения мышей и обнаружили, что эта функция имеет решающее значение для функции LANA in vivo и in vitro. Этот метод в сочетании с полученными здесь знаниями создает основу для будущих исследований для идентификации мутантных форм LANA, которые могут быть использованы для блокирования функции LANA дикого типа или, альтернативно, для разработки лекарств, которые нацелены на функцию LANA.

Радиновирусные инфекции связаны с рядом лимфопролиферативных заболеваний. В случае вируса человека, связанный с саркомой, связанный с саркомой Капоши (KSHV, HHV-8), существует плотная связь между саркомой KSHV и Kaposi (спорадические, эндемичные и связанные с ВИЧ формы саркомы Капоши) [1], а также многоцентровая болезнь Каслмана и первичная эффузионная лимфома [2], [3]. Было показано, что вирус герпетического симири (HVS) индуцирует Т-клеточные лимфомы [4], а мышиный гамма-вирус-68 (MHV68) индуцирует В-клеточные лимфомы [5]. Кроме того, как HVS, так и MHV68 могут увековечить конкретные популяции лимфоцитов в культуре тканей [6], [7]. Общей чертой ассоциированных с KSHV злокачественных новообразований, помимо укрытия скрытого вирусного генома, является последовательное обнаружение латентно-ассоциированного ядерного антигена (LANA) [8], [9].

Считается, что LANA, кодируемая ORF 73 в вирусном геноме, участвует во многих аспектах гамма-герпесвирусной инфекции. Он был обнаружен как антиген, который спекали хромосомы инфицированных KSHV опухолевых клеток, когда опухолевые клетки окрашивали сывороткой KS-пациента [10], [11]. KSHV LANA взаимодействует с рядом клеточных белков, которые влияют на клеточные сигнальные события, включая взаимодействие с опухолевым супрессором p53 [8], [12] — [14]. Было также показано, что KSHV LANA связывает ДНК, которая, как предполагается, имеет важное значение для загрузки истоков репликации [15] — [18], поддерживая вирусный геном как эпизод [14], [15], [19] — [22 ] и регуляции транскрипции генов [16], [23], [24]. Были идентифицированы домены KSHV LANA, необходимые для регуляции транскрипции гена и связывания ДНК [23], [25], [26].

Ранее мы показали, что MHV68 LANA (mLANA) необходим для репликации в естественных условиях in vivo и in vitro, а для реактивации вируса из латентности [21], [27], [28]. Чтобы начать исследовать, как mLANA влияет на репликацию вируса, мы оценили, может ли mLANA модулировать транскрипцию гена и идентифицировать промотор в терминальном повторе MHV68, который сильно подавляется mLANA. Мы использовали это как инструмент для идентификации остатков в mLANA, которые необходимы для функции транскрипционного репрессора. Примечательно, что многие из идентифицированных мутаций, которые устраняют опосредованную mlANA транскрипционную репрессию, находятся в пределах консервативной (среди белков линейного белка рининовируса) C-концевой области mLANA, что соответствует предполагаемому ДНК-связывающему домену. Исследование этих мутаций показывает, что ДНК-связывающая функция действительно нарушена. Мы дополнительно разработали некоторые из этих мутаций в геноме MHV68 и определили, что мутанты mLANA, дефицитные в функции транскрипционного репрессора, оказывают глубокое влияние как на репликацию вируса, так и на реактивацию из латентности.

В предыдущей работе наша лаборатория показала, что вирус mLANA-null (73.Stop) демонстрирует экспрессируемую экспрессию гена, характеризующуюся гипер-экспрессией всех временных классов вирусных генов в ранние моменты времени после инфицирования мышиных фибробластов по сравнению с генетически- (73.MR), как измерено вестерн-блот [27] и RT-PCR (неопубликованное наблюдение Paden и Speck). В эти гиперэкспрессированные гены входит транскрипт гена 73, который кодирует mLANA. Известно, что по меньшей мере один из промоторов для экспрессии mLANA содержится в терминальном повторе, как определено in vivo из инфицированных клеток [29] (см. Схему диаграмм mLANA, показанных на фиг.1А). Также известно, что KSHV LANA может связывать ДНК в терминальном повторе генома KSHV [16] — [18], [30], а KSHV LANA может модулировать экспрессию различных генов [24]. Взятые вместе, мы предположили, что mLANA, вероятно, непосредственно регулирует транскрипцию вирусных генов, включая промотор mLANA в терминальном повторе MHV68. Чтобы проверить эту гипотезу, мы клонировали полную копию терминального повтора MHV68 (используя NotI, который режет только один раз в терминальном повторе, освобождая фрагмент рестрикционной эндонуклеазы 1213 пар оснований) в репортерный вектор pGL4.10 выше по потоку от гена люциферазы светлячков ( PGL-TR). Плазмиду pGL-TR совместно трансфицировали в клеточные линии либо с помощью контрольного родительского экспрессирующего вектора, либо с вектором экспрессии mLANA, и активность люциферазы оценивали через 48 часов после трансфекции (фиг.1B). Репортерный вектор pGL-TR демонстрировал значительную активность в отсутствие экспрессии mLANA. Кроме того, экспрессия люциферазы из плазмиды pGL-TR была сильно ингибирована в присутствии mLANA-GFP (pMSCV-73GFP) (фиг.1B). Примечательно, что наблюдаемая репрессия активности, опосредуемая mLANA, оказалась специфичной, поскольку совместная трансфекция плазмиды экспрессии mLANA-GFP не влияла на репортерную активность, вызванную промотором HSV-TK (фиг.1B).

(A) Схематическая иллюстрация транскрипции гена mLANA, возникающая из 2 различных промоторов, одна в уникальной области, соседствующей с MHV68 TR, а другая внутри TR. Была создана репортерная конструкция люциферазы светлячков, в которой одна копия фрагмента MHV68 TR (Not I) была клонирована перед репортерным геном. Данную репортерную плазмиду использовали в анализах, описанных на панелях B-G. (B). Репортерный вектор, содержащий одну копию NotI-фрагмента TR (pGL-TR), проявляет значительную активацию по сравнению с фонами в клетках HEK 293T. Совместная трансфекция вектора экспрессии mLANA (pMSCV-73GFP) значительно подавляет активность промотора, ассоциированную с TR, но не подавляет промотор HSV-TK. (C) Совместная трансфекция эквивалентного количества экспрессирующей плазмиды KSHV LANA репрессирует транскрипцию TR, а также mLANA. (D) Инфекция с MHV68 дополнительно активирует активность люциферазы TR-5 в 5 раз, а при заражении вирусом mLANA-null (73.Stop) репортерная конструкция люциферазы с TR активируется еще еще (в 33 раза), что указывает роль mLANA в контроле транскрипции из TR во время литической инфекции. (E-G) Промотор (ы) MHV68 TR активен в различных клеточных линиях, а mLANA подавляет его дозозависимым образом. (E) мышиные фибробласты NIH3T12, (F) RAW264.7 мышиный макрофаг и (G) HEK 293T человеческие эпителиальные клетки были совместно трансфицированы 100 нг pGL-TR или пустым репортерным вектором (pGL4.10), наряду с 0, 5, 50 или 500 нг pMSCV-73GFP, каждый из которых сбалансирован в сумме 500 нг с пустым вектором экспрессии (pMSCV-EFGP). Клеточные лизаты анализировали на экспрессию люциферазы через 48 часов. Промотор (ы) TR активен в каждом типе клеток, а активность снижается дозозависимым образом с добавлением экспрессии mLANA. Каждый набор выполняется в трех экземплярах, а данные представлены отношением нормированного RLU (отношение светляка к люмиферазе Ренилла) по нормированному RLU вектора свободных векторов (pGL4.10).

Поскольку существуют существенные различия в N-конце KSHV LANA и mLANA, мы проверили, достаточно ли сохранения последовательности и структуры между гомологами KSHV и MHV68 LANA, чтобы экстраполировать данные о mLANA на вирус человека. Таким образом, мы оценили, может ли KSHV LANA функционально замещаться в анализе репрессий MHV68 TR. Мы совместно трансфицировали клетки HEK 293T с репортерной конструкцией MHV68 TR (pGL-TR) и либо пустой вектор экспрессии, либо вектор экспрессии MHV68 LANA, либо вектор экспрессии KSHV LANA (фиг.1C). Важно отметить, что мы наблюдали (используя эквивалентную величину ввода вектора экспрессии KSHV LANA или mLANA), что и KSHV LANA, и mLANA сильно репрессировали транскрипцию из MHV68 TR. Это указывает на то, что хотя между этими гомологами существует значительная разность аминокислотных последовательностей, а также тот факт, что известные сайты связывания LANS KSHV точно не сохраняются в MHV68 TR, существует достаточное функциональное сходство между двумя гомологами, чтобы выявить консервативную транскрипционную репрессию функция. Таким образом, это дает дополнительную уверенность в том, что исследования в LANA MHV68, скорее всего, обеспечат понимание функции KSHV LANA, особенно в отношении функций, которые отображаются в сохраненный C-терминальный домен.

Чтобы определить, обнаружено ли репликация ЛАН в транскрипции с MHV68 TR в контексте инфекции MHV68, мы ввели репортерную конструкцию pGL-TR в фибробласты NIH 3T12 путем электропорации, за которой следует инфекция MHV68 при множественности 3 PFU / клетка (вирусная инфекция инициировали, как только клетки прилипали к пластинкам культуры примерно через 12 часов после электропорации). Клетки собирали через 18-24 часа после инфицирования и анализировали на активность люциферазы (фиг.1D). Сравнивая индукцию люциферазы с клетками, которые были ложно инфицированы, мы наблюдали, что инфицированные клетки вируса WT (73.MR) проявляли ок. 5-кратное увеличение активности люциферазы, вызванной TR, что указывает на то, что общая транскрипция, возникающая из TR, стимулируется вирусной инфекцией. Тем не менее, клетки, инфицированные мутантным вирусом mLANA-нуль (73.Stop), демонстрировали значительно более высокие уровни активности люциферазы, индуцированной TR (от 30 до 35 раз) по сравнению с ложно инфицированными клетками. Последнее свидетельствует о том, что mLANA играет важную роль в регулировании транскрипции, инициирующей TR, и, вероятно, играет критическую роль в предотвращении чрезмерной экспрессии mLANA во время заражения разрешительных фибробластов (фиг.1D).

Мы продолжили эти начальные исследования, чтобы оценить репликацию mLANA промоторов (-ов) MHV TR в нескольких разных клеточных линиях. Примечательно, что мы наблюдали, что промотор, содержащийся в TR, имел значительную активность в различных типах клеток, включая мышиные фибробласты NIH 3T12 (фиг.1E), линию клеток мышиного макрофагата RAW264.7 (фиг.1F) и эмбриональную эмбрионов человека линии клеток почек HEK 293T (фиг.1G). Кроме того, когда репортерную плазмиду pGL-TR совместно трансфицировали вместе с увеличением количества экспрессирующего вектора mLANA-GFP, во всех исследованных клеточных линиях экспрессия люциферазы снижалась дозозависимым образом (фиг.1, панели E-G ). В совокупности эти данные показывают, что mLANA подавляет транскрипцию, инициирующую из TR, наблюдение, которое согласуется с наблюдаемой гипертранскрипцией транскриптов mLANA (а также с другими вирусными генами) в отсутствие экспрессии mLANA в клетках, инфицированных mLANA-null мутантный вирус (73.Stop) [27].

Чтобы определить, какие последовательности в MHV68 TR участвуют в посредничестве репрессии mLANA, мы взяли два независимых подхода: (i) анализ репликации mLANA панели TR-делеционных конструкций (фиг.2); и (ii) удаление ДНКазы I TR с использованием рекомбинантного белка mLANA (фиг.3). Во-первых, вложенные делеции с любого конца фрагмента эндонуклеазы рестрикции TR NotI были сгенерированы и клонированы в репортерный вектор люциферазы pGL4.10 (фиг.2B). Примечательно, что TR клонируется в репортерный вектор относительно открытой рамки считывания люциферазы в обратной ориентации из аннотированной последовательности [31] (GenBank U97553) (т. Е. Ориентация фрагмента TR согласуется с промоторной активностью, наблюдаемой в контексте вирусного генома, который приведет к расшифровке транскриптов в правый конец уникальной области генома MHV68, такой как ранее описанный для гена 73 и транскриптов гена 72 [29], [32]) (фиг.2А). Как отмечено выше, фрагмент NotI в репортерном векторе представляет собой фрагмент 1213 пар оснований, соответствующий bp 119,105 до bp 118,238, и продолжается от bp 119,450 до bp 119,106 (соединение между копиями TR составляет bp 118,238 / 119,450, как определено из полные последовательности изолята WUMS MHV68 [31]. Чтобы упростить обсуждение последовательности TR, участвующих в посредничестве репрессии mLANA, мы перенумеровали фрагмент NotI TR как нуклеотиды 1-1213, как показано на фиг.2А.

(A) Схема pGL-TR, отмечая схему нумерации в отношении сайта NotI. Координата 1 соответствует MHV68 WUMS [31] bp 119,105, идя по направлению к правому концу уникальной последовательности. Координата 894 — это конец одного блока TR, слитого с началом следующего. На диаграмме показаны два известных участка инициации транскрипции: (i) (73p1) начинает транскрипцию между координатами 423-466 (118, 683-118, 640) в зависимости от типа ячейки [29], [32] и частичных сращиваний экзонов до полного 73E1 экзон (118 695-118 605) в следующем повторном блоке; (ii) инициирует транскрипцию одного вида ORF75a, начинающегося между координатами 885-891 (118221-118216) [32] (промоторные элементы, вероятно, разделены между транскриптами ORF75a и ORF73, которые инициируют при 73E2 [29], а в дистальных копиях могут сращиваться 73E1). (B) Последовательные делеции TR были сделаны в векторе pGL-TR с помощью ПЦР и названы соответственно. Каждая делеция TR, включая полноразмерную TR (FL), была совместно трансфицирована в клетки 293T вместе с либо mlANA-GFP, либо пустым вектором экспрессии GFP, как показано на фиг.1, в трех повторениях. Здесь данные нормализуются путем принятия отношения каждой конструкции удаления к соответствующему pGL4.10 пустующему репортерному управлению, устанавливая pGL4.10 в каждом случае равным 1. Удаление 3′-конца дает большой всплеск активности, который все еще подавляется mLANA, пока второе удаление не удалит чувствительность mLANA. 5 ‘не влияли на чувствительность mLANA.

(A) После реакции связывания с терминалом повторите фрагмент NotI из pGL-TR, который был радиоактивно мечен на 3′-конце, и либо 50 мкг очищенного mLANA-6XHis + 50 мкг BSA, либо только 100 мкг BSA, в качестве отрицательного контроля , смесь белка / ДНК подвергали расщеплению ДНКазы и после восстановления ДНК загружали в 8% -ный денатурирующий полиакриламидный гель. Кластер из трех защищенных областей обозначается цветными полосами в сторону. Это изображение представляет собой несколько повторов, а также результат оптимизации концентраций mLANA, BSA и TR. (B) анализ ДНКазы I мутантов mLANA P179T, A117V и L150P, наряду с WT mLANA и BSA, выполнялся так же, как и в (A). Мутанты, которые не подавляют транскрипцию, не связывают ДНК. (C) Иммоноблот рекомбинантного mLANA-6XH с аффинностью очищен от E. coli. Белок запускали на геле SDS-PAGE, переносили в нитроцеллюлозу и зондировали антителом против конъюгированного антитела против H-метки. (D) Последовательность, защищенная в анализе отпечатка, показана здесь, расшифровывается с использованием дорожек G + A и цветовой кодировки, отражающих цветные полосы в (A). Ниже защищенной последовательности в черном обозначена последовательность, показанная на фиг.2, как требуется для чувствительности mLANA. В поле показаны области, которые перекрываются, а координаты — геномные координаты от GenBank U97553.

TR были совместно трансфицированы в клетки HEK 293T либо с помощью экспрессирующего вектора mLANA-GFP, либо с родительского пустого вектора экспрессии, и анализировали на активность люциферазы (фиг.2B). Данные были нормализованы как сгиб через пустые репортерные векторы pGL4.10. Удаление последовательностей из восходящего конца TR (bp 1-585) мало влияет на активность базального промотора или способность mLANA подавлять активность. Примечательно, что удаление последовательностей из bp 390 до 451, которое не имело заметного влияния на активность люциферазы, удалило область, кодирующую один из ранее описанных промоторов LANA [сайт инициации транскрипции (i) на фиг.2А], указывающий на наличие другого начала транскрипции сайтов в пределах MHV68 TR. Действительно, делеция последовательностей от bp 585 до 963 приводила к почти полной потере активности репортерного гена (фиг.2В, сравнение активности репортерных конструкций Δ1-585 и Δ1-963), вовлечение последовательностей в этой области как критическое для наблюдаемого активности в отсутствие восходящих TR-последовательностей [например, сайт инициации транскрипции (ii), показанный на фиг.2А]. То, что другие сайты в TR могут быть вовлечены в экспрессию люциферазы, было дополнительно подчеркнуто анализом вложенных нисходящих делеций, где делеция Δ369-1213 проявляла основную активность, столь же высокую, как полная репортерная конструкция (фиг.2B). Это удаление удаляет обе ранее идентифицированные сайты инициации транскрипции в TR [сайты (i) и (ii), показанные на фиг.2A]. Однако, как отмечает Coleman и др., Существует отдельная насыщенная AT последовательность 5 ‘исходного сайта 73E1. Когда AT-насыщенные последовательности (bp 328-350 или MHV68 геномные координаты118,778-118,756) удаляются в конструкции репортера TR3232-12-12 TR, базальная активность этого промотора теряется. Таким образом, оказывается, что существует несколько потенциальных сайтов инициации транскрипции внутри TR, вклад которых в наблюдаемую активность люциферазы, вероятно, зависит от контекста (то есть наличие или отсутствие других последовательностей TR).

Удаление TR-последовательностей от bp 1174 до 1213 привело к значительному увеличению (примерно в 8 раз) активности базальной люциферазы (фиг.2B), что выявило наличие в этой области TR сильного отрицательного цис-элемента. Примечательно, что репортерная конструкция Δ1174-1213 была подавлена ​​mLANA в той же степени, что и полная репортерная конструкция TR (фиг.2B). Однако дальнейшее удаление, которое удаляет последовательности из bp 1130-1174, привело к полной потере репрессии mLANA. Отсутствие репликации mLANA наблюдалось также со всеми остальными мутантами, вложенными в нисходящее гнездование, которые не имели последовательности из bp 1130-1174 (фиг.2B). Таким образом, в фрагменте TR 1213 bp была отображена одна область, которая опосредует репликацию mLANA активности люциферазы, вызванной TR.

Чтобы оценить, оказывает ли mLANA, например KSHV LANA, репрессирование посредством прямого связывания целевого сайта (-ов) внутри TR, в отличие от зависимостей от ассоциаций с другими ДНК-связывающими белками, мы выполнили нанесение ДНКазы I на фрагмент MHV68 TR NotI, используя рекомбинантный mLANA-6XH — меченый белок, очищенный от лизатов E. coli. Используя рекомбинантную аффинность mLANA, очищенную от бактерий, гарантировали, что любое обнаруженное связывание с ГАНА-зависимой ДНК не будет отражать связывание любого белка (ов), связанного с ICAN-ассоциированным эукариотом, но скорее ДНК-связывающей активности mLANA. Мы меченым радиоактивным изолятом помещали каждый конец ТР отдельно и проводили анализы на отпечаток с использованием каждого из этих меченых фрагментов и различных количеств рекомбинантного mLANA-6XHis в присутствии BSA и только BSA как отрицательный контроль. Мы нашли одну область TR, состоящую из кластера ок. три отдельных участка (фланкированные гиперчувствительными сайтами DNAse I), которые были защищены от переваривания ДНКse I (фиг.3А). Примечательно, что область связывания mLANA в значительной степени перекрывалась с областью, которая была определена как критическая для репрессий mLANA репортерных конструкций pGL-TR люциферазы (см. Рис. 3D). Таким образом, эти данные вместе дают убедительные доказательства того, что опосредуемая mLANA репрессия репортерной конструкции люмиферазы pGL-TR включает прямое взаимодействие mLANA с идентифицированными последовательностями в MHV68 TR.

Установив анализ репортера TR как надежное считывание модуляционной транскрипционной модуляции, опосредуемой mLANA, мы использовали этот анализ для скрининга мутантов mLANA, нарушенных при подавлении транскрипции. Чтобы идентифицировать область или области mLANA, которые важны для регуляции транскрипции, мы использовали подход, обеспечивающий беспристрастный анализ всей кодирующей последовательности mLANA. ПЦР с низкой точностью / ошибкой применяли для амплификации ORF mLANA, используя условия полимеразы Mutazyme II (Stratagene) и PCR, которые благоприятствуют одной-двум ошибкам на амплифицированную матрицу. Полученные продукты ПЦР затем клонировали в экспрессирующий вектор для получения С-концевых слитых белков GFP, а отдельные колонии выращивали для выделения ДНК. Эти мутированные плазмиды mLANA-GFP затем трансфицировали в клетки HEK 293T в 96-луночных планшетах вместе с репортерным вектором pGL-TR и внутренним контролем phRL-SV40, который экспрессирует люмиферазу Renilla. В течение 48 часов после трансфекции каждая лунка была исследована на экспрессию GFP, чтобы идентифицировать и исключать те лунки, в которых либо глупая мутация была включена в кодирующую последовательность mLANA, либо что введенная мутация приводила к образованию неустойчивого синтеза белка. Таким образом, эти лунки с надежной экспрессией GFP были впоследствии проанализированы на активность люциферазы для идентификации клонов, которые неспособны ингибировать транскрипцию из MHV68 TR. Таким образом, те клоны, которые были GFP-положительными и люциферазы-высокими, были размножены в E. coli и повторно протестированы для потери транскрипционных репрессий. Те клоны, в которых подтвержден фенотип, затем отправляют на анализ последовательности ДНК для определения мутаций, вводимых в кодирующую последовательность mLANA.

Примерно 1500 клонов, выделенных из протокола мутагенеза, были подвергнуты скринингу, а 14 клонов (~ 0,93%) отображали экспрессию и достаточно значительное изменение фенотипа из mLANA дикого типа для обеспечения дальнейшего анализа (таблица 1). Хотя стратегия случайного мутагенеза не была рассчитана на исчерпывающий поиск, мы обнаружили, что большинство мутаций попало в область mLANA (выделено серым цветом на фиг.4А), которое относительно хорошо сохраняется среди секвенированных гомологов LANA. Примечательно, что 3 из восстановленных клонов содержали 2 missense мутации в кодирующей последовательности mLANA, тогда как четвертый клон включал 3 missense мутации (таблица 1). Остальная часть проанализированных мутантов mLANA содержала одну мутацию missense (таблица 1). Для сложных мутантов в mLANA вводили несколько индивидуальных точечных мутаций, чтобы определить остаток, связанный с потерей транскрипционной репрессии.

Здесь показаны потери функциональных мутантов, генерируемых случайным образом с помощью ПЦР, подверженных ошибкам, и определяемые их неспособностью подавить репортерную активность TR-люциферазы. (А) показана первичная аминокислотная последовательность mLANA, а внизу каждая указанная разница аминокислот представляет собой аминокислоту, измененную в мутанте, который потерял способность подавлять транскрипцию. Выделенный в сером области является областью, которая имеет гомологию с другими белками LANA и является доменом, который, как прогнозируется, будет сгибаться подобно ДНК-связывающему домену EBV1 EBV1, как показано на панели C. Подчеркнуты мутации, которые были введены в BAC MHV68-YFP в последующих эксперименты. (B) Последовательность выравнивания консервативных С-концевых доменов mLANA и KSHV LANA (kLANA). Показаны красные мутации в mLANA и kLANA, которые уменьшают репрезентацию транскрипции, опосредуемую LANA (подчеркнуты те мутации, которые были введены в kLANA, которые изменили более 1 остаток). (C) Моделирование алгоритма прогнозирования структуры белка PHYRE сохраненного C-концевого домена (затененного серым цветом в панели A) mLANA на основе решенной структуры ДНК-связывающего домена EBNA-1 [33], [34]. Это изображение предсказанной трехмерной структуры сохраненного C-терминального домена mLANA выделено зелеными мутациями, которые устраняют функцию ретрансляции транскрипции mLANA. Также красным цветом показана мутация A171V, которая не влияет на репликацию транскрипции mLANA (имеет фенотип дикого типа) и использовалась в последующих экспериментах как отрицательный мутант mLANA.

-, 0-20% репрессии; +, 20-50% репрессий; ++, 50-70% репрессий; +++, 80-100% репрессий.

Ряд этих мутаций были изменениями остатков, сохраненных между белками KSHV и MHV68 LANA, а другие были в остатках, которые имеют сходный заряд или гидрофобность. Примечательно, что многие из этих случайно сгенерированных мутаций перекрываются с областями KSHV LANA, направленными Han et al. для разрушения связывания ДНК LANA (фиг.4B). Показаны красным цветом на фиг.4В, которые являются мутациями, которые ослабляют медиану, опосредуемую mLANA, в наших руках (MHV68_LANA) и мутации в KSHV LANA, которые приводят к ≤50% ретрансляции WT KSHV [23].

Чтобы оценить, как мутации, которые нарушают репрессию mLANA, распространяются на трехмерной модели mLANA (до настоящего времени нет доступной кристаллической структуры любого гомолога LANA), мы использовали алгоритм 0.26 и онлайн-алгоритм Phyre (Protein Homology / analogy Recognition Engine) 0.2 инструмент поиска для определения аналогичных структур. Мы запросили инструмент Phyre (http://www.sbg.bio.ic.ac.uk/~phyre/), используя полноразмерную аминокислотную последовательность mLANA и искали профили белков с известными структурами [33]. Этот алгоритм определил, что верхний удар был для заштрихованной области последовательности mLANA, показанной на фиг.4А, которая наиболее точно соответствовала ДНК-связывающему домену (DBD) ядерного антигена-1 вируса Эпштейна-Барра (EBNA-1) белок — предполагаемый функциональный гомолог (кодируемый подклассом лимфокриптовирусов гамма-герпесвирусов) белков ЛАНА из радиновируса [34], [35]. Примечательно, что этот регион EBNA1 практически не имеет гомологии и мало похож на первичную последовательность mLANA. Это похоже на то, что было найдено с использованием KSHV LANA в качестве последовательности запросов в более старом алгоритме 3D-PSSM [36]. Используя эту модель, мы отобразили потерю репрессивных мутаций в этой области на гибридной модели DBNA / mLANA EBNA-1 (фиг.4С). Последовательность, закрашенная серым цветом на фиг.4А, показана в модели с мутациями, окрашенными зеленым цветом. Для справки, дополнительный мутант, который мы сгенерировали, который не разрушает активность (A171V), окрашен в красный цвет (рисунок 4C). Из этого анализа мы предположили, что потеря функции мутаций mLANA, идентифицированных в этом регионе, нарушает связывание ДНК, либо за счет того, что структура β-барреля ДНК-связывающего домена [37] слегка соприкасается с неправильными координационными остатками или непосредственно мутирует контактный остаток.

Основываясь на предсказании структуры EBNA-1, мы выбрали шесть мутантов для дальнейшей характеристики. Выбранными мутантами были: (i) P179T, который, как прогнозируется, находится в спирали 2, рассматриваемый как часть основной ДНК-связывающей области; (ii) A171V, который будет в свою очередь между фланкирующими и основными доменами и не имеет измеренного эффекта; (iii) R128G, который находился бы внутри или рядом с петлевой контактным кольцом фланкирующего домена; (iv) V194E, который будет в свою очередь между двумя спиралями основной области; (v) A293G, который, как прогнозируется, находится ниже по потоку от основной ДНК-связывающей области; и (vi) L150P, который будет частью фланкирующего домена, вблизи основных контактных остатков канавки. Их влияние на репрессию активности люциферазы, вызванной TR, значительно отличается от mLANA дикого типа, за исключением мутанта A171V (фиг.5A). Примечательно, что относительно небольшие различия в активности мутантов mLANA, которые потеряли репрессию по сравнению с контролем пустого вектора (EV), не были статистически значимыми (фиг.5A).

(A) Анализ мутантов mLANA, которые проявляют уменьшенную репрессию активности люциферазы, индуцируемой TR-MHV68. Выбранные мутанты, за исключением мутанта A171V, уменьшили способность подавлять транскрипцию от промотора (-ов) TR. Данные выражаются как относительные единицы света. Сравнение с WT mLANA по эффективности репрессирующей транскрипции оценивали с использованием t-теста учащегося: *, Р <0,05; **, P <0,01; нс, незначительно. Различия между каждым нерепрессивным мутантам и пустым вектором (EV) были незначительными (P> 0,05). (B) Экспрессирующие векторы для WT mLANA-3XFLAG вместе с WT mLANA-GFP или указанные мутанты mLANA-GFP были подвергнуты транстрансфекции в клетки 293T. Лизаты собирали и ко-иммунопреципитировали с использованием шариков FLAG-агарозы и выделенных комплексов, разрешенных SDS-PAGE. Контрольные выходы включали EGFP с mLANA-3XFLAG и WT mLANA-GFP и пустой вектор экспрессии FLAG-тега, которые не могли ко-иммунопреципитировать. Показаны анти-GFP-блоты для раскрытых и цельных клеточных лизатов, а также анти-FLAG-блот для целых клеточных лизатов.

Чтобы оценить, действительно ли мутации, выявленные с уменьшенной транскрипционной репрессирующей активностью, фактически теряют способность связывать ДНК, мы создали рекомбинантный белок для трех мутантов P179T, A171V и L150P (фиг.3C). Мы выполнили нанесение ДНКазы I на эти мутантные протеины mLANA вместе с WT mLANA и отметили, что, хотя могут быть тонкие различия между мутантами P179T и L150P — оба из которых не могут подавлять транскрипцию — не обеспечивали надежную защиту от переваривания ДНКазы I, демонстрируя снижение Связывание ДНК (фиг.3В). Напротив, как мутант mLANA дикого типа, так и мутант A171V, который проявляет фенотип дикого типа в анализе репозиции люциферазы pGL-TR (фиг.5A), демонстрируют устойчивое последовательное связывание ДНК (фиг.3B). Следует отметить, что отсутствие связывания ДНК, наблюдаемое с мутантами P197T и L150P, вряд ли отражает неадекватные уровни рекомбинантного белка, используемого в анализе отпечатка DNAse I, на основе анализа SDS PAGE очищенных белков mLANA (фиг.3C).

Поскольку было показано, что ДНК-связывающий домен и домен димеризации в EBNA-1 находятся рядом друг с другом [34], [37], [38], мы хотели бы знать: (i) если mLANA также образует димеры и (ii) является ли какой-либо из идентифицированных мутантов mLANA дефектным при димеризации, что, вероятно, сделает их нефункциональными, поскольку было показано, что KSHV LANA связывает ДНК в виде димера [30]. Для оценки димеризации мы создали конструкцию, которая экспрессирует mLANA с C-концевым 3XFLAG-эпитопом (p73-3XFLAG) и со-экспрессирует эту конструкцию вместе с 5 mLANA-мутантами (экспрессируемыми как белки GFP-белка), WT mLANA-GFP или Только GFP. После иммунопреципитации антителом против FLAG мы разрешали комплексы SDS-PAGE и зондированные иммуноблоты антителом против GFP (фиг.5В). Примечательно, что, как и ожидалось, мы наблюдали, что WT mLANA-3XFLAG способен взаимодействовать с WT mLANA-GFP и вытягивать его вниз, демонстрируя образование димеров mLANA (фиг.5В). Кроме того, WT mLANA-3XFLAG также способен выталкивать каждый из мутантов mLANA, но не только GFP (фиг.5B). Кроме того, в качестве контроля мы совместно выражали пустой вектор 3XFLAG и WT mLANA-GFP и продемонстрировали, что антитело против FLAG не иммунопреципитирует mLANA-GFP (фиг.5В). Эти анализы демонстрируют: (i) димеризацию mLANA; и (ii) все идентифицированные мутанты mLANA способны димеризоваться с mLANA дикого типа. Примечательно, что, хотя мутант L150P (и, в меньшей степени, мутант A171V) был экспрессирован на более низких уровнях, аналогичные уровни мутантного белка, по-видимому, были выделены путем совместного иммунопреципитации wt mLANA. Вполне вероятно, что это отражает то, что анализ совместного иммунопреципитации не является количественным и что антитело является предельным, что приводит к тому, что аналогичные уровни димеров mLANA восстанавливаются после иммунопреципитации.

Преимущество использования MHV68 для изучения биологии LANA заключается в следующем: (i) прямое создание мутантных вирусов, так как MHV68 реплицируется в культуре тканей, а вирусный геном клонирован в бактериальную искусственную хромосому (BAC); и (ii) вирус легко заражает наивных лабораторных мышей, что позволяет провести подробные исследования вирусного патогенеза. По этим причинам мы выбрали шесть mLANA мутаций, чтобы ввести в вирусный геном, чтобы оценить влияние, которое транскрипционная репрессия и / или ДНК-связывающие функции mLANA оказывают на общий патогенез MHV68. Чтобы построить мутантные ВАС, мы использовали λRed-опосредованную гомологичную рекомбинацию с использованием galK для облегчения отбора в штамме E.coli SW102 [39]. BAC MHV68-YFP [40] трансформировали в штамм SW102 E.coli. Затем все ORF73 было заменено на кассету galK, окруженную 50 bp оружием, гомологичным области вверх и вниз по течению ORF73, и выбрали на галактозосодержащих минимальных средах для создания pMHV68.73galK. Клоны были проверены путем рестрикционного переваривания. ПЦР-продукты ORF73, содержащие каждую мутацию, а также мутацию 73.Stop [28] и WT ORF73 были введены в SW102, несущие MHV68.73galK BAC для рекомбинации на ВАК galK. Полученные колонии были проверены ПЦР колонии и рестрикционным перевариванием. Поскольку в этих точечных мутантах отсутствуют сайты с диагностическим рестриктом, область ORF73 каждого BAC была дополнительно амплифицирована и секвенирована ПЦР (данные не показаны). Полученные мутантные вирусы mLANA-транскрипция-репликация-нуль (73TRN) обозначены 73.P179T, 73.R128G, 73.V194E, 73.A293G и 73.L150P, а также 73.A171V, 73.Stop-2, которые содержит стоп-кодон около начала ORF, идентичный 73.Stop [28], и генетически восстановленный 73.galKMR.

Чтобы гарантировать, что наши мутанты mLANA будут экспрессироваться в контексте инфекции, мы заразили клетки NIH3T3 при МВД 3 PFU / клетки и собрали лизаты через 7 часов после инфицирования. Мы легко наблюдали экспрессию mLANA иммуноблоттом с использованием кроличьего поликлонального анти-mLANA-антитела у всех мутантов, за исключением A293G (основа для обнаружения последнего мутанта неясна) (фиг.6A). Кроме того, фенотипом вируса 73.Stop, который мы ранее наблюдали, была дисрегуляция экспрессии литического гена, что проявляется как гиперэкспрессия всех литических генов. Каждый мутант также проявлял экспрессию антигенов, обнаруживаемых литической антисывороткой, за исключением 73.galK (73.MR) и 73.A171V вирусов, которые ведут себя как WT (фиг.6A).

Шесть mLANA-мутантов вводили в геном MHV68 с использованием BAC-рекомбинации. (A) После инфицирования фибробластов NIH3T3 с каждым вирусом MHV68-73TRN при МВД 3 PFU / мл клеточные лизаты собирали в течение одного и семи часов после инфицирования. Лизаты были иммуноблоттированы антисывороткой mlANA кролика, антисывороткой MHV68 мыши и антителами против β-актина. (B) фибробласты NIH3T3 инфицировали при MOI 0,001 PFU / клетку, а клетки и супернатанты собирали на 7-й день после инфицирования и титровали на клетках NIH3T12. Полученные данные показывают, что вирусы MHV68-73TRN растут до титров, сходных с титрами 73. Стоп, примерно в 10 раз ниже, чем генетически восстановленный вирус 73galkMR. **, P <0,01.

Ранее мы показали, что mLANA требуется для эффективной репликации в тканевой культуре после низкой инфекции MOI — вируса нуклеиновой кислоты 73.Stop показал дефект от 1 до 2 log в выходном вирусе из разрешительных фибробластов при низкой инфекции MOI (между 0,05 и 0,001 PFU / клетка) по сравнению с генетически восстановленным вирусом 73.MR [27]. Чтобы определить, требуется ли связывание ДНК ДНКAANA для эффективной репликации вируса, мы инфицировали фибробласты NIH3T3 с каждым вирусом 73TRN при MOI 0,001 PFU / cell. Клетки и супернатанты собирали путем лизиса / оттаивания через семь дней после инфицирования и титровали на фибробластах NIH 3T12. Мы определили, что вирусы 73TRN, такие как 73.Stop, продемонстрировали значительное снижение выходных титров в течение нескольких раундов вирусной инфекции, тогда как 73A171V-мутант был эквивалентен 73.galK-маркерному спасению (73.MR) вирусу (73.MR) Фиг.6В).

Как и в случае дефекта репликации in vitro, известного для вируса mLANA-null 73.Stop, мы ранее показали, что MHV68 требует экспрессии mlANA для эффективной реактивации из латентно инфицированных клеток [21]. Чтобы проверить, требуется ли функция ретрансляции транскрипции mLANA для реактивации с латентностью, мы использовали мутантные вирусы 73TRN для заражения мышей и анализа для установления и реактивации из латентности. Каждый вирус 73TRN использовался для инфицирования групп мышей C57Bl / 6 внутрибрюшинно с 1000 PFU вируса на мышь. Интраперитонеальный путь использовался, так как вирус 73.Stop способен устанавливать латентность у иммунокомпетентных мышей по этому маршруту, а не по интраназальному пути [21], [28], [41]. Через 18 дней после инфицирования мышей умерщвляли, а клетки селезенки и перитонеального экссудата собирали и подвергали предельной разводке ПЦР (фиг.7В) и анализу реактивации для окончательного разведения ex vivo (фиг.7С). Несколько удивительно, что мы обнаружили, что каждый мутант mLANA, который был нулевым в анализе ретрансляции транскрипции TR при введении в MHV68, показал ограниченную спленомегалию, аналогичную мутанту mLANA-нуль (73.Stop) (фиг.7А), и фенотип реактивации, сопоставимый к мутанту mLANA-нуль (фиг.7C) (т.е. эти инфицированные вирусом клетки не выявили заметной реактивации в анализе предельного разведения). В этих экспериментальных условиях мутант 73.Stop также демонстрирует небольшое уменьшение частоты латентно инфицированных клеток-ca. В 3-5 раз ниже МР-вируса, что подтверждается здесь в каждом из мутантных вирусов 73TRN (фиг.7В). Эти данные указывают на вывод о том, что функции связывания ДНК-связывания и / или транскрипции mLANA играют решающую роль в вирусном патогенезе.

Группы из 3-4 мышей инфицировали внутрибрюшинно 1000 PFU каждого вируса MHV68-73TRN. Восемнадцать дней после инфицирования мышей умерщвляли и (А) селезенки взвешивали, (В) частоту инфицированных спленоцитов определяли с помощью ПЦР с предельным разведением и (С) частоту клеток, которые активировали вирус, определяли с помощью ограничения, разбавление CPE. Во всех случаях вирусы MHV68-73TRN вели себя аналогично нулевому мутанту mLANA 73.Stop. (D) Аналогично, мышей, инфицированных интраназально 1000 PFU каждого вируса, анализировали на клетки, активирующие вирус через 18 дней после инфицирования. *, P <0,05, ***, P <0,001.

Интраназальная инфекция мышей с этими мутантными вирусами также приводила к абляции реактивирующего вируса из селезенки (фиг.7D), что не удивительно по результатам внутрибрюшинной инфекции, а также к предыдущим данным, касающимся интраназальной инфекции 73.Stop [28], [41 ].

Здесь мы сообщаем, что mLANA может функционировать для подавления транскрипции, вызванной MHV68 TR, посредством связывания с определенным сайтом в TR. Кроме того, мы сообщаем о разработке быстрого метода для генерации и скрининга мутантов mLANA с потерями функции и использовали этот подход для определения и характеристики мутантов mLANA, которые потеряли способность подавлять транскрипцию из MHV68 TR. Наконец, мы использовали эту информацию для создания мутантов mLANA в контексте вирусного генома и показали, что роль mLANA в: (i) репликации вируса в разрешающих фибробластах in vitro; (ii) регулирование экспрессии вирусного гена во время входа в литический цикл; и (iii) реактивация вируса от латентности, все они зависят от связывания ДНК mLANA. Действительно, все мутанты mLANA, характеризующиеся, которые не подавляют транскрипцию TR, демонстрируют фенотип, неотличимый от мутантного вируса mLANA-null. Таким образом, эти исследования по подавлению транскрипции mLANA подчеркивают роль ДНК-связывающего домена mLANA и его функции во время вирусной инфекции.

Промоторы и регуляторные области в терминальном повторении, идентифицированные здесь, согласуются с различными элементами, ранее отображенными другими [29], [32]. Существует как минимум два промотора в терминальных повторах 73p1 [29], которые инициируют транскрипцию экзона 1 гена 73 и промотор ORF75a (который разделяет цис-элементы с 73p2-промотором и может также управлять транскрипцией ORF73 in vivo [ 32], [42]), идентифицированные во время реактивации инфицированных спленоцитов, а также при de novo инфекции фибробластов. Результаты нашего анализа удаления согласуются с данными этих исследований, идентифицирующими промотор, управляющий транскриптом, инициирующим между bp 118683-118640. Интересно, что удаление этих координат не удаляло транскрипцию из этой области, но когда мы удалили область A / T-богатых между bp 118780-118738 (TR-координаты 327-369), активность люциферазы была снижена до фоновых уровней, что указывает на то, что эта область ( -73 по сравнению с большинством 5′-TSS) имеет решающее значение для транскрипции экзона 1 гена 73. Анализ делеции также подтверждает существование второго промотора, который инициирует транскрипт между bp 119434-119429. Обратите внимание, что последняя последовательность гомологична bp 118221-118216 в вирусном геноме, который находится в короткой частице TR TR с 27 bp в правой части уникальной последовательности MHV68, непосредственно примыкающей к первой полной копии TR, как определено формулой последовательность последовательности MHV68 WUMS [31] [фиг. 2; показан как сайт инициации транскрипции (ii)].

Важно отметить, что все области, которые, по-видимому, участвуют в активности репортерного гена TR, находятся выше по потоку от сайта (а) связывания с mAANA, которые были отображены в геномных координатах 119169-119122. В этом контексте mLANA сильно подавляет активность репортерного гена. Показано, что KSHV LANA связывается с последовательностями в KSHV TR и оказывает аналогичное отрицательное влияние на транскрипцию из промоторов, расположенных вблизи TR в репортерном векторе [16]. В отличие от MHV68 TR, где одна копия TR достаточна для того, чтобы наблюдать как активность промотора, так и эффективную репрессию с помощью mLANA, KSHV TR, как было показано, не содержит промоторную активность сама по себе, и требуется несколько копий TR ЛАНА-репрессия гетерологичного промотора [16].

В соответствии с нашим наблюдением, что mLANA может подавлять транскрипцию, возникающую из ТР, важно отметить, что присутствие mLANA вызывает понижающую регуляцию уровней транскрипции ORF73 во время вирусной инфекции в разрешающих фибробластах, как обнаружено RT-PCR кодирующего ORF73 экзона. Аналогичным образом, при исследовании RADUS RADVINA (RRV) LANA многие наблюдаемые уровни вирусной транскрипции, включая ORF73, были увеличены во время заражения мутантом нулевого RRV LANA [43]. Эти исследования, по-видимому, противоречат тому, что было обнаружено в отношении воздействия KSHV LANA на анализ транзиторной трансфекции, в котором показано, что LANA активирует свой промотор [16], [24], [44]. Однако, в соответствии с наблюдениями с MHV68 и RRV, нулевой мутантный вирус KSHV LANA обнаруживает гиперэкспрессию генов, связанных с репликацией вируса, хотя авторы не оценивали уровни транскриптов LANA [45]. Таким образом, различия между поведением LANA, кодируемым RRV и MHV68 и KSHV LANA, могут просто отражать нехватку данных относительно транскрипции LANA во время инфекции. Примечательно, что в отношении этой проблемы не было опубликовано никаких исследований, демонстрирующих транскрипты KSHV LANA, инициирующие терминальные повторы. Точно так же очень мало данных о промоторе MHV68 LANA, расположенном в уникальной области вирусного генома [32], [46]. Таким образом, это подчеркивает необходимость дальнейшего тщательного анализа роли гомологов LANA в регуляции транскрипции ORF73 как во время установления латентности, так и при резкой репликации вируса.

ДНК-связывающие домены были идентифицированы в KSHV LANA [16], [23], [25], [30] и EBV EBNA-1 [38], [47], [48] — последний, являющийся функциональным гомологом белков ЛАНА из роданидов. Мы показали здесь, что mLANA, как KSHV LANA и EBNA-1, физически взаимодействует с ДНК по-специфически. Следует отметить, что мы идентифицировали эту последовательность с использованием двух различных анализов, причем оба подхода идентифицировали одну и ту же область MHV68 TR как требуемую как для связывания ДНК mLANA, так и для подавления транскрипции TR-driven. Вкратце, анализ делеции TR идентифицировал последовательность ДНК между bp 1130 и 1174 фрагмента TR NotI, как требуется для mLANA-зависимой репрессии. Анализ оснований ДНКазы I обоих концов этого фрагмента TR идентифицировал защищенный участок 48 bp, который перекрывает область 44 bp, идентифицированную из анализа конструкций делеций TR-Luciferase. На снимке KSHV LANA последовательностей KSHV TR показана защищенная область аналогичного размера [30]. Дальнейший анализ показал, что большая занимаемая площадь на самом деле представляет собой две различные последовательности связывания, одновременно занятые мультиманом LANA [30]. Мы подозреваем, что mLANA связывает ДНК аналогичным образом, однако для подтверждения этого эксперимента потребуется дополнительная работа.

Примечательно, что в отношении сайтов связывания ДНК mLANA существует некоторая гомология между связывающей последовательностью MHV68 mLANA TR и одним из известных сайтов связывания LANS KSHV (LBS) [17], [30]. KSHV LBS1 и сайт связывания TR разделяют 14 из 16 нуклеотидов, хотя нет существенной гомологии между сайтом связывания MHV68 TR mLANA и KSHV LBS2. Однако, несмотря на то, что точные узлы KSHV LBS1 или LBS2 отсутствуют в MHV68 TR, мы обнаружили, что KSHV LANA полностью способна подавлять транскрипцию, инициированную MHV68 TR.

Предполагается, что C-концевая часть mLANA, которая является областью с наибольшим сохранением последовательности между белками LANA rhadinovirus, имеет третичную структуру, аналогичную структуре ДНК-связывающего домена EBV-EBNA-1. Предполагается, что гомологичная область ЛВП KSHV также будет иметь такое же сходство с ДНК-связывающим доменом EBNA-1 [30], [36]. Это говорит о том, что исследования структуры и функции mLANA, скорее всего, будут информативными в отношении функции KSHV LANA. Важно отметить, что большинство потерь мутантов репрессии, которые были идентифицированы на экране несмещенной мутагенеза, были отображены в этот регион mLANA. В отношении ДНК-связывающего домена EBNA-1 было проведено обсуждение вклада второй и третьей спиралей (рассматривается как «основной» домен), а первая спираль (считается «фланкирующим» доменом) в последовательности, связывающей ДНК [34], [37], [49]. Здесь мы идентифицировали из случайного пула мутантов, мутации потери функции, которые попадают в каждую из этих трех спиралей, что указывает на то, что все три спирали являются критическими для образования функциональной ДНК-связывающей области. Кроме того, наш анализ связывания ДНК с использованием мутантов mLANA P179T (мутация в спирали 2, как полагают, находится в области ядра) и L150P (мутация в спирали 1, которая считается фланкирующей областью) продемонстрировала, что оба мутантных белка не смогли защитить mLANA связывание с расщеплением ДНКазой I, дополнительно поддерживая данные, полученные с помощью анализа репликации люциферазы с помощью TR.

Зная, что нуклеиновый вирус mLANA обнаруживает несколько фенотипов, включая: (i) дефекты репликации in vitro и in vivo; (ii) выраженная экспрессия вирусных генов; и (iii) неспособность реактивироваться из латентно инфицированных спленоцитов [21], [27], [28], мы проверили, зависят ли эти фенотипы от функции модулирования / ДНК-связывания транскрипции mLANA. Важно отметить, что все анализы вирусов с точки зрения мутантов показали, что этот домен mLANA является критическим для каждого из этих фенотипов. Одним из осложняющих факторов может быть то, что нарушение ДНК-связывающей способности mLANA может оказать влияние на другие функции, предложенные для гомологов LANA, помимо регуляции транскрипции. Например, mLANA может быть вовлечена в репликацию вирусной ДНК, поскольку она, как и EBNA-1, предлагается быть исходным связывающим белком с способностью набирать клеточные механизмы репликации ДНК [22], [50]. Однако из исследований KSHV LANA неясно, требуется ли это для репликации вируса и работает ли он в литической и / или скрытой репликации [51], [52]. Альтернативно, может быть, что mLANA, который очень сильно связывается в концевой области повторения и димеризуется, может способствовать циркулированию генома перед репликацией кругового круга или образованием эпизода. Действительно, мы ранее сообщали, что in vivo вирус 73.Stop установил пожизненную инфекцию у мышей, но вирусный геном не может образовывать эписомы [21].

mLANA может использовать различные механизмы для подавления транскрипции прямо или косвенно. Он может непосредственно влиять на транскрипцию либо на стадии инициации, либо физически во время удлинения зарождающейся транскрипции. Другая возможность заключается в том, что mLANA взаимодействует с новорожденными белками, которые перекрывают транскрипцию с помощью модификации хроматина, и аналогично KSHV LANA, которая, как было показано, взаимодействует с новобранными метилтрансферазами [53] и членами комплекса coS-репрессоров mSin3 [44]. Дайте высокое содержание G + C в TR, активатор клеточной транскрипции Sp1 может потребоваться для эффективной активации инициации транскрипции из TR. В EBV было показано, что EBNA-1 вытесняет Sp1 из TR [54], и может быть, что mLANA выполняет аналогичную функцию. MLANA может вытеснять Sp1 или какой-либо другой белок, повышающий транскрипцию, с ключевых сайтов, тем самым снижая транскрипции.

Предлагается, чтобы несколько копий TR могли функционировать в качестве добавленных сайтов связывания для строгого привязки генома вируса к хромосоме хозяина посредством взаимодействия с белком гистона хозяина [36], [55] — [57]. Кроме того, мы предлагаем, чтобы множественные копии сайтов связывания TR (и mLANA) позволяли mLANA контролировать транскрипцию локуса латентности (гены 72, 73 и, возможно, другие) во время литической и латентной репликации — возможно, до того, как эта область станет метилированной во время латентности (KS Gray и SH Speck, неопубликованное наблюдение), который также закрывает транскрипцию. Это будет напоминать регуляцию EBV-транскриптов EBV от промоторов C и W на ранней стадии латентно-вирусных промоторов, которые затем замораживаются метилированием ДНК в виде латентных переходов EBV в зародышевый центр, а затем в В-клетки памяти [58] — [ 60]. Вероятно, очень важно иметь жесткий, полу-избыточный контроль над транскрипцией латентного локуса — надежная неконтролируемая экспрессия этого локуса из KSHV приводит к образованию опухолей у мышей [61], [62] и, по-видимому, необходима для трансформации роста / иммортализации B-клеток MHV68 [6]. В конечном счете, у нас пока нет достаточно детального понимания транскрипции в этой области вирусного генома, чтобы адекватно смоделировать, как регулирование зависимости mlANA от латентности и связанного с литическим циклом экспрессии гена влияет на вирусную инфекцию.

Наконец, метод случайного мутагенеза, который мы использовали в этом исследовании, может оказаться полезным для разработки методов лечения заболеваний, связанных с гамма-вирусом. Были выявлены эффективные доминантные отрицательные формы EBNA-1 [63], а небольшие модификации протокола mLANA-мутагенеза могут приводить к избирательному нацеливанию мутаций на области mLANA, отличные от ДНК-связывающего домена. Последнее может приводить к образованию мутантов mLANA, которые могут занимать сайты связывания LANA без привлечения дополнительных факторов, участвующих в модулировании экспрессии вирусных генов и последующей клеточной трансформации. Недавно были идентифицированы ингибиторы малых молекул EBNA-1 [64], [65] и предложены в качестве терапевтических для лечения заболеваний, вызванных EBV. Точно так же описанный здесь подход скрининга способен быстро определять влияние большого количества отдельных соединений на функцию mLANA. У нас также есть преимущество в изучении MHV68 mLANA, что мы можем проверить эти стратегии in vivo, чтобы непосредственно оценить эффекты на патогенез и болезнь. Учитывая очевидное сохранение функций между mLANA и KSHV LANA, такие исследования могут в конечном итоге оказаться полезными при лечении связанных с KSHV заболеваний.

NIH 3T12, RAW24,7, HEK 293T и MEF (мышиные эмбриональные фибробласты) поддерживали в модифицированной Дульбекко среде Eagle (DMEM), дополненной 10% фетальной телячьей сывороткой (FCS), 100 мкл пенициллина на мл, 100 мг стрептомицина на мл и 2 мМ L-глутамина (полный DMEM). Клетки поддерживали в инкубаторе культуральной ткани с 5% CO2 при 37 ° С. MEF получали из эмбрионов мыши C57BL / 6, как описано ранее {Weck, 1996 # 372}. Клетки Vero-Cre были подарком Дэвида Лейба. Клетки пассировали в DMEM с добавлением 10% FCS и 300 мкг гигромицина В / мл.

Были выполнены трансфекции, за исключением случаев, когда это указано иначе, с использованием реагента на основе липидов TransIT LT-1 (Mirus) в соответствии с инструкциями производителя. Для этих анализов, проведенных в 12-луночных планшетах (формат, используемый для большинства трансфекций), 100 нг репортера и от 50 до 500 нг соответствующего вектора экспрессии трансфецировали на лунку. Для некоторых экспериментов 10 нг SV40-индуцированной люциферазы Renilla, phRL-SV40, были совместно трансфицированы с помощью репортерного вектора люциферазы светлячков и служили в качестве внутреннего контроля. Все трансфекции собирали через 48 ч после трансфекции. Для этих трансфекций, проведенных в 96-луночных планшетах, 50 нг-вектора экспрессии, 15 нг репортерного вектора pGL-TR и 0,2 нг phRL-SV40 вводили в каждую лунку.

Для экспериментов с совместным иммунопреципитацией использовали 7,5 мкг каждой экспрессирующей конструкции. Клетки собирали через 48 ч после трансфекции

Все тесты с двумя репортерами выполнялись с использованием набора Dual Luciferase (Promega) в соответствии с инструкциями производителя. Для анализов с одной люциферазой клетки лизировали в соответствующем объеме буфера для лизиса (25 мМ Трис-фосфата, рН 7,8, 2 мМ ДТТ, 2 мМ DCTA, 10% глицерина, 1% Triton X-100), а затем 10 мкл лизата (1,5 мМ HEPES, pH 8, 80 мкМ MgSO4, 0,4 мМ ДТТ, 2 мкМ ЭДТА, 10,6 мкМ АТФ, 5,4 мкМ коэнзима А и 9,4 мкМ жука Люцифера) и световые единицы считывали либо на TD-20/20 люминометр (Turner BioSystems) или планшет-ридер (BioTek) для анализа большого формата.

Экспрессионная плазмида экспрессии mlANA-GFP pMSCV-73GFP была описана ранее [27]. Контрольную плазмиду, экспрессирующую только EGFP pMSCV-EGFP, получали путем амплификации последовательности EGFP из pIRES-EGFP с использованием олигонов EGFP_5’_BglII (5′-ggaagatctATGGTGAGCAAGGGCGAGG-3 ‘) и EGFP_3’_EcoRI (5′-tagaattcTTACTTGTAC AGCTCGTCC-3) и клонирование его в сайты BamHI / EcoRI pMSCVpuro. Меченосную плазмиду mLANA-3XFLAG с эпитопом получали с помощью PCR-амплифицирующей последовательности ORF73 из pL3700 [66] с использованием 73-1_BAM (5’-GATCGGATCCCTTGACCCACACCCTTCCTGTGC-3 ‘) и 73-3_nostop_BAM (5′-gatcggatccTGTCTGAGACCC-3’). Продукт ПЦР клонировали в сайт BamHI в p3XFLAG-CMV-14 (Sigma). Экспрессионную конструкцию KSHV LANA создавали путем извлечения последовательности LANA из pDD105 [67] и вставки ее в сайт NotI pcDNA3.1 (+) (Invitrogen).

Репортерную плазмиду pGL-TR (NotI) (pGL-TR) создавали путем переваривания MHV68 BAC с NotI для получения фрагмента TR с длиной волны 1240 bp. Этот фрагмент клонировали в сайт NotI pcDNA3.1 (+) (Invitrogen) для создания pcDNA-TRnot. Полученный вектор затем расщепляли для определения ориентации и затем расщепляли XhoI и EcoRV для выделения фрагмента, который затем клонировали направленно в pGL4.10 (Promega) с использованием соответствующих сайтов рестрикции. TR направлена ​​к открытой рамке считывания люциферазы в обратном направлении относительно аннотированной последовательности.

Последовательные делеции TR выполнялись путем амплификации участков TR с использованием ПЦР и затем клонирования этих фрагментов в сайты KpnI / BglII. Используемые праймеры были для 5′-делеций: TRn-3’BglII (5′-atatagatctGCGCCTGGGGCGCCATGC-3 ‘) в комбинации с 173F-Kpn (5′-ttaggtacc cccgggcccccacaagcctc-3′), 311F-Kpn (5’-ttaggtacc ccggggccccccgctacgagc -3 ‘), 353F-Kpn (5′-ttaggtacc aagccccgggcccgcccc-3′), 395F-Kpn (5’-ttaggtacc cgtgcccctcccccctgcag-3 ‘), 456F-Kpn (5′-ttaggtacc cctccgggacccgcccacag-3′), 590F-Kpn (5’-ttaggtaccgagggccagagtctgaa ctg-3 ‘), 702F-Kpn (5′-ttaggtacc gagggccagagtctgaactg-3′), или 995F-Kpn (5’-ttaggtaccgtggccgc gctggcctagc-3 ‘); и для 3′-делеций TRn-5’KpnI (5’-ttaggtaccGGCCGCTAC CGCCCGGGCC-3 ‘) в комбинации с 311R-Bgl (5′-atatagatctGCTCGTAGCGGGGCCCCCGG-3′), 353R-Bgl (5’-atatagatctCGGGGCGGGCCCGGGGCTTAC-3 ‘), 526R-Bgl (5’-atatagatctCCCCCTCGGC GGCTCCCCTAC-3 ‘), 737R-Bgl (5′-atatagatctAGGGGGCGGGGAGGGGGGAAG-3′), 875R-Bgl (5’-ататагатцCCCCCACCCCCCAAGAAGAG-3 ‘), 1014R-Bg (5’-ататагакт -AGAGTCCGCCAG CGCGGCCAC- 3 ‘), 1161R-Bgl (5′-atatagatctCCCTACCGGGCTGCCGCTAC-3′) или 1205R-Bgl (5’-atatagatctCACGCGGCGCGCCCTGGAG-3 ‘).

Бактериальный экспрессирующий вектор pET22b-73dN генерировали путем амплификации ORF73 из pL3700 с использованием следующих праймеров: 73_5’_ATG2_Bam_2 (5′-gatcg gatccgATGCCTCCTAAAA GACGCC-3 ‘) и 73_3’_nostop_Xho (5′-gatcctcgagTGTCTGAGACCCTTGTCCCTG-3’). Продукт ПЦР клонировали в сайты BamHI / XhoI pET22b (Novagen).

Все ПЦР-амплификации для клонирования выполняли с использованием высокоточной Fusion-полимеразы (New England Biolabs).

Векторы pET22b-73dN (а также мутанты ORF73) и pRARE (Stratagene) оба превращались в штамм BL21 (DE3) E. coli (New England Biolabs). После приведения культур 1 L к логарифмическому росту экспрессию индуцировали добавлением 1 мМ IPTG в течение 5 часов при 37 ° C. Бактерии собирали центрифугированием, и лизаты готовили для очистки Ni-NTA в естественных условиях в соответствии с инструкциями производителя (QIAGEN). Вкратце, осадок ресуспендировали в буфере для лизиса и клетки лизировали в присутствии лизоцима 1 мг / мл и путем обработки ультразвуком. После обработки ультразвуком лизаты обрабатывали РНКазой А (10 мкг / мл) и ДНКазой I (5 мкг / мл) перед очисткой. Лизат инкубировали с 10 мл суспензии агарозы Ni-NTA в партии в течение 1 часа и подвергали промывке на колонке и элюированию. 500 мкл фракции собирали и анализировали с помощью SDS-PAGE. Те фракции, содержащие большинство белка mLANA, определ емые окрашиванием Coomassie Blue, объедин ли и диализовали в течение ночи в буфер BFD (20 мМ HEPES, 20% глицерина, 0,1 М KCl, 0,2 мМ EDTA, 0,5 мМ DTT и 0,5 мМ PMSF) и хранят при -80 ° C.

Обработка ДНКазы I выполнялась в основном так, как описано ранее, с незначительными модификациями [68], [69]. Зонды были сделаны путем переваривания pcDNA-TRnot с помощью тупой резки PmeI и либо XhoI, либо BamHI для создания зондов с выступами на одном конце или другом. Эти фрагменты затем помечены [α-32] P с использованием фрагмента Кленова (3′-5’exo-) ДНК-полимеразы I (New England Biolabs) в реакции заполнения навесом. Свободные нуклеотиды удаляли гель-фильтрационными спиновыми колонками (GE Healthcare) с последующим осаждением зондов.

Реакцию связывания устанавливали в 50 мкл, содержащем 100 мкг белка (0-100 мкг mLANA-6XHis, с остатком, приготовленным с бычьим сывороточным альбумином [BSA]), 1 мкг поли (dI: dC) и связывающий буфер (2% поливинилэтанола, 2,5% глицерина, 10 мМ Трис, рН 8, 0,5 мМ ЭДТА и 0,5 мМ DTT). После 10-минутной инкубации на льду реакции доводили до комнатной температуры и к каждой реакции добавляли меченый зонд по 50 000 об / мин, а затем их инкубировали при комнатной температуре в течение 20 минут. ДНКазу I (DPRF) (Worthington) разбавляли до 10 мМ MgCl2 и затем каждую реакцию подвергали воздействию 100 мкл соответствующей концентрации разбавленной ДНКазы I в течение 30 секунд до добавления буфера DNase Stop (8M мочевины, 0,5% SDS, 5 мМ ЭДТА) с последующей экстракцией фенола, тремя экстракциями фенол-хлороформ, экстракцией хлороформом и последующим осаждением этанолом. Эти дайджесты разделяли на 8% -ный денатурирующий акриламидный секвенирующий гель.

Лестница G + A была выполнена с использованием модифицированного протокола Maxam-Gilbert. 50 000 м.д. зонда смешивали с 2 мкг ДНК спермы лосося в 10 мкл реакции, добавляли 1 мкл 4% муравьиной кислоты и инкубировали 25 минут при 37 ° С. Затем добавляли 150 мкл разведения 1:10 предварительно охлажденного пиперидина и реакцию инкубировали 30 минут при 90 ° C. Затем реакционную смесь помещали на лед и добавляли 1 мл 1-бутанола и перемешивали во встряхивании. Осажденную ДНК центрифугировали. Осадок промывали 150 мкл 1% SDS, затем добавляли 1 мл 1-бутанола и реакционную смесь снова центрифугировали. После окончательной промывки в 0,5 мл 1-бутанола, центрифугирования и удаления осадок высушивали под вакуумом и ресуспендировали в буфере для загрузки формамида.

Плазмиду pMSCV-73GFP использовали для получения мутантов ORF73, подвергая его ПЦР, подверженной ошибкам, с использованием набора GeneMorph II (Stratagene). Условия были установлены в соответствии с рекомендацией изготовителя для создания 1-2 мутаций на каждый продукт ПЦР. Праймеры 73_5’ATG2 (5′-ATGCCTCCTAAAAGACGCCG-3 ‘) и 73_3’noSTOP (5′-TGTCTGAGACCCTTGTCCCTGTT-3’) использовали для амплификации ORF73 из pMSCV-73GFP (6448 нг) с использованием следующих условий ПЦР: 2’95 °, [30 «95 °, 30 ° 55 °, 60 ° 72 °] × 30, 10’72 °. После осаждения продукта ПЦР его использовали в качестве «мегапимера» в реакции сайт-направленного мутагенеза (Stratagene) на pMSCV-73GFP для создания библиотеки мутантов в экспрессирующей плазмиде. После расщепления DpnI вновь созданного экспрессии мутанта плазмиды трансформировали в E.coli, колонии собирали и ДНК получали щелочным лизису с последующей очисткой диоксида кремния в 96-луночном формате (Zymo Research). Эти ДНК-препыты использовали непосредственно для трансфекции и для автоматизированного секвенирования ДНК.

BAC MHV68 был мутирован с использованием связанной с galK красной рекомбинации, как описано ранее для других ВАС [39]. Вкратце, мы внедрили MHV68 BAC в штамм галк бактерий SW102. Для того, чтобы создать и ORF73 / замена GalK BAC, мы амплифицировали ген galK из плазмиды pGalK с использованием праймеров galK-US-73 (5′-catgccctggcgaaggtgttgccca ggatatattctgggaatgtgatttaCCTGTTGACAATTAATCATCGGCA-3 ‘) и galK-ДС-73 (5’-acccttcctgtgctaaaagttgtgactgtgtactttatctctttcagataTCAGCACTGTCCTGCT КСТП -3 ‘); полученный продукт ПЦР включает 50 п.о. последовательности выше по течению и ниже ORF73 для использования в гомологичной рекомбинации. Продукт ПЦР вводили путем электропорации в клетки SW102 / MHV68, и эти рекомбинанты выбирали с использованием минимальной среды с галактозой в качестве единственного источника углерода. После того, как заменители ORF73 / GalK BAC-мутанты (MHV68.Δ73galK) были подтверждены рестрикционным перевариванием, ORF73-точечные мутантные ПЦР-продукты были сделаны для замены GalK. Продукты ПЦР изготавливали путем амплификации каждой мутантной плазмиды pMSCV-73GFP со следующими праймерами, которые содержали гомологию такого же 50 б.п. в качестве праймеров выше: 73-res-ds (5’-ACCCTTCCTGTGCTAAAAGTTGTGACTGTAGTACTT TATCTCTTTCAGATAATGCCCACATCCCCAC-3 ‘) и 73-res -us (5’-catgccctggcgaaggtgt tgcccaggatatattctgggaatgtgatttatgtctgagacccttg-3 ‘). Мутантный продукт ORF73 PCR подвергали электропорированию в SW102 / MHV68. Δ73galK и после рекомбинации выбирали на минимальных пластинах для среды, содержащих глицерин и 2-дезокси-D-галактозу, которая токсична для бактерий, которые метаболизируют галактозу. Полученные колонии подвергали скринингу ПЦР колонии (праймеры 5’-ACAC AACCTCAGGCAAAAC-3 ‘и 5′-CCTTCAACATCAACATCTGG-3’), а затем проверяли путем рестрикционного переваривания. Мутации были подтверждены ПЦР ORF73 и автоматизированным секвенированием ДНК продукта ПЦР.

Результирующие ВАС трансфицировали в клетки Vero-Cre. Когда клетки достигали 70% CPE, клетки и супернатанты собирали путем лизиса с замораживанием / оттаиванием, а свежие клетки Vero-Cre инфицировали этим запасом, чтобы обеспечить удаление BAC. Один дополнительный проход в клетках Vero-Cre был выполнен с целью расширения вирусных запасов.

Запасы вирусов разбавлялись в полной среде и адсорбировались на клетках, покрытых предыдущим днем. При инфекциях MOI 3 вирус адсорбировался в течение одного часа, инокулят удаляли и заменяли свежие, полные среды. При инфекциях с низким MOI (0,001) вирус разводили, адсорбировали и оставляли на клетках. Вирус собирали из клеток и супернатантов путем лизиса 3х замораживания / оттаивания. Анализ бляшек выполняли, как описано ранее [70].

Иммуноблоты выполняли, как описано [27]. Клетки лизировали в альтернативном буфере для анализа радиоиммунопреципитации (RIPA) (150 мМ NaCl, 20 мМ Трис, 2 мМ ЭДТА, 1% НП-40, 0,25% дезоксихолата, 1 мМ NaF и 1 мМ Na3VO4, дополненном полным мини-ЭДТА-свободным ингибиторы протеазы [Roche]). Используемыми антителами были антисыворотка MHV68 мыши, антисыворотка mlANA кролика, анти-β-актин мыши (Sigma), а также HRP-конъюгированные антитела против кроликов и антител против мышиного Ig (Jackson ImmunoResearch). mLANA-6XH был обнаружен с использованием мышиного антитела против пента-His (QIAGEN).

Для экспериментов с совместным иммунопреципитацией лизаты готовили из 10 см блюд из 293 Т клеток, ко-трансфицированных p73-3XFLAG и pMSCV-73GFP (и мутантов) путем лизирования в 1,1 мл альт. Буфер RIPA и сдвиг с иглой 20G. После очистки путем центрифугирования при 4 ° С 0,1 мл сохраняли для анализа цельного клеточного лизата, а оставшийся 1 мл лизата инкубировали в течение ночи при 4 ° С с помощью гранул агарозы против FLAG (M2) (Sigma) для удаления mLANA-3XFLAG комплексы. Бусины промывали в соответствии с инструкциями изготовителя, а затем разделяли на 10% SDS-PAGE гель и переносили в нитроцеллюлозу. Блоты исследовали либо с HRP-конъюгированным мышиным анти-FLAG M2 (Sigma), либо с анти-GFP козла (Rockland Immunochemicals) и HRP-конъюгированным ослиным анти-козьим Ig (Jackson ImmunoResearch).

Для получения кроличьей антисыворотки до mLANA последовательность аминокислот, кодирующих mLANA 173-314 С-конца, клонировали в pGEX-6P-1 (GE LifeSciences), и полученный слитый белок GST получали в клетках ArcticExpress BL21 (Agilent Technologies ), затем очищают на колонках Glutathione Sepharose 4B (GE LifeSciences).

Самки C57Bl / 6 мышей от 6 до 8 недель были приобретены в Лаборатории Джексона и поддерживались в Университете Эмори. Мыши были стерильны и обработаны в соответствии с рекомендациями в Медицинской школе Университета Эмори (Атланта, Джорджия). Мышей инфицировали внутрибрюшинно 1000 PFU вируса, разведенного в 0,5 мл полного DMEM или интраназально с 1000 PFU вируса, разведенного в 20 мкл полного DMEM. Для интраназальной инфекции мышей успокаивали, и после заражения разрешалось восстанавливаться перед возвращением в клетки.

Предельные анализы разбавления на частоту латентно инфицированных клеток или реагентов, реагирующих с клетками, выполняли, как описано ранее [71], [72]. Вкратце, чтобы определить частоту клеток, содержащих скрытые вирусные геномы, однократную чувствительную вложенную ПЦР проводили на лунках серийно разведенных, не содержащих эритроцитов спленоцитов. Клетки лизировали путем переваривания протеазой K, и два образца ПЦР проводили на образец с двенадцатью образцами на разведение, и продукты растворяли на 2% агарозных гелях. Для измерения частоты клеток, реактивирующих вирус, спленоциты ресуспендировали в полном DMEM и высевали в последовательные двукратные разведения на монослоях эмбриональных фибробластов мыши (MEF) в 96-луночных планшетах для культивирования тканей. Параллельные образцы механически разрушенных клеток были покрыты для обнаружения предварительно сформированного инфекционного вируса. Уэллс забивали для цитопатического эффекта от 14 до 21 дня после эксплантата. Частоты определяются с использованием распределения Пуассона.

Авторы благодарят доктора Рольфа Ренна за полезные предложения в отношении анализов ДНК-связывания и NCI-Frederick для штамма SW102 E. coli и плазмиды pGalK. Мы также хотели бы поблагодарить членов лаборатории Speck за полезные комментарии в ходе этого исследования и этой рукописи.

Комментариев нет.

Добавить комментарий

Ваш e-mail не будет опубликован. Обязательные поля помечены *