Нажмите "Enter", чтобы перейти к контенту

Низкий вес при рождении Мужская родословная свиней с выдержкой свиней Повышенная висцеральная ожирение в раннем взрослом возрасте

Low Birth Weight Male Guinea Pig Offspring Display Increased Visceral Adiposity in Early Adulthood
Источник: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4057084/

Конкурирующие интересы: авторы заявили, что конкурирующих интересов не существует.

Задуманные и разработанные эксперименты: OS TRHR. Выполнены эксперименты: ОС. Проанализированы данные: ОС. Добавленные реагенты / материалы / инструменты анализа: OS JAT LZ T-YL TRHR. Написал бумагу: ОС.

Утероплацентарная недостаточность (УПИ) — индуцированное внутриутробное ограничение роста (IUGR) предрасполагает людей к висцеральному ожирению взрослых. Мы предположили, что дети с низким весом при рождении (LBW) из беременностей IUGR, индуцированных UPI, будут отображать висцеральную жироподобную липогенную молекулярную подпись, включающую измененную экспрессию генов, статус фосфорилирования белков пути синтеза липидов и профиль экспрессии микроРНК (miR), происходящий в ассоциация с повышенным висцеральным ожирением. Нормальный вес при рождении (NBW) и LBW (полученный путем абляции маточной артерии), щенки морских свинок, кормили контрольной диетой от отъема до 145 дней и умерщвляли. Несмотря на то, что LBW щенки были легче при рождении, весы тела были похожи на вес новорожденных детей в 145 дней. В этом возрасте, который представляет молодую взрослую жизнь, относительные веса LBW эпидидимальной белой жировой ткани (EWAT) и содержания липидов были увеличены; что соответствовало гипертрофии адипоцитов у потомства LBW. Кроме того, экспрессия мРНК генов, связанных с липидным синтезом, включая ацетил-СоА-карбоксилазу 1 (ACC1), диглицерид-ацилтрансферазу 2 (DGAT2) и активирующее активацию пролифератора пероксисома gamma 1 (PPARγ1), была увеличена в LWW EWAT. Кроме того, LBW EWAT показал снижение фосфо-ACC (Ser79) и фосфо-PPARγ (Ser273) белков. Более того, экспрессия мРНК гормонально-чувствительной липазы (HSL) и связывающего жирную кислоту белка 4 (FABP4), участвующих в продвижении хранения жировых липидов, была увеличена в LWW EWAT. Наконец, miR-24 и miR-103-2, miRs, связанные с развитием адипоцитов, были увеличены в LWW EWAT. Эти данные свидетельствуют о том, что после неблагоприятной среды в матке гены, связанные с липидным синтезом, и экспрессия miR, а также статус фосфорилирования ключевых регуляторов синтеза липидов, по-видимому, хронически изменены и происходят в связи с увеличением висцерального ожирения у молодых взрослых мужчин IUGR потомство.

Утероплацентарная недостаточность (УПИ), осложнение беременности из-за неспособности плаценты доставить адекватные питательные вещества и кислород для плода, отвечает за большинство случаев внутриутробного ограничения роста (IUGR) в промышленно развитых странах [1]. Человеческие исследования связаны с низким весом при рождении, связанным с IUGR, как фактором риска развития позднего ожирения [2]. Взрослые IUGR имеют относительное увеличение жировой ткани и имеют тенденцию приобретать более висцеральную белую жировую ткань (НДС), но меньше подкожной жировой ткани (SAT) относительно общей массы жира [3], [4]. Повышенная масса НДС связана с резистентностью к инсулину и является сильным фактором риска развития диабета типа 2 [5]. Это является основным компонентом метаболического синдрома, одной из ведущих проблем общественного здравоохранения во всем мире [6], [7].

Маска жировой ткани определяется взаимодействием синтеза жирных кислот (липогенеза), поглощением жирных кислот и процессами β-окисления и расщеплением жировых триглицеридов на глицерин и жирные кислоты (липолиз) [8]. Жировой липогенез происходит либо как de novo синтез жирных кислот из нелипидных субстратов, таких как глюкоза, ацетат и лактат (также известный как липогенез de novo или DNL), или как следствие повторной этерификации свободных жирных кислот с глицерином.

Adipose DNL находится под контролем двух ключевых ферментов: ацетил-кофермент-карбоксилаза (ACC) и синтаза жирных кислот (FAS) [9]. У людей и других млекопитающих АКК существует в двух изоформах, ACC1 и ACC2. Хотя АК2 высоко экспрессируется в окислительных тканях, таких как скелетная мышца и сердце, АК1 выражается в основном в липогенных тканях, включая жировую ткань, с функцией катализации карбоксилирования ацетил-СоА с образованием малонил-СоА. Малонил-СоА используется в качестве строительного блока для удлинения длины цепи жирных кислот с двумя углеродными приращениями, процесс, катализируемый FAS [9]. ACC и FAS регулируются статусом активации AMP-активированной протеинкиназы (AMPK), где активация (фосфорилирование у треонина 172 (Thr172) на α-субъединице) AMPK приводит к ингибированию синтеза жирных кислот посредством репрессированной экспрессии ACC1 и FAS в сочетании с прямым фосфорилированием ACC1 у серина 79 (Ser79) [10]. Дальнейший контроль экспрессии и активности АКК и ФАС был зарегистрирован посредством действия фактора транскрипционного фактора стерола, регулирующего элемент-связывающий белок 1 (SREBP1) и рецепторов ядерных гормонов, включая рецептор пролифератора-пероксисома ядра (PPARγ) [11] — [13 ]. Как и в случае AMPK и ACC, статус фосфорилирования теперь понимается как имеющий решающее значение для определения активности, а в жировой ткани пониженное фосфатирование PPARγ у серина 273 (Ser273) создает конститутивно активное состояние PPARγ в висцеральной жировой ткани [14]. Хотя в настоящее время более глубокое понимание того, как состояние фосфорилирования сенсоров стресса и рецепторов ядерных гормонов, таких как AMPK и PPARγ, влияет на динамику массы жировой ткани, появились новые регуляторы восходящего потока, такие как некодирующие микроРНК, в литературе. МикроРНК (miRNAs или miRs) участвуют в регуляции генов, которые участвуют в адипогенезе (miR-24) [15], [16] и увеличении адипоцитов (miR-103) [17]. В частности, показано, что другие miRs, miR-27a и miR-27b играют важную роль в экспрессии PPARγ [18] — [20], потенциально выделяя эти miR в качестве ключевых регуляторов экспрессии PPARγ и в конечном счете влияя на активность адипогенеза и / или DNL в жировой ткани.

В дополнение к DNL поглощение и хранение циркулирующих свободных жирных кислот адипоцитами и повторная этерификация жирных кислот из интраадипоцитарного липолиза также способствуют синтезу триглицеридов и накоплению жировой ткани [21], [22]. Эти процессы включают в себя ряд различных белков, включая транслоказу кластера дифференцировки 36 (CD36), жирную кислоту, связывающую белок 4 (FABP4), жироподобную триглицеридную липазу (ATGL), гормон-чувствительную липазу (HSL) и диацилглицериновые ацилтрансферазы DGAT1 и DGAT2 [23 ] — [27]. Как и в случае DNL, ​​регулирование этих белков метаболизма жирных кислот также включает в себя ядерные рецепторы и miR. В частности, CD36 был предложен как прямая цель PPARγ [13], а PPARγ играет центральную роль в регуляции экспрессии DGAT1, HSL и ATGL в белой жировой ткани [28] — [30]. Кроме того, было показано, что экспрессия FABP4 находится под контролем miR-24 и miR-378 in vitro в преадипоцитах и ​​адипоцитах соответственно [31], [32].

Эти комбинированные отчеты подчеркивают сложную регуляцию массы жировой ткани. Регулирование этих белков, участвующих в синтезе и метаболизме жирных кислот, хорошо изучено в неблагоприятных ситуациях чрезмерного накопления НДС, таких как ожирение [33] — [36]. На сегодняшний день исследования потенциальных воздействий на программирование в результате неблагоприятной среды внутриутробного развития и последующие последствия для последующих жизненных процессов только сейчас появляются. Внутриутробная среда является критическим регулятором многих более поздних жизненных метаболических параметров. Действительно, что касается развития жировой ткани, сообщалось о снижении процентного содержания фосфорилированного AMPK в жирной жировой ткани параллельно с неизменным размером аментального размера аментатора и маслом оментального жира у ягнят IUGR в течение двадцати одного дня [37]. Эти данные свидетельствуют о том, что в результате внутриутробной или ранней постнатальной среды изменения фосфорилирования сохраняются в более позднем периоде жизни, создавая предпосылки для более позднего увеличения липогенеза. Кроме того, сообщалось об увеличении накопления забрюшинной, эпидидимальной и периренальной белой жировой ткани в сочетании с повышенной экспрессией липогенных генов FAS и ACC у взрослых мужских крыс IUGR [38], [39], что дополнительно указывает на запрограммированное увеличение висцеральных жировая активация AMPK / ACC / FAS после неблагоприятной среды в матке. Интересно, что эти изменения в экспрессии липогенных генов происходили в сочетании с увеличением PPARγ [39]. В этих исследованиях подчеркивается, что среда внутриутробного развития играет решающую роль в программировании процессов адипогенеза и липогенеза в последующем процессе, вызванных внутриутробными запрограммированными изменениями не только регуляции экспрессии генов и его транскрипции, но и придания важных посттрансляционных модификаций , многие из которых могут иметь долгосрочные программные последствия.

Учитывая, что внутриутробное программирование более поздней метаболической функции жизни имеет решающее значение для нашего понимания эволюции более поздних жизненных заболеваний, а также развития ожирения, связанного с IUGR, представляющего собой ведущую проблему общественного здравоохранения, дальнейшее выяснение молекулярного происхождения висцерального ожирения в IUGR / Для взрослых детей LBW это оправданно. Поэтому мы стремились исследовать взаимосвязь между несколькими критическими регуляторами метаболизма жировых липидов у потомства LBW от IUGR, индуцированного UPI. Мы предположили, что молодое взрослое потомство LBW будет отображать измененную жироподобную молекулярную сигнатуру генов, miRs и посттрансляционных модификаций белков пути синтеза липидов, возникающих в связи с увеличением висцерального ожирения.

Уход за животными, уход и хирургия проводились в соответствии с рекомендациями Канадского совета по уходу за животными. Подкомитет по использованию животных Университета Западного Онтарио утвердил все процедуры.

Связанные с длительным сроком беременности беременные морские свинки Dunkin-Hartley (Charles River Laboratories, Wilmington, MA, USA) размещались в контролируемой среде с температурой (20 ° C) и влажностью (30%) с 12-часовым темно-темным циклом и имели доступ к морская свинка и вода из крана, предоставленная ad libitum.

Все беременные морские свинки подверглись абляции маточной артерии (UAA) на середину беременности (~ 32 дня, срок ~67 дней), чтобы индуцировать UPI и IUGR, как описано ранее [40]. Вкратце, свиноматки были вызваны в анестезиологической камере (4-5% изофлурана с 2 л / мин O2, затем 2,5-3% изофлурана с 1 л / мин O2 для поддержания). Сразу после индукции вводили подкожную инъекцию Robinul (Glycopyrrolate, 0,01 мг / кг, Sandoz Can Inc., Montreal QC). Срезы средней линии были сделаны ниже пупка, чтобы выявить бикорнатную матку, и было отмечено количество плодов. В то время были идентифицированы артериальные сосуды, и каждая вторая ветвь была прижигана с использованием электрохирургического генератора Aaron 2250 (Bovie Medical, Clearwater, FL). Сразу же после операции вводили подкожную инъекцию Temgesic (бупренорфин, 0,025 мг / кг, Schering-Plough Co., Kenilworth NJ). Свиноматки производились самопроизвольно, в это время потомство взвешивалось, а щенки весом менее 85 грамм в каждом подстилке определялись как низкий вес при рождении (LBW), тогда как те, которые классифицировались как нормальный вес при рождении (NBW), весили более 90 граммов. Щенки LBW и NBW оставались с их плотинами в течение 14-дневного периода лактации. За пять дней до отлучения всех щенков вводили в контрольную диету (Harlan Laboratories TD.110240: 21,6% белка, 18,4% жира, 60% углеводов) и отняли от груди в послеродовой день 15 послеродовой период. После отлучения и после этого у потомков LBW (n = 5) и NBW (n = 7) у детей был доступ к контрольной диете и водопроводной воде, а также в отдельных клетках. Щенки взвешивали ежедневно до 50-го дня после родов, после чего веса регистрировали два раза в неделю. Потребление пищи измерялось ежедневно в течение всего эксперимента. Для этого исследования использовали только самцов, так как изменяли уровни эстрогенов в эстральном цикле с остро модулированной ожирением и липидным обменом в парафитриальной жировой клетке [41].

В возрасте ~ 120 дней проводилась компьютерная томография in vivo для количественной оценки общей жировой ткани, общей мышечной массы и кости всего тела (от проксимальной большеберцовой кости до основания черепа) [42]. Анестезию у животных индуцировали в анестезиологической камере (4-5% изофлурана с 2 л / мин O2) и поддерживали 1,5-3% изофлурана. Впоследствии изображения были сделаны на срезах 1,25 мм, с настройками напряжения и тока при 80 кВ и 100 мА соответственно, с использованием сканера Discovery CT750 HD (GE Healthcare, Миссиссауга, ОН). Используя приложение, разработанное в MATLAB (The Mathworks Inc., Natick, MA), жировая ткань, мышца и кость были дифференцированы пороговыми фрагментами изображения КТ морской свинки [43]. Используя размер пикселя и толщину каждого фрагмента изображения ТТ, объемы (см3) жировой ткани, мышцы и кости были рассчитаны для каждого среза изображения и суммированы для каждого типа ткани индивидуально. Суммарный объем каждого типа ткани нормализуется до массы тела и выражается в процентах от общего объема тела.

В послеродовый день 145, что соответствует молодости взрослой жизни [44], однодневное голодание потомство умерщвлялось ингаляцией СО2. Брюшную полость открывали, и образцы крови из нижней полой вены сразу же собирали в ЭДТА (BioShop Canada Inc., Burlington, ON), подвергали центрифугированию 2000 × g в течение 15 мин при 4 ° С и плазме, хранящейся при -80 ° С для последующего анализа. Эпидидимальная белая жировая ткань (EWAT), окружающая эпидидимид, проецирующая вперед во внутрибрюшной полости вдоль брюшины, удалялась и взвешивалась большая висцеральная жировая ткань у морской свинки [45], а часть замораживалась в жидком азоте для более поздних молекулярных анализ. Для гистологического анализа часть EWAT медленно замораживалась в охлажденном изопентане (Sigma-Aldrich Canada Ltd., Oakville ON). Затем все образцы хранили при -80 ° C до анализа. Были также взвешены ретроперитонеальные и брыжеечные жировые ткани, замораживались и хранили при -80 ° C. Поскольку относительный вес забрюшинного и брыжеечного складов не изменился между потомками NBW и LBW (0,007 ± 0,001 против 0,009 ± 0,003, p = 0,34 и 0,012 ± 0,002 против 0,014 ± 0,003, p = 0,5 соответственно), только исследование молекулярной сигнатуры EWAT.

Содержание липидов в замороженном EWAT (250 мг) определяли с использованием метода экстракции хлороформ / метанол [46] и выражали по отношению к влажной ткани. Для морфологии клеток медленно замороженные образцы EWAT фиксировали в 4% параформальдегиде (Billerica, MA) в течение 12 часов в течение ночи. На следующий день фиксированные ткани обрабатывали с использованием процессора Leica ASP300 (Leica Microsystems, Nussloch), который включал постепенную инкубацию этанола, ксилольные промывки и инфильтрацию парафина через 13-часовой цикл. Ткани затем вставляли в парафин с использованием Shandon Histocentre 3 (ThermoFisher Scientific, Gormley, ON). Три последовательных поперечных сечения (5 мкм) на животное были разрезаны на микротом Leica RM2255 (Leica Biosystems, Nussloch). На микроскопе (Leica DMIL LED, Leica Microsystems CMS GmbH, Wetzlar) с увеличением 10 × с помощью Leica Application Suite версии 3.8.0 (Leica Microsystems, Heerbrugg) на микроскопе были зафиксированы захваченные гематоксилин и эозин (H & E) поперечные сечения (Leica DMIL LED, Leica Microsystems CMS GmbH, Wetzlar). Отдельные области около 400 адипоцитов в трех срезах измерялись с использованием программного обеспечения Image-Pro Plus версии 7.0 (Media Cybernetics Inc., Bethesda, MD). Результаты, соответствующие средней площади (K), определенной на трех участках каждого образца жировой ткани, были выражены как средний диаметр (d) в мкм, учитывая адипоциты в виде сферических клеток и следуя формуле где π = 3,142. Количество адипоцитов на грамм ткани рассчитывали путем деления общего содержания липидов на грамм ткани (описанного выше) на средний оценочный объем (V) адипоцитов, рассчитанный следующим образом: V (μm3) = 4/3 × π × R3 где R = d / 2.

Для полных выделений РНК (мРНК и микроРНК) образцы EWAT (~ 200 мг каждый) гомогенизировали в 1 мл TRIzol (Invitrogen, Carlsbad, CA) с использованием T 10 базового ULTRA-TURRAX (IKA, Wilmington, NC) и супернатантом сохраняли и отделяли от липидов путем добавления хлороформа (1 об. / 5 об.) и центрифугирования (12000 × г, 15 мин, 4 ° С). Затем водную фазу использовали для очистки РНК с использованием E.Z.N.A. Полный комплект РНК I согласно инструкциям производителя (Omega Bio-Tek, Norcross, GA). Количественную оценку РНК проводили с использованием спектрофотометра Nano-Trop ND-1000 (Thermo Fisher Scientific, Рочестер, Нью-Йорк), и использовали только те образцы, которые отображали коэффициент поглощения 260/280 между 1,9 и 2. Целостность РНК дополнительно оценивали на денатурирующем агарозном геле, окрашенном бромидом этидия. Для более поздних анализов использовалась только высококачественная РНК с четкими полосами 28S и 18S рРНК и приблизительно с соотношением 2:1 (28S: 18S).

РНК (1 мкг) транскрибировали с обратной транскрипцией с использованием обратной транскриптазы M-MLV (Life Technologies, Burlington, ON) и C1000 Thermal Cycler (Bio-Rad, Mississauga, ON). Все праймеры для целевого и контрольного генов были сконструированы из последовательностей морских свинок (cavia porcellus) с использованием инструмента NCBI / Primer-BLAST (таблица 1), за исключением GLUT4 (ранее опубликованного для использования в жировой ткани гвиней [47]). Специфика праймеров (три пары для каждого гена) была проверена путем проведения анализов кривой плавления и последующего подтверждения размера продукта RTq-PCR с 1,2% агарозным гелем. Эффективность амплификации реакции RTq-PCR определялась для каждой мишени и для эталонного гена с использованием стандартных кривых, генерируемых с уменьшением концентрации образцов кДНК. Эффективность амплификации во всех наборах праймеров составляла от 90% до 100%. Количественные (RTq-PCR) экспрессии генов выполняли с 3 мкл ретрансляционной РНК с использованием реагентов SYBR Green I в системном приборе CFX384 Real-Time (Bio-Rad). Проводились 40 циклов амплификации, каждый цикл состоял из денатурации при 95 ° С в течение 15 с, отжига при 55 ° С в течение 15 с и растяжения при 72 ° С в течение 20 с. Контрольные образцы, не содержащие кДНК, использовали для подтверждения отсутствия заражения ДНК. Значения циклов квантования (Ct) — это средства трехкратных измерений. В предварительных экспериментах значения β-актина Ct не были согласованы между группой NBW и LBW (15,3 ± 0,2 против 16,1 ± 0,2 соответственно, p <0,05), тогда как глицеральдегид-3-фосфатдегидрогеназа (GAPDH) отображала согласованные значения Ct между группами NBW и LBW (21,2 ± 0,3 против 21,5 ± 0,3 соответственно, p = 0,45) и использовали в качестве эталонного гена. Уровень транскрипции генов-мишеней затем нормализуется к гену GAPDH уровня транскрипции. Сложная экспрессия каждого отдельного гена-мишени определялась методом 2-ΔΔt [48].

* Номер доступа для последовательностей в базе данных Национального центра биотехнологической информации (NCBI) или браузера генома Ensembl.

FAS, синтаза жирных кислот; АКК (1) и (2), ацетил-СоА-карбоксилазу 1 и 2; ACSL1, член семейства длинноцепочечных ацил-CoA-синтетаз 1; DGAT (1) и (2), диацилглицерол-ацилтрансфераза 1 и 2; ATGL; жировая триглицеридная липаза, HSL, чувствительная к гормонам липаза; FABP4, связывающий жирные кислоты белок 4; CD36, кластер дифференцирования 36; HK2, гексокиназа 2; GLUT4, транспортер глюкозы 4; GLUT1, транспортер глюкозы 1; ADIPOQ, адипонектин; MCP-1, моноцитарный хемоаттрактантный белок-1; TNFα, фактор некроза опухоли альфа; PPARγ1, активированный пролифератором пероксисома рецептор-гамма 1; SREBP-1c, стерол-регуляторный элемент-связывающий белок-1c; NCoR1, корепрессор ядерного рецептора 1; GAPDH, 3-фосфатдегидрогеназы глицеральдегида.

Общая РНК, включающая miR-фракцию, выделяли, как описано выше. Обратную транскрипцию miRs проводили согласно инструкции набора miScript II RT (Qiagen, Toronto, ON). Образцы из тканей NBW и LBW EWAT выполняли в трех повторностях с использованием набора микроскопов miScript SYBR Green PCR Kit (Qiagen) в системном приборе Bio-Rad CFX384 Real-Time. Грунты для экспрессии miR были разработаны и подтверждены Qiagen и включали miR-27a (5′-UUCACAGUGGCUAAGUUCCGC-3 ‘), miR-27b (5′-UUCACAGUGGCUAAGUUCUGC-3’), miR-378 (CUCCUGACUCCAGGUCCUGUGU) miR-24 (5 ‘-UGGCUCAGUUCAGCAGGAACAG-3′), miR-145 (5’-GUCCAGUUUUCCCAGGAAUCCC-3 ‘), miR-103-2 (5′-AGCAGCAUUGUACAGGGCUAUGA-3′), miR-222 (5’-AGCUACAUCUGGCUACUGGGU-3 ‘), miR -223 (5’-UGUCAGUUUGUCAAAUACCCC-3 ‘) и miR-103-1 (5′-GGCUUCUUUACAGUGCUGCCUUGU-3’). Сгибающее выражение каждой индивидуальной миридной мишени определяли по методу 2-ΔΔt и нормировали на экспрессию GAPDH [49].

Образцы EWAT (~ 200 мг каждый) гомогенизировали с помощью T-10 основного ULTRA-TURRAX (Bio-Rad) в 0,8 мл ледяного лизирующего буфера (рН 7,4), содержащего 10 ммоль / л основания Триса (Thermo Fisher Scientific, Whitby , ON), 1 ммоль / л ЭДТА (Sigma-Aldrich), 0,25 моль / л сахарозы (Thermo Fisher Scientific), коктейль ингибитора протеазы (EMD Millipore, Billerica, MA) и ингибиторы фосфатазы (1 M NaF, 0,2 M Na2Vo4 ). Гомогенаты перемешивали в течение 1 часа на льду, используя трубчатый ротатор (VWR, London, ON) и затем центрифугировали при 10000 × g при 4 ° С в течение 15 мин. Полученные супернатанты собирали и общую концентрацию белка в экстрактах оценивали с помощью реагентов анализа белка DC (Bio-Rad) с использованием BSA (AMRESCO, Solon, Ohio) в качестве стандартной ссылки. Экстракты белков мигрировали на Nu-PAGE 4-12% гель Bis-Tris (Life Technologies) и переносили на переносные мембраны Immobilon (EMD Millipore). Мембраны блокировали в течение ночи при 4 ° С трис-буферным солевым раствором (TBS) / 0,1% Tween 20 (Thermo Fisher Scientific), содержащим 5% обезжиренного молока. Затем блоты инкубировали с первичными антителами в TBS / 0,1% Tween 20, содержащем 5% обезжиренного молока или альбумина бычьей сыворотки в течение 2 часов при комнатной температуре. Антитела кролика (Santa Cruz Biotechnology, Santa Cruz, CA) против FAS (sc-20140), ACC (C83B10) и антифосфо-ACC (Ser79) (№ 3661), анти-фосфо-AMPKα (Thr172) (40H9) антитела (Cell Signaling Technology, Whitby, ON) использовали при конечном разведении 1:000. Кролик-антифосфо-PPARγ (Ser273) (bs-4888R) (Bioss Inc, Woburn, MA) использовали при окончательном разбавлении 1/500. Затем кляксы промывали в 0,1% Tween 20 / TBS и инкубировали при комнатной температуре в течение 1 часа со вторичным конъюгированным антителом к ​​пероксидазе хрена кролика (1:10,000) (технология клеточной сигнализации) в 0,1% Tween 20 / TBS, содержащем 5% обезжиренного молока или альбумин бычьей сыворотки. При разбавлении 1/50000 использовали β-актин мыши (A 5316) (Sigma-Aldrich). Протеиновые полосы были обнаружены субстратом Luminata Classico West Blot HRP (EMD Millipore). Сигнал хемилюминесценции захватывали с помощью люминесцентного анализатора изображений (Bio-Rad), а значения денситометрии (произвольные единицы) определяли с использованием программного обеспечения ImageQuant LAS 4000 (Bio-Rad). Обилие целевых белков было выражено относительно количества белка β-актина в каждом образце.

Уровни холестерина и триглицеридов натощак в плазме определяли количественно с помощью колориметрических анализов с использованием реагентов (комплекты № 11447513216, 11491458216 и 11877771216 соответственно) от Roche Diagnostics (Laval, QC). Все анализы проводились на автоанализаторе Cobas Mira S (Laval, QC). Внутреннее исследование CV для измерения уровня глюкозы, общего холестерина и триглицеридов составляло 1,7, 1,9 и 2% соответственно. Интер-анализ CV для измерения уровня глюкозы, общего холестерина и триглицеридов составлял 1,5, 3,2 и 2,6% соответственно.

Данные представлены как средства ± SEM. Статистическую значимость определяли с использованием двухстороннего непарного t-теста с GraphPad Prism 5 (GraphPad Software, San Diego, CA). Значения p≤0,05 считались статистически значимыми.

Вес тела щенков LBW при рождении был на 28% меньше, чем у щенков NBW (p <0,001). Щенки LBW продолжали демонстрировать низкий вес по сравнению с НБВ на ранней постнатальной жизни (день 1-й день 98) (рис. 1А и 1С). Со дня 98 до конца эксперимента (день 145), соответствующего раннему взрослому состоянию, массы тела были одинаковыми между животными NBW и LBW (рис. 1B и 1C). Во время раннего периода отлучения до 60 дней относительное ежедневное потребление энергии (ккал / день / г массы тела) было выше в LBW по сравнению с морскими свинками NBW (p≤0,05), но не сильно отличалось (p> 0,10, Рис. 1D). Концентрации глюкозы и триглицеридов в плазме, измеренные в 145-дневном возрасте, существенно не различались в НБВ (10,43 ± 2,71 и 1,38 ± 0,40 ммоль / л соответственно) по сравнению с LBW (18,45 ± 4,26 и 1,24 ± 0,27 ммоль / л соответственно, p> 0,10) , Общий холестерин в плазме увеличился на 32% в ЛБВ (1,08 ± 0,09 ммоль / л) по сравнению с НБВ (1,42 ± 0,12 ммоль / л), хотя это статистически не статистически (р = 0,063).

A и B, веса животных при рождении и соответственно откладываются. C, веса животных в течение всего эксперимента. Открытые круги представляют животных НБВ; и закрытые квадраты, животные LBW. D, Потребление пищи животных от отъема до выпадения. Данные представляют собой средства ± SEM (n = 7 для NBW и n = 5 для LBW). Значимость была определена с помощью двухстороннего непарного студенческого t-теста. * p <0,05, ** p <0,01, *** p <0,001.

Для оценки состава тела у потомков НБВ и ЛБВ, КТ-сканирование проводилось в возрасте ~ 120 дней (рис. 2А и 2В). Общий относительный объем мышц, жира и кости для области между проксимальной большеберцовой костью до основания черепа был похож на потомство LBW и NBW (рисунок 2C). Интересно, однако, что при сборке тканей (145 дней) относительный вес EWAT (масса тела г / г) был на 36% выше в ЛБВ по сравнению с НБВ (р <0,05, фиг. 3А). Количество липидов [(г на г EWAT) × 100] было несколько больше (+ 9%, p = 0,05) (рисунок 3B), а средний диаметр эпидидимального адипоцита был увеличен на 15% (p <0,05) в сравнении с LBW к NBW (рисунки 3C и 3F). Процентная доля придаточных малых адипоцитов с диаметром от 40 до 50 мкм была ниже (р <0,01), а процент больших адипоцитов с диаметром от 70 до 90 мкм был больше (p <0,05), в LBW относительно группы NBW (Рисунок 3D). Следовательно, количество клеток на грамм EWAT было значительно ниже (-26%, p <0,05) в LBW по сравнению с животными NBW (рисунок 3E).

Гвинейских свиней анестезировали и отсканировали от проксимальной большеберцовой кости до основания черепа, и изображения были взяты на уровне 1,25 А, срединном изображении НТВ; B, срез изображения CT-scan LBW. Жировая ткань характеризуется более низким сигналом интенсивности (более темные области на изображении). Показана площадь, занимаемая костью, эпидидималом (EWAT) и паховыми жирами. C Объемы, занимаемые мышцами, жиром и костью в области между проксимальной большеберцовой костью и основанием черепа, рассчитывали с использованием приложения, разработанного в MATLAB, нормированного на массу тела и выраженного в процентах от общего объема тела. Значения представляют собой ± SEM; n = 5 для NBW и n = 4 для LBW. Значимость была определена с помощью двухстороннего непарного студенческого t-теста.

A, белая эпидидимальная жировая ткань (EWAT), скорректированная по массе тела; B, содержание клеточного липида эпидидимального жира; C, средний диаметр адипоцита эпидидима; D, распределение эпидидимального адипоцита на основе диаметра клетки; E, число эпидидимальных клеток на грамм EWAT; F, репрезентативные изображения EWAT (увеличение 10 ×). Данные представляют собой средства ± SEM (n = 7 для NBW и n = 5 для LBW). Значимость была определена с помощью двухстороннего непарного студенческого t-теста. * p <0,05, ** p <0,01, *** p <0,001.

ACC1 участвует в развитии жировой ткани и синтезе липидов. Экспрессия мРНК ACC1 была выше в LWW EWAT по сравнению с потомством NBW (p <0,05, фиг. 4A). Кроме того, экспрессия мРНК DGAT2, катализатор синтеза триглицеридов была увеличена в EWAT LBW, хотя это не достигало статистической значимости (p = 0,09, фиг. 4A). Кроме того, экспрессия мРНК HSL, ключевого фермента в регуляции хранилищ липидов и FABP4, фактор липидного обмена в жировой ткани, была значительно увеличена в EWAT LBW по отношению к группе NBW (p <0,05 и 0,01 соответственно, рис. 4B). Кроме того, экспрессия мРНК PPARγ1, регулятор адипогенеза, а также синтез липидов в жировой ткани, была значительно выше в LWW EWAT (p <0,05, рисунок 4C). Однако экспрессия мРНК других регуляторов транскрипции крови (SREBP-1c и NCoR1), также участвующих в регуляции метаболизма липидов, была неизменной. Экспрессия мРНК нижележащих липогенных мишеней PPARγ / SREBP-1c, FASN, ACSL1 и DGAT1 не изменялась между NBW и LBW (рисунок 4A). Кроме того, экспрессия мРНК АТГЛ (участвующая в расщеплении триглицеридов), CD36 и ACC2 (вовлеченная в поглощение и окисление жирных кислот), а также GLUT4, GLUT1 и HK2 (компоненты метаболизма глюкозы) в EWAT не отличалась между потомками LBW и NBW ( Фиг.4В, 4С). Наконец, значительное увеличение экспрессии мРНК моноклитического белка-1 (MCP1) моноцитов наблюдалось также в LWW EWAT (p <0,05), хотя экспрессия мРНК адипокинов (ADIPOQ и TNFα) не изменялась (рисунок 4D).

экспрессию мРНК липогенных генов (A), генов, участвующих в мобилизации жирных кислот и транспорте (B), регуляторов ядерной транскрипции и генов метаболизма глюкозы (C) и адипокинов (D). Сложную экспрессию каждого отдельного гена-мишени рассчитывали по транскрипту мРНК GAPDH. мРНК в LBW представлены относительно мРНК-выражений НБВ. Данные представляют собой средства ± SEM; n = 7-6 для NBW и n = 5-4 для LBW. Значимость была определена с помощью двухстороннего непарного студенческого t-теста. Ψp <0,10, * p <0,05, ** p <0,01.

Посттрансляционная модификация белков, включая фосфорилирование, способствует регуляции липидного обмена. Чтобы дополнительно характеризовать молекулярные и метаболические изменения, связанные с увеличением EWAT в LBW, мы исследовали состояние фосфорилирования ключевых регуляторов биосинтеза жирных кислот, AMPK, ACC и PPARγ. В потомстве EWAT у LBW наблюдалось уменьшение в 3,9 раза (p <0,001) фосфо-ACC (Ser79), тогда как общий белок ACC не был существенно иным (p = 0,102, фиг. 5A) между 2 группами. В соответствии с уменьшенным фосфо-АКК фосфо-AMPKα (Thr172) имел тенденцию быть ниже в EWAT LBW против NBW (-73%, p = 0,076, фиг. 5B). Общий белок AMPK был сопоставим и не сильно различался между двумя группами (рис. 5B). Кроме того, животные LBW имели значительное 1,5-кратное снижение фосфо-PPARγ (Ser273), (p = 0,047, фиг. 5D). Уровни белка FAS не отличались между экспериментальными группами (p = 0,989, фиг. 5C).

На левой панели показаны репрезентативные вестерн-блоты, а на правой панели показаны обобщенные данные денситометрического анализа. A, обилие фосфо-ACC (Ser79) и общего белка ACC. B, обилие фосфо-AMPKα (Thr172) и общих белков AMPK. C и D, обилие FAS и фосфо-PPARγ (Ser273) белков. Уровни белка были нормализованы до уровня уровней белка β-актина. Данные представляют собой средства ± SEM (n = 7-6 для NBW и n = 5 для LBW). Значимость была определена с помощью двухстороннего непарного студенческого t-теста. * p <0,05, *** p <0,001.

Для оценки потенциальных дополнительных медиаторов увеличенного относительного веса EWAT, связанного с LBW, была исследована экспрессия девяти miRs, связанных с развитием жировой ткани (рис. 6). Интересно, что LBW ассоциировался с повышенной экспрессией miR-24 (+ 70%, p <0,05) и miR-103-2 (+ 231%, p <0,01), связанных с размером адипогенеза и адипоцитов соответственно. Экспрессия других miRs, связанных с адипогенезом (miR-27a, miR-27b, miR-145 и miR-222), липогенеза (miR-378), размера клеток (miR-103-1) и активации макрофагов (miR-223 ) в жировой ткани не было существенно различно в EWAT LBW против NBW в этом возрасте (рис. 6).

miR-27a, miR-27b, miR-378, miR-24, miR-145, miR-103-1, miR-103-2, miR-222 и miR-223, все связанные с развитием жировой ткани, были измерены RT- КПЦР. Фрагментное выражение каждой индивидуальной миридной мишени рассчитывали по транскрипту мРНК GAPDH. miR-выражения в LBW (n = 5) представлены относительно miR-экспрессии NBW (n = 7). Значимость была определена с помощью двухстороннего непарного студенческого t-теста. * Р <0,05.

Настоящее исследование демонстрирует, что LBW, вызванный абляцией маточной артерии, ассоциируется с постнатальным повышенным отложением липидов и клеточной гипертрофией в EWAT, крупном висцеральном депо у морской свинки. Важно отметить, что в раннем взрослом возрасте наблюдалось отсутствие изменений в составе всего тела и, в частности, отсутствие увеличения общего жира в организме. Он также выявляет постоянные изменения экспрессии генов и miRs и посттрансляционных модификаций, которые, как известно, регулируют накопление липидов в постнатальной жизни. Вместе эти результаты подтверждают концепцию внутриутробно запрограммированной дисрегуляции синтеза липидов и накопления в висцеральной жировой ткани молодого взрослого самца LBW. Они также предполагают, что эти наблюдаемые молекулярные изменения являются факторами, а не последствиями повышенного висцерального ожирения, зарегистрированного у потомства LBW. Самая поразительная новизна настоящего исследования заключается в том, что после неблагоприятной среды в матке у потомства LBW проявляется повышенный липидный синтез и гипертрофия адипоцитов в висцеральной жировой ткани в сочетании с измененным липогенным статусом фосфорилирования белка и экспрессией miR.

Увеличенный относительный вес EWAT был обнаружен у 145-дневного потомка морской свинки LBW, независимо от изменений в составе всего тела. Аналогичное наблюдение также было зарегистрировано в модели IUGR, индуцированной крысами UPI, где масса эпидидимальной жировой прокладки в возрасте 30 недель была значительно увеличена, но вес тела не изменялся [50]. В дополнение к увеличенной массе EWAT у потомства мужского пола LBW, о котором сообщалось в текущем исследовании, также был увеличен средний диаметр эпидидимальных адипоцитов, что указывает на увеличение клеток в этой ткани, предположительно связанное с повышенным хранением липидов. Действительно, потомство LBW показало более высокое содержание липидов в эпидидимальной жировой ткани по сравнению с NBW. Нынешнее наблюдение гипертрофических адипоцитов согласуется с взрослым возрастанием расширения адипоцитов, продемонстрированным в 50% -ной модели крысы IUGR, ограниченной потреблением пищи [39], что указывает на то, что дисрегуляция морфологии адипоцитов в эпидидимальной жировой ткани может быть запрограммирована внутриутробно. В целом, вышеупомянутые наблюдения подчеркивают потенциальное участие пренатального роста в регуляции распределения жира и морфологии.

В настоящем исследовании было рассмотрено несколько возможных медиаторов наблюдаемых гипертрофических адипоцитов. Мы подтверждаем, что увеличение содержания липидов и гипертрофии адипоцитов в EWAT объясняется повышенной экспрессией мРНК ACC1 в сочетании с уменьшением фосфо-АКК (Ser79). В жировой ткани повышенное фосфорилирование АКК на Ser79 ингибирует активность АКК и тем самым уменьшает образование малонил-СоА, субстрата синтеза жирных кислот [10], [51], [52]. Сообщалось также, что активация жировой AMPKα посредством специфического фосфорилирования на Thr172 приводит к фосфорилированию ACC при Ser79, что ингибирует синтез жирных кислот [10]. Следовательно, снижение фосфо-AMPKα (Thr172) и последующее уменьшение фосфо-ACC (Ser79) в сочетании с повышающей регуляцией мРНК ACC1 могут быть связаны с продвижением синтеза жирных кислот и увеличением клеток в EWAT LBW. Хотя это и не существенно, повышенная экспрессия мРНК липогенного гена DGAT2, обнаруженного в EWAT потомства LBW, также может способствовать увеличению липидного состава и, следовательно, гипертрофии адипоцитов в этом жировом отложениях в раннем взрослом возрасте. Для подтверждения этой гипотезы потребуется дополнительный анализ белка.

Хотя наши данные предполагают, что липогенные гены участвуют в увеличении EWAT у молодых взрослых морских свинок LBW, мы расширили наши исследования, чтобы исследовать возможность того, что гены, участвующие в использовании нелипидных субстратов, таких как глюкоза, для синтеза de novo жирных кислот в адипоциты. Несмотря на непропорциональное увеличение массы EWAT и доказательство увеличения содержания липидов в EWAT у потомства LBW, не было изменений в экспрессии мРНК переносчиков глюкозы GLUT4 и GLUT1, а также гликолитического гена HK2 у потомства LWW EWAT. Отсутствие изменений в этом наборе генов происходило в сочетании с неизменным уровнем глюкозы натощак. Исходя из этого, мы предполагаем, что изменения в базальном поглощении глюкозы в EWAT вряд ли внесет существенный вклад в увеличение синтеза липидов и последующее осаждение EWAT у потомства LBW. Это подтверждают предыдущие исследования, которые показали, что в отличие от крысиных жировых клеток, эпидидимальные жировые клетки морских свинок используют ацетат и лактат в качестве липогенных субстратов и плохо используют глюкозу [53], [54]. Однако, хотя глюкоза не может играть важную роль в жире морских свинок, мы не можем исключать, что включение ацетата и лактата в эпидидимальные адипоциты не изменяется у потомства LBW.

В жировой ткани липолиз регулируется серией липаз, причем ATGL является основной липазой на начальной стадии гидролиза триглицеридов и HSL, действующей на последовательной стадии гидролиза диглицеридов [26], [55]. В настоящем исследовании экспрессия мРНК HSL, но не ATGL, была увеличена в EWAT LBW по сравнению с потомством NBW. Это увеличение экспрессии HSL согласуется с выраженной экспрессией HSL висцеральной жировой ткани, которая, как сообщается, встречается у детей с дефицитом питательных веществ IUGR, [39]. В этом предыдущем исследовании сообщалось о повышенном высвобождении жирных кислот из IUGR адипоцитов, которые, вероятно, способствуют повышению уровня жирных кислот в плазме, как следствие увеличения количества жировой HSL. Интересно, что это не похоже на морскую свинку, поскольку уровни триглицеридов в плазме не изменялись между потомками LBW и NBW. Поскольку 60% жирных кислот, образующихся в результате липолиза жировой ткани, повторно этерифицируются у голодных крыс [56], и повторная этерификация жирных кислот из интраадипоцитарного липолиза может участвовать в синтезе триглицеридов адипоцитов [22], оказалось бы, что увеличение HSL экспрессия в EWAT LBW способствует увеличению содержания липидов в этой ткани. Кроме того, повышенная экспрессия мРНК FABP4 в EWAT морских свинок LBW также подтверждает идею о том, что увеличение экспрессии алипоцитов HSL способствует увеличению образования свободных жирных кислот для синтеза и хранения липидов в придаточных эпидидиматах потомства LBW. Действительно, FABP4 влияет на метаболизм внутриклеточного липида путем переноса жирных кислот или субстратов жирных кислот в ядро ​​для регуляции транскрипции, митохондрий для β-окисления и липидных капель для хранения в качестве триглицеридов [23].

Показав участие оси AMPK / ACC, DGAT2, FABP4 и HSL в увеличенном содержании липидов, наблюдаемом в EWAT потомства LBW, были изучены роли дополнительных механизмов молекулярной сигнализации. Лиганд-активированный ядерный транскрипционный фактор PPARγ экспрессируется во взрослых адипоцитах и ​​регулирует адипогенез и гены, участвующие во всех путях метаболизма липидов, включая синтез жирных кислот, что приводит к увеличению отложения жира [13], [57], [58]. Статус фосфорилирования играет ключевую роль в регуляции активности белка, особенно в том, что касается адипогенеза и липогенеза [10], [59], [60]. У мышей с нокаутом Corepressor (NCoR) с адипоцитовым ядром (NCOR) мышечные выходы (AKO) проявляют снижение связанного с циклинзависимой киназой (Cdk5) фосфатирования PPARγ (Ser273) как в эпидидидиальной жировой ткани, так и в первичных адипоцитах, что приводит к конститутивной активации увеличения PPARγ -ответственные гены. Такое уменьшение фосфо-PPARγ сопровождалось повышенной экспрессией мРНК PPARγ и гиперплазией внутри висцеральной эпидидидимальной жировой ткани [14]. Интересно отметить, что в LBW EWAT был снижен фосфо-PPARγ (Ser273) и повышенная экспрессия мРНК PPARγ1, несмотря на любые изменения экспрессии мРНК кофактора PPARγ SREBP-1c и PPARγ corepressor NCoR1. Кроме того, наблюдалась гипертрофия адипоцитов, но не гиперплазия. Таким образом, запрограммированная увеличенная мРНК PPARγ1 и уменьшенный фосфо-PPARγ (Ser273), индуцированный в ситуациях ограниченного питания питательных веществ в матке, могут быть вовлечены в увеличение экспрессии ACC1 и, следовательно, активацию синтеза липидов в EWAT. Действительно, адипогенный / липогенный транскрипционный фактор PPARγ регулирует экспрессию ряда нижележащих липогенных генов в эпидидимальной жировой ткани, включая АКК [13]. Кроме того, учитывая, что появляется негеномная роль PPARγ [61], снижение фосфо-PPARγ (Ser273) в виде внутриутробного действия, вероятно, является важным фактором фенотипа EWAT потомства LBW. Такие эффекты, по-видимому, не связаны с экспрессией гена NCoR1 или SREBP-1c, хотя необходимы дальнейшие исследования, чтобы пролить свет на специфический фактор, который способствует снижению фосфорилирования PPARγ в более поздней жизни LBW EWAT.

В дополнение к посттрансляционной модификации сообщается, что miRs играют роль в липогенезе, размере адипоцитов и адипогенезе. Чрезмерная экспрессия miR-103 в эпителиальных клетках козьей молочной железы приводит к увеличению транскрипции генов, связанных с синтезом жиров молочной железы козьего жира, включая PPARγ, ACC1 и FAS [62]. И наоборот, глушение miR-103 снижает общий жир за счет уменьшения размера адипоцитов у мышей [17], что указывает на то, что он играет роль в регулировании размера адипоцитов. Еще один miR, участвующий в накоплении жировой ткани, miR-24, увеличивается в эпидидимальных адипоцитах из дефицита лептина ob / ob и ожирения с диетой (DIO) [15]. Другие исследования сообщили о вовлечении miR-24 в адипогенез [16], [18]. В текущем отчете мы наблюдали увеличение miR-24 и miR-103-2 в EWAT у молодых взрослых детей LBW. Механизмы, лежащие в основе этого запрограммированного повышения в более позднем возрасте после неблагоприятных условий в матке, еще не определены. Однако в канцерогенезе было изучено несколько контролируемых гипоксией miR, включая miR-24, miR-103-1 и miR-103-2, и показано, что они способствуют выживанию клеток в гипоксических микросредах [63]. Таким образом, возможно, что экспрессия miR-103-2 и miR-24 представляет собой маточно-запрограммированный механизм в гипоксической ситуации, например, при абляции маточной артерии [64], что может увеличить синтез жирных кислот адипоцитов посредством активации PPARγ и ACC1 в этой ткани. В будущих исследованиях следует попытаться выяснить точную роль miR-24 и miR-103-2 при гипертрофии висцерального адипоцита у потомства LBW и определить их прямые ассоциации с PPARγ или другими генами, участвующими в метаболизме липидов, такими как ACC1, DGAT2, FABP4 и HSL ,

Таким образом, эти данные показывают, что LBW, индуцированный UPI, связан с увеличением осаждения висцеральной жировой ткани, который включает активную модуляцию генов, miRs и посттрансляционных модификаций, которые влияют на анаболизм липидов и их хранение у самцов морских свинок в раннем взрослом возрасте. Наши результаты подтверждают концепцию внутриутробного программирования свойств постнатальной висцеральной жировой ткани независимо от изменений состава всего тела и проливают свет на потенциальные механизмы, которые приводят к накоплению послеродовой висцеральной жировой ткани после развития в неблагоприятной среде внутриутробно.

Мы хотели бы поблагодарить Брэда Матушевского за его помощь в операциях на животных и Дженнифер Хадуэй и Фэн Су за их техническую помощь во время КТ-изображений. Мы также признаем Синтия Г Савейз (Отдел сосудистой биологии, Исследовательский институт Robarts, Лондон, США, Канада) для измерения плазмы, Келли Галловей-Кей (Молекулярная патологическая база, Исследовательский институт Robarts, Лондон, США, Канада) для обработки жировой ткани и Карен Найгард (Исследовательский центр по исследованию изменения климата Biotron, Университет Западного Онтарио, Лондон, США, Канада) за ее помощь в анализе гистологии.

Комментариев нет.

Добавить комментарий

Ваш e-mail не будет опубликован. Обязательные поля помечены *