Нажмите "Enter", чтобы перейти к контенту

Интерферон γ Индукция легочной эмфиземы у взрослых мышей

Interferon γ Induction of Pulmonary Emphysema in the Adult Murine Lung
Источник: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2193095/

Хроническое воспаление, содержащее CD8 + лимфоциты, нейтрофилы и макрофаги, и эмфизему легких в сосудах сосуществуют в легких у пациентов с хронической обструктивной болезнью легких. Хотя считается, что этот воспалительный ответ вызывает ремоделирование, которое наблюдается в этих тканях, механизм (ы), при котором воспаление вызывает эмфизему, не было определено. Здесь мы демонстрируем, что интерферон γ (IFN-γ), известный продукт клеток CD8 +, вызывает эмфизему с альвеолярным увеличением, увеличенные объемы легких, улучшенную легочную совместимость и воспаление, богатое макрофагами и нейтрофилами, когда индуцируемо нацеливают трансгенным способом, для взрослого мышиного легкого. У этих мышей отмечались также заметные изменения протеазы и антипротеазы. Они включали индукцию и активацию матричной металлопротеиназы (MMP) -12 и катепсинов B, H, D, S и L, разработку MMP-9 и селективное ингибирование секреторного ингибитора лейкоцитарной протеиназы. IFN-γ вызывает эмфизему и изменения баланса легочной протеазы / антипротеазы при экспрессии в легочных тканях.

Хроническая обструктивная болезнь легких (ХОБЛ) является общим термином, охватывающим несколько клинических синдромов, включая эмфизему и хронический бронхит. Хронический бронхит диагностируется у пациентов с историей кашля или производства мокроты в большинстве дней не менее 3 месяцев в течение двух лет подряд без какого-либо другого объяснения 12. Напротив, эмфизема определяется патологически как состояние легкого, характеризующееся аномальным постоянным увеличением воздушных пространств, дистальных к терминальному бронхиолу, сопровождающихся разрушением альвеолярных стенок 12. ХОБЛ является неотложной клинической проблемой. В США это затрагивает более 16 миллионов человек, что составляет 13% госпитализаций, и является четвертой ведущей причиной смерти 13. Кроме того, 48 миллионов человек в США курят сигареты, основную причину ХОБЛ и 3000 человек, в основном подростки, каждый день приходят к привычке. 1. Во всем мире 1,5 миллиона смертей в год из-за ХОБЛ прогнозируются только в Китае в течение следующей половины столетия. 4. В отличие от впечатляющей важности здравоохранения ХОБЛ является наименее финансируемым заболеванием США Национальные институты здравоохранения при корректировке бремени болезней 5.

Тканевое воспаление отмечается во всем бронхиальном дереве и в паренхиме легких у пациентов с ХОБЛ. Нейтрофильные, макрофаговые и / или эозинофильные ткани и реакции дыхательных путей видны в этих местах 367891011. Инфильтрация лимфоцитов с усиленным накоплением клеток CD8 + также является заметным нахождением 78911. Уже давно предполагается, что это воспаление вызывает ткань ремоделирование, наблюдаемое в ХОБЛ 11213. Однако особенности этого воспалительного ответа, которые вызывают альвеолярное ремоделирование и медиаторы, ответственные за эти изменения, плохо изучены.

Несколько доказательств свидетельствуют о том, что легочные лимфоциты вносят важный вклад в патогенез ремоделирования тканей при ХОБЛ. Они включают исследования, демонстрирующие корреляции между подсчетами лимфоцитов и индексами количества альвеолярных разрушений 14 и CD8 + клеток и степенью ограничения ХСНВ воздушного потока 811. Эти лимфоциты, как полагают, являются преимущественно цитотоксическими (Tc1) клетками типа 1, которые продуцируют цитокины, такие как IFN-γ 61115 Удивительно, но способность цитокинов, продуцируемых этими клетками, генерировать изменения, наблюдаемые при эмфиземе легких, не была определена.

Исследования дефицита α1-антитрипсина человека (α1-AT) и экспериментов с животными эмфиземами, вызванными папаином или другими протеазами, показали, что эмфизема может быть вызвана протеолитическим повреждением легочной матрицы, в частности, с эластином 116. Это привело к протеазе / антипротеазе гипотеза, которая по-прежнему является преобладающей концепцией в патогенезе эмфиземы. Согласно этой гипотезе нормальное легкое защищено «антипротеазным экраном», который нейтрализует протеолитические ферменты, которые высвобождаются в дыхательные пути или паренхиму. Эмфизема вызвана изменением этого баланса с увеличением протеаз и / или снижением количества антипротеаз 13. Неэффективный и / или неупорядоченный ремонт эластичных волокон и / или коллаген- и окислительно-индуцированное легочное повреждение также могут способствовать формированию эти поражения 171819. Однако способность воспалительных клеток и медиаторов в тканях ХОБЛ индуцировать аномалии протеазы / антипротеазы, которые могут способствовать или активировать легочный протеолиз, не были должным образом исследованы.

В соответствии с убеждением, что клетки CD8 + Tc1 играют важную роль в патогенезе эмфиземы, мы предположили, что IFN-γ может индуцировать альвеолярную деструкцию, характерную для этого расстройства. Чтобы проверить эту гипотезу, мы использовали систему трансгенного моделирования с избыточной экспрессией для нацеливания IFN-γ на взрослые мышиные легкие. Эти исследования показывают, что IFN-γ вызывает фенотип, который отражает ХОБЛ человека с прогрессирующей эмфиземой, увеличением объема легких и макрофагом и нейтрофильным воспалением. Они также определяют изменения матричной металлопротеиназы (MMP), катепсина и антипротеазы, индуцированные IFN-γ в этой установке in vivo.

Мыши и люди рождаются с преждевременными легкими, которые содержат большие меховидные структуры. Нормальный альвеолярный размер и число приобретаются только после процесса роста и септации, который возникает в течение первого месяца и лет жизни, соответственно 20. Таким образом, увеличенные альвеолы ​​у взрослых мышей или людей могут быть вызваны процессами, которые изменяют альвеолярное развитие или процессы, которые разрушают в противном случае нормальные альвеолярные перегородки 12122. Эмфизема в ХОБЛ вызвана последним 1. Трансгенное моделирование избыточной экспрессии в легких использует чаще всего промоторы промотора CAP-клещей 10-kD (CC10) или поверхностно-активных агентов. Оба промотора активируются во внутриутробном периоде и, когда они используются для управления подходящим трансгеном, как показано, вызывают аномалии развития 222324. Необходимость дифференцировать фенотипы развития, зависящие от развития и взросления, смешивает использование трансгенного моделирования избыточной экспрессии легочной артерии для изучения патогенеза ХОБЛ , Чтобы избежать этого путаницы, мы использовали новую, внешне регулируемую трансгенную систему трансэкспрессии с двойной конструкцией, разработанную в нашей лаборатории 22. Эта трансгенная система позволяет свести к минимуму трансгенную экспрессию во время фаз развития легких и вызвана после развития легкого. Конструкции, используемые в этой системе, были описаны ранее нашей лабораторией 22. Конструкция CC10-rtTA-hGH содержит промотор CC10, трансактиватор обратного тетрациклина (rtTA) и интронные и полиаденилирующие последовательности человеческого гормона роста (hGH) (фиг.1 ). RtTA представляет собой слитый белок, состоящий из мутантного тетрациклинового репрессора (rtet-R) и трансактиватора вируса герпеса вируса VP-16. Конструкция tet-O-CMV-IFN-γ-hGH содержит полимерный тетрациклиновый оператор (tet-O), минимальный промотор CMV, мышиную IFN-γ-кДНК и сигналы интронного и полиаденилирования hGH (фиг.1). В этой системе промотор CC10 направляет экспрессию rtTA в легкое. В присутствии доксициклина (dox) rtTA способен связываться в транс с тетра-O, а трансактиватор VP-16 активирует транскрипцию IFN-γ. В отсутствие dox связывание rtTA происходит на очень низких уровнях и отмечается только транскрипция гена низкого уровня. Получение конструкции CC10-rtTA описано ранее 22. Конструкцию tet-O-CMV-IFN-γ-hGH получали путем замены кДНК IL-11 в конструкции tet-O-CMV-hIL-11-hGH описанных ранее нашей лабораторией 22 с мышиной IFN-γ-кДНК. Эта конструкция была проверена на правильную ориентацию вставки путем расщепления рестриктазы и секвенирования. Обе конструкции очищали, линеаризировали, разделяли электрофорезом через агарозу и очищали, как описано ранее. 22. Трансгенные мыши получали в (FBA) клетках (CBA × C57BL / 6) F2 путем смешивания и одновременного введения конструкций в пронуклеусы, как описано ранее 22.

Присутствие или отсутствие трансгенов первоначально оценивали с использованием Саузерн-блот-анализа, а затем с помощью ПЦР. Южный анализ проводили, как описано ранее, с использованием кДНК, кодирующей мышиный IFN-γ или rtTA 2225. ПЦР для rtTA также выполняли с использованием протоколов, описанных нашей лабораторией 2225. ПЦР для конструкции, содержащей IFN-γ, проводили с использованием следующих праймеров: верхний праймер 5′-ACT CAC ATT CAG AAC CCC AAA C-3 ‘, нижний праймер 5′-CGT CAG ATC GCC TGG AGA C-3’. Условия циклирования составляли один цикл при 94 ° С в течение 4 мин, 35 циклов 94 ° С в течение 1 мин, затем 57 ° С в течение 1 мин и 72 ° С в течение 1 мин, 1 цикл при 72 ° С в течение 5 мин, и 1 цикл при 4 ° C до конца. Все животные линии CC10-rtTA-IFN-γ оценивали на наличие как трансгенных конструкций, содержащих rtTA-, так и IFN-γ.

Животных CC10-rtTA-IFN-γ поддерживали на нормальной воде до 4-6 недель. В это время они были рандомизированы для получения нормальной воды или воды, содержащей докс (1,0 мг / мл), как описано ранее 22.

Мышей убивали, трахею выделяли тупым рассечением, а в воздуховод вводили и закрепляли трубки малого калибра. Затем добавляли три объема 0,75 мл PBS с 0,1% BSA и осторожно аспирировали и объединяли. Каждый образец жидкости с бронхоальвеолярным лаважем (БАЛ) центрифугировали и супернатанты хранили при -70 ° С до использования. Уровни IFN-γ определяли иммунологически с использованием коммерческих ELISA (R & D Systems) в соответствии с инструкциями производителя.

Животных анестезировали, трахею канюлировали, а легкие провентилировали со 100% O2 с помощью прикрепления «T». Затем канюлю трахеи зажимали, и кислород поглощался перед лицом продолжающейся легочной перфузии. В конце этой дегазации легкие и сердце удалялись в блоке и накачались давлением 25 см с помощью PBS. Статическое соответствие было рассчитано как изменение объема, деленное на изменение давления.

Животных убивали, проводили срединную стернотомию, а перфузию правого сердца осуществляли с помощью кальция и магния без PBS, чтобы очистить внутрисосудистое пространство легких. Затем сердце и легкие удаляли в блоке, накачивали до 25 см с помощью 10% -ного формалина с нейтральным буфером, фиксировали в течение ночи в 10% формалине, вставляли в парафин, разделяли на 5 мкм и окрашивали. Гематоксилин и эозин, Конго красный и периодические кислоты-Шифф с диастазными (D-PAS) пятнами были выполнены в Лаборатории исследований гистологии Отделения патологии Медицинской школы Йельского университета.

уровни мРНК оценивали с использованием нозерн-блоттинга и обратной транскрипции (RT) -PCR, как описано ранее нашими лабораториями 2526. В этих экспериментах суммарная клеточная РНК из легких или различных других тканей мыши была получена с использованием реактива Trizol (GIBCO BRL) в соответствии с инструкции изготовителя. Когда проводили нозерн-блоты, РНК фракционировали электрофорезом на основе формальдегида-агарозы, переносили на нейлоновую мембрану и зондировали 32Р-меченной кДНК, кодирующей представляющую интерес группу. КДНК-зонды генерировали с использованием RT-PCR с праймерами в таблице и всей РНК РНК от мышей CC10-IL-13. Все кДНК секвенировали перед использованием. Соотношение нагрузки на образец и эффективность переноса оценивали путем снятия и репродуцирования мембраны кДНК, кодирующей β-актин.

В RT-PCR-анализах были получены образцы РНК и транскрибированы в обратном порядке. Для протеаз и антипротеаз использовали ген-специфические праймеры (табл.) Для амплификации выбранных областей каждого целевого фрагмента. Когда оценивали мРНК IFN-γ, использовали верхний праймер в IFN-γ и нижний праймер в hGH (верхний GAGGAACTGGCAAAAGGATG, нижний GATTTTAGGGGCGCTACCT). Это дает продукт реакции 418 п.о. Чтобы убедиться, что в каждую реакцию ОТ-ПЦР добавляли равные количества нерасщепленной РНК, в качестве внутреннего стандарта использовали β-актин. Продукты ПЦР определяли количественно после 20, 25 и 30 циклов амплификации. Усиленные продукты ПЦР детектировали с использованием электрофореза на основе гена этидия, количественно определяли в электронном виде и подтверждали нуклеотидным секвенированием.

Вестерн-блот-анализ жидкости BAL проводили с использованием антител к MMP-12 27, как описано ранее нашими лабораториями 26.

Желатин и казеиновую зимографию проводили с использованием жидкости BAL, как описано ранее нашими лабораториями 28.

Анализ проб активного сайта проводили, как описано ранее нашими лабораториями 29. Лизаты легких или бесклеточные БАЛ, нормированные на общий белок, инкубировали с аналогом 125I-JPM E-64 и разрешали SDS-PAGE и авторадиографией.

Альвеолярный размер оценивался по средней длине шнура воздушного пространства, как это было описано ранее нашими лабораториями 30. Это измерение аналогично среднему линейному перехвату, стандартная мера размера воздушного пространства, но имеет то преимущество, что оно не зависит от толщины альвеолярной перегородки , Разделы были подготовлены, как описано выше. Для получения изображений случайным образом для анализа каждый стеклянный слайд помещали на печатную прямоугольную сетку, а на подошвенное покрытие на пересечении линий сетки помещалось множество точек, то есть с интервалами ~ 1 мм. Поля как можно ближе к каждой точке были получены путем систематического сканирования с интервалом в 2 мм. Поля, содержащие идентифицируемые артефакты или неалвеализированные структуры, такие как бронховаскулярные пучки или плевра, были отброшены.

Не менее 10 полей из каждого легкого мыши были приобретены на компьютере Macintosh через плату рамной решетки. Изображения были получены в 8-битных оттенках серого при конечном увеличении 1,5 пикселя / мкм. Изображения были проанализированы на компьютере Macintosh G3 с использованием программы NIH Image Public Media, написанной Уэйном Расбандом в Национальных институтах здравоохранения (доступно по адресу http://rsb.info.nih.gov/nih-image, используя пользовательский письменный макрос с веб-сайта). Изображения были вручную порождены, затем сглажены и перевернуты. Затем изображение подвергалось последовательному согласованию логического изображения «и» с горизонтальной и затем вертикальной сеткой. По меньшей мере 200 измерений на поле были сделаны у трансген-положительных животных, а у трансген-отрицательных животных было сделано 400 измерений на поле. Длина линий, лежащих над воздушным пространством, была усреднена как средняя длина хорды. По крайней мере, четыре животных изучались в каждый момент времени в присутствии и отсутствии воды док. Длина хорды увеличивается с увеличением альвеол.

Значения выражаются как средства ± SEM. Соответственно, групповые средства сравнивались путем анализа дисперсии с посмертным анализом процедуры Шеффе или с двухсторонним непарным тестом Стьюдента с использованием программного обеспечения StatView для Macintosh (Abacus Concepts, Inc.). Показанные эффекты IFN-γ на уровни мРНК, кодирующих протеазы или антипротеазы, являются репрезентативными для результатов, полученных при оценках как минимум шести отдельных животных.

Чтобы охарактеризовать эффекты IFN-γ во взрослом легком, мы использовали новую, внешне регулируемую трансгенную систему трансэкспрессии с двойной конструкцией, разработанную в нашей лаборатории 22. Конструкции, необходимые для этих трансгенных препаратов, были получены, очищены и одновременно микроинъектированы. Биопсии хвоста были получены у потенциальных животных-основателей, ДНК была выделена, а наличие или отсутствие трансгенных последовательностей IFN-γ и rtTA определяли с помощью Саузерн-блот-анализа и ПЦР. Были получены три двухполюсных животных-основателей (рис.2). Затем их скрещивали с мышами C57BL / 6 для генерации трансген-негативного и трансген-положительного потомства.

Трансген-негативные и трансген-положительные мыши содержались на нормальной воде до тех пор, пока они не достигли возраста 4-6 недель. Затем их рандомизировали на нормальную воду или воду с помощью dox. В отсутствие введения dox уровни BAL IFN-γ были <70 пг / мл. Как показано на фиг.3, введение dox вызывало значительное увеличение IFN-γ BAL. Это увеличение отмечалось в течение 24 ч введения dox, сохранялось на длительные интервалы и возвращалось к исходным значениям в течение 4 дней после удаления dox из питьевой воды животного. Различные трансгенные линии имели уровни BAL IFN-γ между 370 и 1200 пг / мл после 1 недель приема dox.

Чтобы определить, был ли IFN-γ, который был получен у наших трансгенных животных, биологически активен, были проведены исследования, чтобы определить, являются ли IFN-γ-регулируемые гены IFN-γ-индуцибельным белком 10 (IP-10) и монокином, индуцированным IFN-γ ( Mig) стимулировали после введения dox. мРНК, кодирующая любой ген, не может быть оценена у трансген-отрицательных мышей на нормальной воде или воде dox (фиг.4). Напротив, мРНК, кодирующая IP-10 и Mig, была слабо обнаружена у трансген-положительных мышей на нормальной воде, и впечатляющая индукция обоих генов могла быть оценена после введения dox (фиг.4). Эти исследования наглядно демонстрируют, что IFN-γ, который продуцируется в легких этих трансгенных мышей, является биологически активным.

Чтобы определить, была ли IFN-γ надлежащим образом нацелена на легкие, РНК была получена из легких и ряда других тканей от трансген-положительных мышей, которые получали воду док в течение 2 недель. IFN-γ мРНК затем оценивали с помощью RT-PCR-анализа. Впечатляющие уровни мРНК IFN-γ можно было бы оценить в легких от трансген-положительных мышей на воде док. Напротив, индуцированная трансгеном IFN-γ мРНК не была отмечена, а гистологические аномалии не были оценены во множестве висцеральных тканей у трансген-положительных животных (фиг.5 и данные не показаны). Это демонстрирует, что наша трансгенная система, основанная на CC10, как описано ранее этой лабораторией и другими 222331, избирательно нацеливает IFN-γ на легкие этих трансгенных животных.

Двойные трансген-положительные и трансген-отрицательные мыши содержались на нормальной воде до тех пор, пока они не достигли возраста 4-6 недель. Затем их помещали на нормальную воду или воду с помощью dox и поддерживали этот режим в течение дополнительного месяца. В конце этого интервала они были убиты, и была оценена клетка BAL. Восстановление клеток и клеточные дифференциалы жидкостей БАЛ от трансген-отрицательных мышей на нормальной и доксовой воде были почти одинаковыми (табл.). Напротив, IFN-γ увеличивал восстановление клеток BAL. Скромное увеличение клеточности наблюдалось у трансген-положительных мышей на нормальной воде, и впечатляющие увеличения наблюдались после индукции dox. В этот момент, жидкости BAL от двойных трансген-положительных мышей на докс-воде имели ~ 9- и 11,5-кратное количество клеток, чем жидкости BAL от трансген-отрицательных животных на нормальной и докс-воде соответственно (таблица P <0,005). Жидкости BAL от трансген-положительных мышей также имели повышенный процент и восстановление нейтрофилов и лимфоцитов и преувеличенное количество макрофагов по сравнению с трансген-отрицательными контрольными (P <0,05 для всех сравнений, таблица). Аномалии восстановления эозинофилов не отмечались. Эти исследования показывают, что IFN-γ увеличивает накопление легких макрофагов, лимфоцитов и нейтрофилов.

Воспаление и метаплазия слизи не наблюдались в гематоксилиновых и эозиновых и периодических кислотно-шиффовых пятнах легких от трансген-отрицательных мышей на нормальной воде. Аналогично, изменения слизи не были отмечены в гистологических срезах от трансген-положительных мышей на нормальной или докс-воде (данные не показаны). Напротив, воспаление отмечалось в легких у трансген-положительных животных. Этот ответ содержал повышенное количество мононуклеарных клеток и редких нейтрофилов. Он был мягким и неоднородным, и, когда он был замечен, был отмечен в перибронхиолярных и альвеолярных паренхиматозных очагах. Аномалии дыхательных путей в этих местах не оценивались. Этот ответ можно было бы оценить у трансген-положительных мышей, которые получали по крайней мере 1 мес воды док, но не были обнаружены последовательно у трансген-положительных мышей на нормальной воде (фиг.6 и данные не показаны).

Альвеолы ​​в легких от трансген-отрицательных мышей на нормальной воде и док-воде были нормальными по размеру и внешнему виду (рис.7). Напротив, альвеолярное расширение отмечалось у животных с двойным трансгеном. Небольшое увеличение альвеолярного размера наблюдалось у 1-месячных мышей с двойным трансгеном, которые получали нормальную воду (рис.7). Док-индуцированный IFN-γ вызывал дальнейшее увеличение альвеолярного размера. Этот эффект зависит от дозы и времени. Он был наиболее заметным в трансгенных линиях, которые продуцировали высокие уровни IFN-γ после введения dox. У этих мышей отмечалось незначительное увеличение альвеолярного размера после 4-6 недель, и после 3 мес введения dox отмечалась впечатляющая эмфизема (фиг.7 и данные не показаны). Эта эмфизема проявляется как гистологическая (рис.7) и морфометрически очевидная (рис.8) альвеолярное расширение с потерей упорядоченного появления ацина 32. Морфометрические исследования показали> 100% увеличение длины хорды. Это значительно больше, чем увеличение морфометрических параметров альвеолярного размера на 25-30%, которое мы отмечали у аналогичных мышей, подвергшихся воздействию сигаретного дыма в течение 6 месяцев 27.

Усиленные объемы легких и повышенная легочная совместимость являются характерными чертами эмфиземы человека 1. Чтобы определить, отражает ли эта модель мыши эти важные клинические признаки ХОБЛ, 1-мес-старые трансген-отрицательные и трансген-положительные мыши были рандомизированы на нормальную воду и воду док до 3 месяцев. Объемы легких определяли после фиксации давления. Как можно видеть в таблице и на фиг.9, DoX-индукция IFN-γ вызывает прогрессирующее увеличение объема легких и впечатляющее увеличение легочной регуляции по сравнению с двумя трансгенноположительными животными на нормальной воде или трансген-отрицательных животных на нормальных или докс воды. При рассмотрении в сочетании эти исследования показывают, что IFN-γ вызывает эмфизему с увеличением объема легких и улучшенную легочную регуляцию, аналогичную той, которая наблюдается при ХОБЛ человека.

Чтобы начать определять механизм (ы) индуцированного IFN-γ разрушения альвеолярной перегородки, мы сравнили уровни мРНК, кодирующие различные МСП, соответствующие ХОБЛ, у трансген-отрицательных и трансген-положительных мышей, которые были рандомизированы для получения нормальной воды или воду dox в возрасте 1 мес и поддерживали этот режим на срок до 12 недель. Эти исследования показали, что IFN-γ является мощным стимулятором накопления мРНК ММР-12 (рис.10). Этот эффект можно было бы оценить после всего лишь 1 недель введения dox и был легко проявлен на протяжении интервала индукции 3 моля (данные теперь показаны). MMP-2, MMP-9 и MMP-14 мРНК не индуцировались у этих животных. Вестерн-блот-анализ подтвердил индукцию MMP-12 (фиг.11). Zymography также продемонстрировала индуцированные IFN-γ BAL-фрагменты, которые были объединены с необработанными и / или полностью обработанными формами MMP-12 (фиг.11). Интересно, что также были оценены группы БАЛ, которые были объединены с группами MMP-9 (фиг.11). Активность в этих полосах ингибировалась ЭДТА, которая устанавливает их как металлопротеиназы. Таким образом, IFN-γ является мощным и селективным индуктором MMP-12 и стимулирует высвобождение MMP-9 in vivo.

Затем проводились исследования для определения того, индуцировали ли цистеиновые протеиназы IFN-γ в нашей трансгенной системе. Это было достигнуто путем сравнения уровней мРНК, кодирующих различные связанные с дыхательными путями цистеиновые протеиназы в легких у животных с двойным трансгеном и с трансген-отрицательными контрольными личинками, которые были рандомизированы на воду с нормальной водой или доксом в возрасте 1 мес и поддерживались на этот режим для 4 недель. Результаты RT-PCR и нозерн-блоттинга показали, что IFN-γ увеличивает уровни мРНК, кодирующей катепсины D, H, S и B. Стимуляция мРНК, кодирующей катепсины K и L, не может быть оценена (фиг.12 и данные не показаны) , Анализ зонда активного сайта, который идентифицирует биоактивные фрагменты катепсина 29, также продемонстрировал повышенные уровни катепсинов H, S, B и L в лизатах легких и свободных катепсинах B и S в жидкостях БАЛ (фиг.13 и данные не показаны). Таким образом, IFN-γ является мощным индуктором in vivo цистеиновых протеиназ в легких.

Чтобы полностью понять баланс протеазы / антипротеазы в легких трансгенных мышей IFN-γ, были также оценены уровни экспрессии легочных антипротеаз. Исследования, проведенные с использованием RT-PCR и нозерн-блот-анализа, показали, что IFN-γ не меняет экспрессии тканевого ингибитора металлопротеиназы (TIMP) -1, TIMP-2, TIMP-3 или α1-AT. Однако IFN-γ значительно ингибировал экспрессию секреторного ингибитора лейкоцитарной протеиназы (SLPI, фиг.14 и данные не показаны).

Хроническое воспаление и структурное ремоделирование сосуществуют и, как полагают, связаны причинно-следственным образом в тканях ХОБЛ 7121314. Удивительно, что практически ничего не известно о механизме (механизмах), посредством которого воспаление ХОБЛ вызывает эти структурные изменения. Мы предположили, что выбранные медиаторы воспаления ткани ХОБЛ могут непосредственно вызывать легочную эмфизему. Чтобы проверить эту гипотезу, мы использовали индуцируемое трансэкспрессионное трансгенное моделирование для нацеливания соответствующих воспалительных медиаторов ХОБЛ на взрослые мышиные легкие. Для этих исследований был выбран ИФН-γ. Этот выбор основывался на предыдущих исследованиях, демонстрирующих, что инфильтрация CD8 + лимфоцитов является характерной особенностью патологии ХОБЛ, что лимфоцитарное число коррелирует с разрушением тканей и ограничением воздушного потока в этом расстройстве и что клетки CD8 + являются мощными производителями IFN-γ, а что эти клетки продуцируют цитокины типа I 678111415. Эти исследования показывают, что избыточная экспрессия IFN-γ вызывает фенотип, который отражает ХОБЛ человека с выраженной эмфиземой, увеличенными легкими, улучшенным легочным соблюдением и смешанной тканевой и воспалительной реакцией БАЛ, содержащей увеличенное количество макрофагов, лимфоцитов и нейтрофилов. Они также демонстрируют, что IFN-γ сдвигает баланс легочной протеазы / антипротеазы в протеолитическом направлении, индуцируя MMP-12 и различные катепсины, одновременно ингибируя SLPI. Это первые исследования, демонстрирующие, что IFN-γ или цитокины любого типа I могут вызывать легочное структурное ремоделирование и воспаление тканей у пациентов с ХОБЛ. Они также являются первыми исследованиями, которые определяют изменения in vivo, протеазы / антипротеазы, индуцированные IFN-γ в легких. При рассмотрении в комбинации эти исследования показывают, что IFN-γ является важным регулятором баланса легочной протеазы / антипротеазы и предполагает, что IFN-γ и / или пути, которые он активирует, могут способствовать патогенезу эмфиземы легких.

Тип иммунного ответа, который развивается в ответ на чужеродный антиген, можно отнести, по меньшей мере частично, к гетерогенности ответивших популяций Т-клеток. 33. Поляризованные воспалительные реакции типа I и типа II представляют собой контрастные и порой взаимно антагонистические, реакции организма на иммуногенное оскорбление. Специализированные профили цитокинов лимфоцитов 1-го и 2-го типов, которые опосредуют эти ответы (для обзора см. Ссылку 34), являются основными факторами, определяющими результаты многих иммунных реакций, включая аутоиммунные, аллергические и инфекционные заболевания. Это хорошо проиллюстрировано в нашей нынешней концепции патогенеза астмы, что свидетельствует о том, что воспаление CD4 + Th2-доминирующее является краеугольным камнем этого расстройства 34. В отличие от астмы, клетки CD8 + являются основными лимфоцитами в тканях у пациентов с ХОБЛ с обструкцией воздушного потока 811. До недавнего времени клетки CD8 + считались однородным классом, основной функцией которого был MHC-класс I-ограниченный (цитотоксический) лизис инфицированных или измененных клеток-хозяев, по меньшей мере частично, посредством продуцирования IFN-γ 11. Теперь известно, что чрезмерное или ненадлежащая активация клеток CD8 + также могут индуцировать патологические изменения в тканях легких 35 и что клетки CD8 + имеют более широкий профиль цитокинов, чем предполагалось ранее 36. Наши исследования показывают, что IFN-γ вызывает эмфизему при стимуляции и активации различных легочных протеолитических путей. Это наблюдение предполагает, что эмфизема может быть опосредуемым Tc1 / IFN-γ. Однако эту спекуляцию следует рассматривать с осторожностью, поскольку эозинофилия мокроты и ткани также наблюдается у некоторых пациентов с этим расстройством 1037. Это повышает вероятность того, что медиаторы цитокинов 2-го типа могут также способствовать патогенезу болезни у некоторых людей. IL-13 является привлекательным кандидатом-медиатором этого ответа, потому что он индуцирует эозинофилию тканей 25 и вызывает эмфизему при нацеливании на взрослые мышиные легкие 37a. Интересно, что IL-13 может быть продуцирован Tc1, а также клетками Tc2 38. Таким образом, ХОБЛ у этих индивидуумов может быть смешанным расстройством Tc1 / Tc2 или Tc1-доминантным заболеванием, в котором продуцируется IL-13, и эозинофилия тканей генерируемых клетками Tc1. Эти наблюдения и наши исследования позволяют в первый раз начать рассматривать спектр клинических представлений ХОБЛ с точки зрения парадигмы цитокинов Tc1 / Tc2. Однако для определения применимости этой парадигмы к этому сложному беспорядку (ям) потребуется дополнительное экспериментирование.

Набор и активация нейтрофилов в легких в течение многих лет считался основным источником патогенеза эмфиземы 1639. Это основано на исследованиях, демонстрирующих накопление нейтрофилов в жидкостях БАЛ и, в меньшей степени, тканях у пациентов с ХОБЛ 16716 , корреляции между числом нейтрофилов и обструкцией воздушного потока при тяжелой ХОБЛ 7 и сильным эффектом разрушения тканей и разрушения слизистой сериновой протеазы, полученной нейтрофилом 134041. Лейкотриен (LT) B4 42, полученный из макрофага, эпителиальный IL-8 1643, и сигаретный никотин 44 были постулированы, чтобы способствовать генерации нейтрофилии при ХОБЛ. Показано, что повторное воздействие эндотоксина также оказывает легочную нейтрофилию и эмфизему в некоторых системах моделирования животных 45. Наши исследования показывают, что целевая легочная экспрессия IFN-γ увеличивает нейтрофилы БАЛ до уровней, сравнимых с уровнями, наблюдаемыми при ХОБЛ человека. Несколько лабораторий продемонстрировали, что тканевая нейтрофилия может быть индуцирована в легком посредством пассивного переноса и активации поляризованных клеток I типа 46 и что IFN-γ увеличивает ответ ткани на эндотоксин 47. Эти данные свидетельствуют о том, что CD8 + клетка IFN-γ ответственна за по меньшей мере частично, для вербовки и активации нейтрофилов в легких курильщиков сигарет и что последующие структурные события опосредуются, в частности, последствиями этих клеток в альвеолярных структурах. Они также повышают вероятность того, что индуцированные IFN-γ преувеличенные ответы на окружающие уровни эндотоксина окружающей среды могут способствовать этому ответу. Эти гипотезы впервые связывают аномалии лимфоцитов и нейтрофилов при ХОБЛ.

Чтобы получить представление о механизмах индуцированного IFN-γ легочного протеолиза, мы определили, изменило ли IFN-γ уровни экспрессии чувствительных к лечению ММР. Эти исследования впервые демонстрируют, что IFN-γ является мощным и селективным стимулятором MMP-12 in vivo. Это наблюдение дополняет предыдущие исследования наших лабораторий, которые продемонстрировали, что MMP-12 имеет важное значение для воспаления и эмфиземы, вызванной сигаретным дымом, в мышином легком 27 и выражается в преувеличенной форме в альвеолярных макрофагах у курильщиков и пациентов с эмфиземой 48. Наши исследования также впервые продемонстрировали, что IFN-γ стимулирует накопление белка BAL MMP-9 и что эти изменения белка не связаны с одновременным увеличением мРНК MMP-9. Диссоциация между эффектами IFN-γ на мРНК и белке позволяет предположить, что IFN-γ увеличивает выработку MMP-9, воздействуя на клетки с пулами предварительно сформированного фермента, такие как нейтрофил 49. В соответствии с этими наблюдениями преувеличенные уровни MMP-9 были обнаружены в БАЛ-жидкостях у пациентов с ХОБЛ, и нейтрофил, как было показано, является основным источником этого фермента в этой установке 50. При рассмотрении в сочетании эти наблюдения показывают, что сигаретный дым может индуцировать ММР-12 и стимулировать ММР-9 с помощью индукции IFN-γ и способность этих ММР деградировать эластин, компоненты базальной мембраны (фибронектин, ламинин, энактин, витронектин и коллаген типа IV) и компоненты небазеточной мембраны (превращение плазминогена в ангиостатин и активацию скрытого TNF [17, 51]) способствует патогенезу IFN-γ-опосредованных поражений. Однако важно отметить, что индукция и преувеличенная экспрессия комплекса MMP-2-MMP-14-TIMP-2 и метаплазии слизи также наблюдаются в тканях ХОБЛ человека 152, но не в наших обработанных IFN-γ легких. Эти наблюдения показывают, что IFN-γ-независимые механизмы также существуют и способствуют патогенезу ХОБЛ.

Хотя цистеиновые протеазы играют важную роль в деградации лизосомальных белков, они также участвуют во внеклеточных биологических ответах 53. Несколько исследователей предположили, что цистеиновые протеиназы играют важную роль в патогенезе эмфиземы 12535455. Это включает исследования, которые демонстрируют повышенные уровни белка катепсина L, мРНК и биоактивность в клетках БАЛ и жидкостях от курильщиков против некурящих. 5455. Однако патогенетическое значение отдельных фрагментов катепсина на моделях ХОБЛ на животных не было установлено, их роли в ХОБЛ человека не были определены, а механизмы цистеиновой протеиназы индукция в ХОБЛ не была выяснена. В наших исследованиях впервые продемонстрировано, что IFN-γ является мощным стимулятором in vivo продуцирования и активации различных легочных катепсинов, включая катепсины D, H, S, B и L. Эластолитический, коллагенолитический и желатин деградирующие свойства этих ферментов делают их соблазнительными кандидатами на протеолиз, который, как полагают, лежит в основе эмфиземы легких. Они также повышают вероятность того, что IFN-γ или протеолитические пути, которые он активирует, играет важную роль в других легочных протеолитических реакциях. Это может быть особенно важно при заболеваниях, характеризующихся воспалением тканей с преобладанием цитокинов типа 1 и разрушением тканей или ремоделированием, включая легочные инфекции, такие как туберкулез и воспалительные заболевания легких, такие как расширенный саркоидоз.

Чтобы полностью понять изменения протеазы / антипротеазы, которые приводят к эмфиземе, мы также охарактеризовали уровни экспрессии ряда важных антипротеаз в легких ИФН-γ-сверхэкспрессирующих животных. Значительные изменения в ТИМП-1, -2 и -3 и α1-АТ не были отмечены. Интересно отметить, что значительное ингибирование SLPI было легко оценено. SLPI представляет собой 12-килограммовый белок, продуцируемый на эпителиальных поверхностях. Он является мощным ингибитором эластазной и сериновой протеиназ, модулирует воспаление тканей и функционирует как антибактериальный дефинсин 56. Таким образом, разумно предположить, что ингибирование IFN-γ легочного SLPI может способствовать протеолизу, хроническому воспалению и рецидивам инфекции, которые наблюдаются у пациентов с ХОБЛ.

Наши исследования показывают, что трансгенная избыточная экспрессия IFN-γ во взрослом человеческом легком вызывает фенотип, совместимый с эмфиземой человека. Тем не менее, важно отметить, что чрезмерное накопление IFN-γ и / или CD 8+ клеток также отмечается во множестве других заболеваний легких, включая саркоидоз, туберкулез, облитерирующий бронхиолит, отторжение аллотрансплантата, фиброз легких и ВИЧ и другие вирусные инфекции 575859606162636465. В соответствии с нашей гипотезой о том, что хроническая продукция IFN-γ активирует легочные протеолитические пути, эмфизема наблюдается у пациентов с ВИЧ-инфекцией 64, а легочная кавитация наблюдается у пациентов с передовым туберкулезом и саркоидозом. Отсутствие эмфиземы или явное разрушение легких при других нарушениях может быть связано с различиями в сайте (-ях), времени и / или величине продукции IFN-γ при различных нарушениях. Альтернативно, хорошо известно, что эффекторные функции цитокинов зависят от контекста с тем же цитокином, имеющим разные эффекты в разных органах и различными эффектами в одном и том же органе, в зависимости от других клеток и / или медиаторов, которые присутствуют в местной микросреде. Кроме того, все шире признается, что генетический фон хозяина и полиморфизмы в важнейших болезнетворных генах также регулируют фенотипические признаки, которые индуцируются регуляторами, регулирующими воспаление. Таким образом, пока еще неопознанные признаки ответов при этих нарушениях также могут преувеличивать или ингибировать индуцированный IFN-γ легочный протеолиз. Для определения условий, при которых IFN-γ индуцирует эмфизему и легочный протеолиз, и ответы, которые усиливают и / или улучшают эти ответы, потребуются дополнительные исследования.

Таким образом, эти исследования показывают, что целевая экспрессия IFN-γ во взрослом легком вызывает эмфизему и макрофаги, лимфоцит и нейтрофил-ответ, который во многом отражает поражения, наблюдаемые при ХОБЛ человека. Они также демонстрируют, что этот эмфизематный ответ связан с индукцией и активацией MMP-12 и катепсинов B, H, S, D и L, усиленной разработки MMP-9 и ингибирования SLPI. Они предполагают, что IFN-γ может играть важную роль в патогенезе легочной эмфиземы и служить обоснованием для исследования роли (ий) IFN-γ в патогенезе ХОБЛ человека.

Авторы благодарят Кэтлин Бертье за ​​отличную секретарскую и административную помощь.

Эта работа была поддержана Национальными институтами здравоохранения грантами HL56389, HL61904 и HL64242 (JA Elias), грантом Национального института здоровья K08-AI01555 и грантом исследований Американской ассоциации легких (R. Riese) и грантами Национального института здравоохранения HL50472 (S. Shapiro) и HL48261 (H. Chapman).

Сокращения, используемые в этой статье: α1-AT, α1 антитрипсин; БАЛ, бронхоальвеолярный лаваж; CC10, клара-клеточный 10-kD-белок; ХОБЛ, хроническая обструктивная болезнь легких; докс, доксициклин; чГР, гормон роста человека; IP-10, IFN-γ-индуцибельный белок 10; MMP, матриксная металлопротеиназа; Mig, монокин, индуцированный IFN-γ; RT, обратная транскрипция; rtTA, обратный тетрациклиновый трансактиватор; SLPI, секреторный ингибитор лейкоцитарной протеиназы; Tc1, тип 1 T цитотоксический; тетра-О, тетрациклиновый оператор; TIMP, тканевый ингибитор металлопротеиназы.

RT-ПЦР-праймеры

UP, верхний; LO, ниже; MT-MMPI, мембранный MMP1.

IFN-γ Регулирование клеточной клеточности BAL

Влияние IFN-γ на объем легких и статическое соответствие

Конструкции, используемые для генерации мышей CC10-rtTA-IFN-γ.

Саузерн-блот-анализ ДНК от потенциальных мышей-основателей. Необходимые конструкции были приготовлены и микроинъецированы, как описано в материалах и методах. Биопсия хвоста была получена от потенциальных животных-основателей, ДНК была экстрагирована, а наличие конструкций, содержащих rtTA- и IFN-γ, оценивали по Саузерн-блот-анализу. Трансгены у трех двойных трансген-положительных мышей-основателей и контроль трансген-отрицательных личинок сравниваются с контролем количества копий конструкций CC10-rtTA-hGH и tet-O-CMV-IFN-γ-hGH.

Кинетика док-регуляции IFN-γ у мышей CC10-rtTA-IFN-γ. Кинетика индукции dox IFN-γ показана на верхней панели. В этих экспериментах БАЛ проводили на 1-му-старом двойном трансген-положительном животном (0 д) и идентичных животных после отмеченных интервалов воздействия воды на докс. На нижней панели показаны кинетика исключения IFN-γ. В этих экспериментах 1-молярные двойные трансген-положительные животные помещали на докс в течение 1 недели и затем помещали обратно на нормальную воду. Уровни БАЛ-IFN-γ оценивали в то время, когда животные переходили от нормальной воды к воде докс (время 0) и с интервалами после этого. Указанные значения представляют собой средние ± SEM минимум из четырех животных в каждый момент времени.

Демонстрация того, что БАЛ ИФН-γ является биологически активным. 1-мес-старые трансген-негативные и трансген-положительные животные были рандомизированы для приема нормальной воды или воды док на 14 дней. Уровни мРНК, кодирующей IP-10 (A) и Mig (B), оценивали с помощью нозерн-блот-анализа. Гели, окрашенные бромидом этидия, иллюстрирующие 28 S и 18 S рибосомную РНК, показаны ниже каждого геля, демонстрируя справедливость загрузки образца. Аналогичные результаты были получены в трех отдельных экспериментах.

Типичный эксперимент (n = 4), иллюстрирующий специфичность органа экспрессии IFN-γ. РНК была выделена из легких и различных других органов у 6-недельных двойных трансген-положительных мышей, которые получили воду док в течение 2 недель. Уровни мРНК, кодирующей IFN-γ, оценивали с помощью ОТ-ПЦР, как описано в Материалах и Методах.

Воспаление у трансгенных мышей. Трансген-отрицательные, Tg (-) и двойные трансген-положительные мыши Tg (+) в возрасте 1 мес были рандомизированы на нормальную воду, dox (-) или воду dox, dox (+), на 3 мес. Затем легкие удаляли, фиксировали до давления, секционировали, окрашивали (гематоксилин и эозин) и фотографировали (исходное увеличение: × 100). Эти микрофотографии являются репрезентативными для результатов, полученных как минимум в 10 экспериментах, оценивающих гистологию трансген-положительных и трансген-отрицательных мышей на нормальной воде или воде dox.

Морфометрические параметры альвеолярного размера у мышей CC10-rtTA-IFN-γ. Трансген-отрицательные (отрицательные) и трансген-положительные (Pos) мыши были рандомизированы на нормальную воду (-Dox) или воду dox (+ Dox) в возрасте 1 месяца и поддерживали этот режим в течение 3 мес. Затем легкие удаляли, фиксировали до давления, окрашивали, а длину альвеолярной хорды определяли количественно (* P <0,01 по сравнению со всеми другими условиями). Указанные значения представляют собой среднее ± SEM минимум пять животных.

Альвеолярная гистология у трансгенных мышей. Трансген-отрицательные, Tg (-) и двойные трансген-положительные мыши Tg (+) в возрасте 1 мес были рандомизированы на нормальную воду, dox (-) или воду dox, dox (+), на 3 мес. Затем легкие удаляли, фиксировали до давления, секционировали, окрашивали (гематоксилин и эозин) и фотографировали (первоначальное увеличение: × 25). Мягкое альвеолярное расширение наблюдается у трансген-положительных животных на нормальной воде, и дальнейшее альвеолярное расширение наблюдается у трансген-положительных животных, получающих докс. Эти микрофотографии являются репрезентативными для результатов, полученных как минимум в 10 экспериментах, оценивающих альвеолярную гистологию трансген-положительных и трансген-отрицательных мышей на нормальной воде и воде dox.

Влияние IFN-γ на мРНК MMP. 1-мес-старые трансген-отрицательные и двойные трансген-положительные мыши CC10-rtTA-IFN-γ и их контролируемые литтерами были рандомизированы на нормальную воду (-) или воду dox (+) в течение 1 мес. RT-PCR использовали для сравнения уровней мРНК, кодирующих различные ММР в легких у этих животных. Уровни мРНК, кодирующей ММР, сравнивают с уровнями мРНК, кодирующей β-актин.

Размер легких у трансгенных мышей. 1-мес-старые трансген-негативные и трансген-положительные мыши были рандомизированы для приема нормальной воды (Dox-) или воды dox (Dox +) в течение 3 мес. Затем их легкие удаляли, фиксировали до давления и фотографировали. Представленные легкие представляют собой результаты, полученные в пяти отдельных экспериментах.

Влияние IFN-γ на белок MMP. 1-мес-старые трансгены (Tg) -негативные и двойные трансген-положительные мыши CC10-rtTA-IFN-γ и их контролируемые литтерами были рандомизированы на нормальную воду (-) или воду dox (+) в течение 1 мес. Вестерн-блот-анализ (А), казеиновую зимографию (В) и желатиновую зимографию (С) использовали для демонстрации наличия ММР в жидкостях БАЛ у этих животных.

Влияние IFN-γ на мРНК респираторного катепсина. Анализ RT-PCR использовался для сравнения уровней мРНК, кодирующих отмеченные катепсины в лизатах лёгких из трансгенных (Tg) -негативных и трансген-положительных мышей CC10-rtTA-IFN-γ, которые получали нормальную воду или докс воды для 4-недельного интервала перед оценкой.

Влияние IFN-γ на респираторные антипротеазы. RT-ПЦР использовали для сравнения уровней мРНК, кодирующих респираторно-релевантные антипротеазы, у 2-мес-старых трансген-отрицательных и трансген-положительных мышей CC10-rtTA-IFN-γ, которые получали либо нормальную воду (-), либо воду dox (+ ) от 1-2 месяцев. Отсутствие эффекта IFN-γ на ТИМП-1, -2 и -3 и α1-АТ и способность IFN-γ ингибировать SLPI можно оценить.

Влияние IFN-γ на белки катепсина (B, H, S и L). 1-мес-старые трансген-негативные и двойные трансген-положительные мыши были рандомизированы на нормальную воду или воду dox. 4 wk позже анализ активного зондового зонда был использован для характеристики уровней катепсинов в лизатах из легких у этих животных.

Комментариев нет.

Добавить комментарий

Ваш e-mail не будет опубликован. Обязательные поля помечены *