Нажмите "Enter", чтобы перейти к контенту

Предварительная характеристика нокаута крысы рецептора лептина Создана системой CRISPR / Cas9

Preliminary Characterization of a Leptin Receptor Knockout Rat Created by CRISPR/Cas9 System
Источник: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4633582/

Лептин рецептор, который кодируется геном диабета (db) и высоко экспрессируется в сосудистом сплетении, регулирует гомеостаз энергии, баланс между потреблением пищи и расходами энергии, плодовитостью и костной массой. Здесь, используя технологию CRISPR / Cas9, мы создали крысу нокаута рецептора лептина. Гомозиготные крысы-рецепторы лептина характеризуются ожирением, гиперфагией, гипергликемией, непереносимостью глюкозы, гиперинсулинемией и дислипидемией. Из-за долгосрочного плохого гликемического контроля у крыс-нокаутов рецептора лептина также развиваются некоторые диабетические осложнения, такие как панкреатические, печеночные и почечные поражения. Кроме того, крысы нокаута рецептора лептина демонстрируют значительное уменьшение объема кости и минеральной плотности кости бедра по сравнению с их однопометниками дикого типа. Наша модель спасла некоторый дефицит существующих моделей грызунов, таких как переходная гипергликемия мышей db / db в генетическом фоне C57BL / 6J и отсроченное начало непереносимости глюкозы у крыс Цукера, и это доказано как полезное животное модель для биомедицинских и фармакологических исследований ожирения и диабета.

Лептин рецептор (Lepr), который кодируется геном диабета (db) и высоко экспрессируется в сосудистом сплетении, регулирует энергетический гомеостаз, баланс между потреблением пищи и расходами энергии, плодовитостью и массой кости, путем связывания с лептином, который кодируется геном obese (ob )1234. Сопоставление хромосомных мест генов у грызунов показало, что мутации в Lepr были основой для ожирения / диабета у грызунов и людей4.

Соответственно, Lepr-defientmice, аутосомно-рецессивные мутанты-диабеты (db / db), имеют тяжелое раннее ожирение, экстремальную резистентность к инсулину и развивают диабет567, которые использовались в исследованиях по ожирению и диабету. Крысиным эквивалентом мыши db / db является крыса Цукера, также известная как крыса fa / fa8, которая несет спонтанную аутосомную мутацию в гене Lepr и развивает аналогичный фенотип гиперфагии, ведущей к болезненному ожирению910, непереносимость глюкозы и резистентность к инсулину51112 , Хотя крысы Цукера часто использовались для изучения синдромов типа диабета типа 2, они не развивают полный фенотип диабета типа 2. Например, крысы Цукера не имеют типичного высокого уровня глюкозы в крови10.

Система кластеризованных регулярных интервальных коротких палиндромных повторов (CRISPR) / CRISPR (Cas) представляет собой адаптивную иммунную систему на основе РНК в бактериях и археях и теперь разработана как эндонуклеазы, управляемые РНК, для редактирования генома. Система CRISPR типа II функционирует РНК CRISPR (crRNA), взаимодействующая с транс-активирующей кРНК (tracrRNA) с образованием дуплекса crRNA-tracrRNA, который может быть заменен одной направляющей РНК (gRNA), а затем приводит к образованию Cas9 белоксодержащие комплексы рибонуклеопротеинов, которые распознают и расщепляют последовательность ДНК-мишени 1314. В отличие от других инженерных нуклеаз, таких как нуклеаны цинковых пальцев и активатор-активаторы, подобные активаторам транскрипции, система CRISPR / Cas9 не требует разработки конкретных пар белков для каждого целевого сайта, что привело к тому, что система CRISPR / Cas9 превратилась в удобное редактирование генома инструмент для производства генных нокаутных моделей многих видов1516171819. Здесь мы сгенерировали крысиных нокаутов Lepr, используя систему CRISPR / Cas9. У крыс-нокаутов Lepr были ожирение, стерильность и диабетическое состояние, а также снижение минеральной плотности костной ткани, что позволило расширить набор моделей животных для биомедицинских и фармакологических исследований по ожирению и диабету типа 2.

Две гРНК, нацеленные на Lepr exon 4, транскрибировались in vitro. Смесь мРНК Cas9 (20 нг / мкл) и gRNA (10 нг / мкл на гРНК) подвергали микроинъекции в цитоплазме зигот крыс Sprague Dawley (SD). В общей сложности 60 инъецированных зигот были перенесены на 2 псевдопрегнативных самцов SD-крыс, и родилось 8 щенков. ПЦР-амплификация целевых локусов показала, что четыре крысы (основатели 2, 4, 5 и 7) имели Lepr-делецию (фиг.1А). Дальнейшее упорядочение подтвердило, что шесть крыс (основатель 2-7) имели мутацию сдвига кадра (фиг.1В). Основатель 2 был выбран для создания колонии (обозначенной как Lepr — / -), которая перенесла делецию 298 п.о. с № 90043 bp до 90341 bp в последовательности ДНК генома Lepr (NC_005104.4) и вставку 4 bp, и приводил к терминальному кодону TGA, удаляя 997-аминокислоту LEPR. Вестерн-блот-анализ общего белка из ткани печени крыс Lepr — / — подтвердил отсутствие LEPR (рис.1C).

Вес тела измеряли от 1 до 8 месяцев. Самцы Lepr — / — крыс появились с тяжелым ранним ожирением в возрасте 1 месяца и были примерно на 60% тяжелее в возрасте 8 месяцев по сравнению с их однопометниками дикого типа (WT) (рис. 2A, B, n = 12, P = 0,002). Самки Lepr — / — крысы представили более тяжелое ожирение, чем самцы крыс, и были примерно на 160% тяжелее в возрасте 8 месяцев (рис. 2C, n = 15, P = 0,02). Увеличение массы тела крыс Lepr — / — ассоциировалось со значительно повышенным ежедневным потреблением пищи в обоих полах (рис. 2D, E).

Пост и случайные уровни глюкозы измерялись от 1 до 8 месяцев в обоих полах. Самцы Lepr — / — крыс появились с более высоким уровнем глюкозы натощак в возрасте 4 месяцев, и эта гипергликемия продолжалась до 8 месяцев (фиг.3А). Значительно более высокие уровни случайной глюкозы наблюдались уже в возрасте 2 месяцев у самцов крыс Lepr — / — и достигли пиковой глюкозы в возрасте 4 месяцев, что увеличилось в 1,64 раза по сравнению с уровнями их однопометников WT (рис.3C, n = 12 , P = 0,02). Случайная гипергликемия также продолжалась до 8 месяцев. Тем не менее, стойкая гипергликемия не наблюдалась у самцов Lepr — / — крыс (рис. 3B, D).

Согласно вышеописанным уровням глюкозы, мы выбрали 2-, 4- и 8-месячные крысы, на которых выполнялся тест на толерантность к глюкозе. После загрузки глюкозы крысы Lepr — / — показали быстрое и значительное повышение уровня глюкозы в сыворотке, тогда как повышение уровня глюкозы в сыворотке было относительно медленным и кратким у их однопометников WT. Непереносимость глюкозы проявлялась у крыс самцаЛеп — / — в возрасте 2 месяцев и ухудшалась при старении. В частности, в возрасте 8 месяцев максимальный уровень глюкозы достиг 22,2 ммоль / л, а уровень глюкозы поддерживался при 16,3 ммоль / л через 120 мин после загрузки глюкозы (фиг.3Е, n = 8, Р = 0,002). У самцов Lepr — / — крыс непереносимость глюкозы наблюдалась только в 4 месяца (рис.3F).

Для дальнейшей оценки гомеостаза глюкозы у крыс Lepr — / — уровень сывороточного инсулина измеряли в тесте на толерантность к глюкозе. Крысы Lepr — / — продемонстрировали значительную гиперинсулинемию в начале исследования и продемонстрировали резкое увеличение уровней инсулина в сыворотке крови в возрасте 2, 4 и 8 месяцев в обоих полах после загрузки глюкозы (рис. 3G, H).

Связанные с диабетом параметры метаболизма липидов измерялись в возрасте 2, 4 и 8 месяцев в обоих полах. Крысы Lepr — / — демонстрировали сходные показатели метаболизма липидов в обоих полах, поэтому мы объединили параметры мужчин и женщин (таблица 1). Циркулирующие триглицериды, общий холестерин и липопротеин высокой плотности были значительно увеличены у крыс Lepr — / — по сравнению с уровнями их однопометников WT в возрасте 2, 4 и 8 месяцев. Диабетическое состояние существенно изменило липопротеин низкой плотности у 8-месячных Lepr — / — крыс. Дислипидемия появилась у крыс Lepr — / — в возрасте 2 месяцев и ухудшилась при старении.

Lepr — / — rats и их однопометники WT были выбраны для наблюдения за патологическими изменениями, вызванными нокаутом Lepr в возрасте 8 месяцев. По сравнению с их однопометниками WT островки поджелудочной железы крыс Lepr — / — проявляли, очевидно, сильную вакуоляцию, гипертрофию, фиброз и кровоизлияние и имели нерегулярные границы (рис.4А). Инфильтрация воспалительных клеток также наблюдалась в островке (см. Дополнительный рис. S3D). Тяжелый печеночный стеатоз, характеризующийся накоплением более высоких уровней липидов в внутриклеточных везикулах печени, был очевидным у крыс Lepr — / — (рис.4B). Адипоциты крыс Lepr — / — были, очевидно, больше (рис.4C). В тканях почки крыс Lepr — / — наблюдалось расширение клубочковой матрицы, сегментарного гломерулосклероза и повреждения труб, таких как расширение и регенерация труб (фиг.4D).

Употребителей WT и крыс Lepr — / — подвергали эвтаназии (n = 4 для каждой группы) в возрасте 8 месяцев. Их бедра были расчленены, а дистальная бедра были проанализированы с помощью μCT. Трабекулярная кость дистальной бедра была значительно снижена у крыс Lepr — / — по сравнению с трактирами однопометников WT в возрасте 8 месяцев (рис.5A). Трехмерный анализ показал, что объем / общий объем ткани (BV / TV) крыс Lepr — / — уменьшился на 26,40% (рис.5B, P = 0,006), а трабекулярное число (Tb. N) уменьшилось на 23,08% (фиг.5С, Р = 0,03), тогда как трабекулярное разделение (Tb.Sp) было увеличено на 53,73% (фиг.5Е, Р = 0,02). Минеральная плотность кости (BMD) дистальной бедра была значительно снижена на 29,35% у крыс Lepr — / — по сравнению с их однопометниками WT (рис. 5F, P = 0,02).

Было показано, что в последние несколько десятилетий ожирение и связанные с ожирением заболевания, такие как диабет типа 2, напрямую связаны с увеличением смертности и сокращением продолжительности жизни20. Диабет типа 2 человека представляет собой сложное гетерогенное заболевание; он клинически характеризуется ожирением, явной гипергликемией, дислипидемией и непереносимостью глюкозы21. Более того, долгосрочный плохой гликемический контроль у пациентов с диабетом приводит к развитию микрососудистых и макрососудистых осложнений2223. Пациенты с диабетом типа 2 также обладают более высоким потенциалом для падения и риска перелома, чем недиабетические индивидуумы2425.

Для изучения сахарного диабета типа 2 были установлены различные модели на животных типа диабета типа 2. Однако эти модели не развивают полный фенотип диабета типа 2. Таким образом, другая модель животного, в частности модель крысы, благодаря своим физиологическим преимуществам по сравнению с мышами, должна быть полезной для клинических применений Лепра.

Здесь мы создали крыс с нокаутом Lepr (названный Leprtm1Ilas в нашем лабораторном сайте Rat Resource: http://123.1.153.158/portal/root/website_yky) с использованием технологии CRISPR / Cas9. Фенотипы мышей dd / db, крыс Zucker и крысы лейпера были подсчитаны в таблице 2. Наши две гРНК, нацеленные на четвертый экзон гена Lepr, индуцировали делецию 298 п.н. и вставку в 4 п.о. и приводили к окончательному кодону TGA досрочно, что привело к отсутствию LEPR в крыс Lepr — / -. Однако модель крысы Цукера имела спонтанную миссенс-мутацию в гене Lepr, которая не влияет на уровень экспрессии LEPR26. Различия в экспрессии LEPR приводили к разрозненным фенотипам между нашими крысами Lepr — / — и крысами Zucker. Крысы Lepr — / — страдают ожирением и развивают умеренную случайную гипергликемию, гиперинсулинемию и дислипидемию уже в возрасте 8 недель. В то время как крысы Цукера не имеют типичных уровней содержания глюкозы в крови10, и они развивают непереносимость глюкозы и резистентность к инсулину в течение 12 недель в смешанном генетическом фоне (крест между крысами Merck 3M и Sherman) 27 и демонстрируют задержанное начало от непереносимости глюкозы до 21-23 недель при размножении на фоне SD28. В соответствии с крысами Zucker наши крысы Lepr — / — продемонстрировали значительное снижение BV / TV по сравнению с их однопометниками WT29. Было обнаружено, что Leptin ограничивает кортикотропный высвобождающий гормон и стимулирует высвобождение высвобождающего гормона гонадотропина из гипоталамуса [30]. Лептин-дефицит или лейпер-дефицит ожирения животных являются как гиперкортизолические, так и hypogonadal3. Увеличение производства кортикостероидов и снижение присутствия эстрогенов благоприятствуют увеличению числа остеокластов и последующему увеличению резорбции кости, которые могут преобладать у крыс Lepr — / — для увеличения потери костной массы.

Другой широко используемой моделью диабета 2 типа для животных является db / db мышей, которые характеризуются гиперфагией, болезненным ожирением и экстремальной резистентностью к инсулину531. Гипергликемия мышей db / db зависит от фоновой деформации. Например, db / dbmice присутствует с переходной гипергликемией в генетическом фоне C57BL / 6J; хотя мыши db / db в генетическом фонде C57BL / KSJ демонстрируют неконтролируемую гипергликемию, они могут выживать только до 10-месячного возраста32. У нашей Lepr — / — крысы есть умеренная гипергликемия уже в возрасте 1 месяца, и этот более высокий уровень продолжался до 8 месяцев. Хроническая гипергликемия Lepr — / — крыса демонстрирует преимущество долгосрочного наблюдения за развитием диабета и осложнений, связанных с диабетом. Мыши db / db и Lepr — / — крыса могут дополнять друг друга в исследованиях по развитию диабета.

В заключение, наша первоначальная характеристика показывает, что нокаут гена Lepr у крыс SD приводит к сильному ожирению, гиперфагии, непереносимости глюкозы, гиперинсулинемии, дислипидемии, снижению минеральной плотности костной ткани и частичным осложнениям диабета. Наша модель компенсирует некоторые недостатки существующих моделей грызунов, особенно в отношении хронической гипергликемии, и доказано, что она является полезной моделью для исследования ожирения и диабета.

Использование животных и весь экспериментальный протокол были одобрены Комитетами по животноводству и использованию Института лабораторной животноводства Медицинского колледжа Пекинского союза (ILAS-GC-2010-044), включая создание крыс Leprknockout, пост и случайных тест на глюкозу, тест на толерантность к глюкозе, тест уровня сывороточного инсулина, тест на биохимию в сыворотке крови, гистологический анализ и анализ микрокомпьютеров. И все методы были выполнены в соответствии с утвержденными руководящими принципами, упомянутыми выше.

Крыс-нокаут Lepr генерировали CRISPR / Cas9, как описано ранее33. Короче говоря, мы разработали две пары синтезированных олигонуклеотидов для нацеливания гРНК на экзон 4 Lepr, TAGGCAAATCATCTATAACTTC и AAACGAAGTTATAGATGATTTG; TAGGCTGAAAGCTGTCTTTCAG и AAACCTGAAAGACAGCTTTCAG, которые были отожжены и клонированы в экспрессирующий вектор pUC57-гРНК (Plasmid # 51132, Addgene, Cambridge, MA, USA, полученные от профессора Xingxu Huang). Экспрессирующие плазмиды gRNA линеаризуют с помощью Dra I и используют в качестве шаблонов для транскрипции in vitro с использованием набора MEGAshortscript Kit (Ambion, AM1354). Экспрессионную плазмиду Cas9 (Plasmid # 44758, Addgene, Cambridge, MA, USA, полученную от профессора Xingxu Huang) линеаризировали с возрастом I и использовали в качестве матрицы для транскрипции in vitro с использованием набора T7 Ultra Kit (Ambion, AM1345). Транскрибированную мРНК Cas9 и gRNA обе очищают с использованием набора MEGAclear Kit (Ambion, AM1908), а затем смесь транскрибируемой мРНК Cas9 и gRNA подвергают микроинъекции в крысе Sprague Dawley (SD) (приобретается в Центре животных животных Beijing Vital River Laboratories, которые были введены от Чарльза Ривер) зиготы для генерации Lepr — / — крысы. Микроинъекции проводились в цитоплазме зигот с использованием микроинъекционной системы Nikon в стандартных условиях. Крысу генотипировали с помощью ПЦР с праймерами 5 ‘CTTGTGTCCAGAGCCTTCCTATAAC и 5’ ATTCCCCATGTTGTCTAGTAGTGATC. Для генотипирования фрагмент WT с 662 п.о. и фрагмент 368 п.о. гена нокаута Lepr амплифицировали с помощью 30 циклов ПЦР, состоящих из 94 ° С в течение 30 с, 60 ° С в течение 30 с и 72 ° С в течение 45 с.

Все крысы, используемые в этом исследовании, поддерживались на генетическом фоне SD и были разведены в аккредитованном AAALAC объекте. Крыс размещали в помещении, поддерживаемом при 23 ± 2 ° С, с 12:12 ч светлого / темного цикла и снабжали стандартным питанием и водным либитом. Использование животных было одобрено Комитетами по уходу и использованию животных Института Лаборатория животноводства Медицинского колледжа Пекинского союза (ILAS-GC-2010-044).

Крыс подвергали эвтаназии и получали полный лизат белка из тканей печени крысы, как описано ранее34. После SDS-PAGE и переноса полос на нитроцеллюлозу (Millipore) мембраны инкубировали в течение ночи с антителами против LEPR (Santa Cruz, sc-8325). После инкубации с соответствующим вторичным антителом в течение 1 ч при комнатной температуре связывание антитела детектировали с помощью HRP-конъюгированного иммуноглобулина G (Санта-Крус) с использованием системы определения хемилюминесценции (Santa Cruz). Для количественного анализа уровень LEPR был нормирован на β-актин.

Товарищи WT и Lepr — / — крысы обоих полов взвешивали каждый месяц от 1 до 8 месяцев. У однопометников WT и крыс Lepr — / — были обеспечены стандартный пищевой и водный либитум. Пища взвешивалась, и среднее ежедневное потребление было рассчитано от 1 до 8 месяцев.

Товарищи WT и Lepr — / — крысы обоих полов голодали в течение ночи (14 часов), но получали водный либитум. Кровь собирали путем прокола хвостовой вены, а уровень глюкозы в крови анализировали с помощью глюкометра One Touch Ultra (YZB / USA 6891). Случайное измерение уровня глюкозы в крови проводилось в 9:00 утра в течение 8 месяцев в обоих полах.

Товарищи WT и Lepr — / — крысы обоих полов голодали в течение ночи (14 часов), но получали водный либитум. В день испытания крысы взвешивали, и кровь собирали путем прокола хвостовой вены. Глюкозу крови анализировали глюкометром One Touch Ultra (YZB / USA 6891). После достижения базовой концентрации глюкозы крысам вводили внутрибрюшинно D-глюкозой при весе 1 г / кг массы тела. Уровни глюкозы в крови отбирали из хвоста через 30, 60, 90 и 120 минут после инъекции. Между тем, 100 мкл крови собирали для теста уровня сывороточного инсулина с использованием наборов ELISA для крыс / мышей инсулина (Millipore).

Товарищи WT и Lepr — / — крысы обоих полов голодали в течение ночи (14 часов), но получали водный либитум. Кровь собирали путем прокола хвостовой вены. Целую кровь центрифугировали при 3000 г в течение 10 мин при 4 ° С для получения сыворотки и получали общий сывороточный холестерин (СНО), триглицериды (ТГ), липопротеин высокой плотности (ЛПВП) и детектирование липопротеинов низкой плотности (ЛПНП) с использованием HITACHI 7100 Автоматический анализатор.

Для легкой микроскопии крыс подвергали эвтаназии, а поджелудочную, печеную, почковую и брюшную жировую ткань фиксировали в 4% формальдегиде и устанавливали в парафиновых блоках. Секции были окрашены гематоксилином и эозином (H & E) и проанализированы с использованием программного обеспечения Aperio Image Scope v8.2.5. Секции анализировали наблюдатель, ослепленный генотипами крыс.

Товарищи WT и крысы Lepr — / — 8 месяцев были подвергнуты эвтаназии, а их бедра были вскрыты. Измерения трабекулярной архитектуры выполнялись на дистальном бедре, очищенном от всех мягких тканей с помощью Siemens INVEON LG CT. После первоначального скаутского сканирования на каждый образец кости было получено в общей сложности 100 ломтиков с шагом 10 мкм, начиная с 1,0 мм ниже пластины роста. Область для анализа была описана в трабекулярном отсеке, исключая кортикальную и подкорковую кость. Были выделены все 5 разделов, а промежуточные секции были проинтерполированы с помощью алгоритма контура, чтобы создать интересующий объем. Значения сегментации, используемые для анализа, определялись с использованием Inveon Research Workplace. Трехмерный (трехмерный) анализ проводили для определения BV / TV, трабекулярного числа (Tb.N), толщины трабекулы (Tb.Th) и трабекулярного разделения (Tb.Sp). Для определения минеральной плотности костной ткани (BMD) был проведен двумерный (2-D) анализ. Средняя толщина коры (Ct.Th) определялась измерениями расстояния в 4 разных точках на срезе коры.

Данные были проанализированы непараметрическим тестом Two Independent-Samples. Данные были выражены как средства ± SEM от отдельных экспериментов. Различия считались значимыми при P <0,05.

Как процитировать эту статью: Bao, D. et al. Предварительная характеристика нокаута крысы рецептора лептина Создана системой CRISPR / Cas9. Sci. По донесению
5, 15942; doi: 10.1038 / srep15942 (2015).

Настоящая работа была поддержана Национальной программой исследований и развития технологий Министерства науки и технологий Китая (2014BAI02B01) и Грантом из научно-исследовательского фонда Института лабораторной животноводства, CAMS & PUMC (DWS201407).

Авторские вклады D.B написал основной манускрипт и подготовили рисунки 2, 4 и таблицу 1; Y.M, X.Z и W.C подготовили рисунок 1; F.G подготовил Рисунок 3; К.G подготовил Рисунок 5; L.Z разработал план исследований, а C.Q контролировал патологические наблюдения.

(A) Целевые локусы Lepr амплифицировали с использованием геномных ДНК-шаблонов у основателей. M: маркер молекулярной массы ДНК DL2000; WT: ДНК шаблона заменялась геномной ДНК дикого типа; 1-8: Основатели крыс, образующихся при микроинъекции. (B) ПЦР-продукты целевого фрагмента в Lepr на крысах были секвенированы. Последовательность прототипного прототипа (PAM) была подчеркнута и выделена зеленым цветом; сайты таргетинга были красными; вставки были фиолетовыми, в нижнем регистре; в правой части каждого аллеля показаны вставки (+) или удаления (-). E3, E4 и E5 представляют собой экзон 3, экзон 4 и экзон 5 Lepr соответственно. (C) Уровень белка LEPR в тканях печени однопометников WT и крыс Lepr — / — были обнаружены вестерн-блоттингом, используя β-актин в качестве нормализации.

(A) Изображение однопометника WT и крыса Lepr — / — в возрасте 8 месяцев. (B, C) Масса тела была измерена в течение 8 месяцев у самца WT littermate (n = 19), мужской Lepr — / — крыса (n = 12), самка WT littermate (n = 13) и самка Lepr — / — rat ( п = 15). (D, E) Ежедневный прием пищи измерялся в течение 8 месяцев у самца WT littermate (n = 12), мужской Lepr — / — крыса (n = 8), самка WT littermate (n = 8) и самка Lepr — / — rat (n = 8). * P <0,05, ** P <0,01, *** P <0,001 против крыс однопометника WT.

(A-D) Пост и случайный уровень глюкозы в крови были измерены в течение 8 месяцев у самцов WT (n = 19), мужской Lepr — / — крыса (n = 12), самка WT littermate (n = 13) и женщины Lepr- / — крыса (n = 15). (E, F) 2, 4 и 8 месяцев летнего личинки WT и Lepr — / — крыса (n = 8 для каждой группы) в обоих полах вводили D-глюкозой, а уровни глюкозы в сыворотке определяли при 0, 30, 60 , 90 и 120 мин после введения. (G, H). Уровни инсулина в сыворотке лейкемитера WT и Lepr — / — крыса (n = 4 для каждой группы) в обоих полах измерялись в то время как тесты на толерантность к глюкозе. * P <0,05, ** P <0,01, *** P <0,001 против однопометников WT на рисунке 3A-3D; # относится к различиям между WT-2M и Lepr - / - 2M; & относится к различиям между WT-4M и Lepr - / - 4M и * относится к разности между WT-8M и Lepr - / - 8M на фиг.3E-H; #, & и * P <0,05, ##, && и ** P <0.01, ###, &&& и *** P <0,001.

(A-C) окрашивание гематоксилином и эозином (H & E) поджелудочной железы, печени и жировой ткани у однопометников WT и крыс Leppr — / — (увеличение × 100); (D) H & E окрашивание почек у однопометников WT и крыс Lepr — / — (увеличение × 200). ☆ представляет фиброз поджелудочной железы, черные стрелки представляют собой кровоизлияние поджелудочной железы, △ представляет собой почечный трубчатый ущерб.

(A) μCT изображения трабекулярного костного отдела в дистальной бедро однопометника WT и крыс Lepr — / — в возрасте 8 месяцев (шкала шкалы: 1 мм). (B-F) Объем / общий объем ткани (BV / TV), трабекулярное число (Tb.N), толщина трабекулы (Tb.Th), трабекулярное разделение (Tb.Sp) и минеральная плотность кости (BMD) были измеряется у однопометников WT и крыс Lepr — / — в возрасте 8 месяцев (n = 4 для каждой группы, * P <0,05, ** P <0,01 против однопометников WT, NS: нет существенной разницы).

CHO, общий холестерин; ТГ, триглицериды; HDL, липопротеин высокой плотности; ЛПНП, липопротеин низкой плотности.

* P <0,05, ** P <0,01, *** P <0,001 по сравнению с носителем WT.

Комментариев нет.

Добавить комментарий

Ваш e-mail не будет опубликован. Обязательные поля помечены *