Нажмите "Enter", чтобы перейти к контенту

Система CRISPR / Cas9 инактивирует латентную провирусную ДНК ВИЧ-1

The CRISPR/Cas9 system inactivates latent HIV-1 proviral DNA
Источник: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4359768/

Высокоактивная антиретровирусная терапия (ВААРТ) трансформировала инфекцию ВИЧ-1 от смертельной болезни к управляемому хроническому заболеванию, хотя и не обеспечивает лечения. Недавно разработанная система редактирования генома CRISPR / Cas9 предлагает новый инструмент для инактивации интегрированной скрытой ДНК ВИЧ-1 и может служить новым средством для лечения.

Мы протестировали 10 сайтов в ДНК ВИЧ-1, которые могут быть нацелены на CRISPR / Cas9. Разработанная система CRISPR / Cas9 была введена в клетки JLat10.6, которые латентно инфицированы ВИЧ-1. Результаты секвенирования показали, что каждый сайт-мишень в ДНК ВИЧ-1 эффективно мутировал CRISPR / Cas9 с целевым сайтом во втором экзоне Rev (T10), проявляющим наивысшую степень мутации. В результате экспрессия гена ВИЧ-1 и продуцирование вируса были значительно уменьшены при T10, что приводило к уменьшению в 20 раз.

Комплекс CRISPR / Cas9 эффективно мутирует и дезактивирует провирусную ДНК ВИЧ-1 в латентно инфицированных клетках Jurkat. Наши результаты также показали высокоэффективный целевой объект Cas9 во втором экзоне Rev, который представляет собой перспективную цель, которая будет дополнительно изучена в стратегии лечения CRISPR / Cas9.

Текущая антиретровирусная терапия (АРТ) позволяет контролировать ВИЧ-инфекцию как на индивидуальном уровне, так и в глобальном масштабе. В результате этого наблюдалось устойчивое снижение как числа новых ВИЧ-инфекций, так и показателей смертности от ВИЧ [1,2]. К сожалению, лечение ВИЧ-инфекции еще не достигнуто. Одним из блоков этой конечной цели является сохранение резервуаров для борьбы с ВИЧ, которые не могут быть очищены в соответствии с настоящим ИСК [3]. Создание вирусных резервуаров требует интеграции ДНК ВИЧ в клеточный геном [4]. Теоретически, удаление или деактивация провирусной ДНК должно устранить источник устойчивости к ВИЧ и, таким образом, может стать ценным инструментом для лечения.

В этом контексте были изучены два подхода. Один из них основан на нуклеазах цинкового пальца (ZFN), которые были разработаны для распознавания и расщепления определенных последовательностей ДНК ВИЧ [5]. Второй подход называется TALENS (транскрипционные активатор-подобные эффекторные нуклеазы), которые программируют факторы транскрипции для распознавания специфических последовательностей ДНК [6]. Оба подхода используют принцип распознавания белка-ДНК, который часто включает определенную степень двусмысленности. Недавней разработкой в ​​области редактирования генома является CRISPR (микробная кластеризация типа II с периодическим чередованием коротких палиндромных повторов) / Cas9, которая использует направляющую цепь РНК для распознавания и мутации ДНК-мишени; поэтому теперь предлагается новая стратегия инактивации ДНК ВИЧ [7-10].

Эта система CRISPR / Cas9 захватывает ДНК-эндонуклеазу под названием Cas9 с компонентом РНК, который использует 20-нуклеотидную направляющую последовательность (gRNA) для распознавания специфического участка ДНК [7,8]. Расщепление ДНК с помощью Cas9 генерирует двухцепочечные разрывы ДНК, которые при восстановлении не гомологичного концевого соединения (NHEJ) вызывают вставки или делеции на целевых участках ДНК. Этот подход был продемонстрирован с высокой степенью специфичности и эффективности при нацеливании на несколько клеточных генов и был дополнительно разработан для экранов генома для изучения функции генов [11-14]. В этом исследовании мы проверили эффективность системы CRISPR / Cas9 при инактивации интегрированной ДНК ВИЧ-1 в линии клеток Jurkat HIV-GFP под названием JLat10.6, которая была разработана для изучения латентности ВИЧ [15].

Эта клеточная линия ВИЧ-латентной линии JLat10.6 содержит полноразмерную вирусную ДНК, транскрипцию которой молчат в отсутствие внешней стимуляции. Лечение цитокинами, такими как TNF-α, активирует экспрессию вирусного гена, которое можно измерить, контролируя экспрессию GFP, который был вставлен в ДНК ВИЧ-1 в качестве репортерного гена. В целях нацеливания на ДНК ВИЧ-1 мы исследовали геном ВИЧ-1 и идентифицировали более 80 сайтов PAM (protospacer near motif), которые потенциально позволяют CRISPR / Cas9-комплексу распознавать ДНК ВИЧ-1. После рассмотрения сохранения этих целевых ДНК-последовательностей по разным штаммам ВИЧ-1, а также исключения возможностей нецелевого применения путем взрыва генома человека, 10 гРНК (с T1-T10) были отобраны и вставлены в вектор клонирования gRNA [8] , Из этих 10 целевых сайтов 3 находятся в пределах LTR, 5 в гене pol и 2 во втором экзоне tat / rev (рис. 1). Затем мы нуклеотизировали эти конструкции gRNA вместе с плазмидной ДНК hCas9 (экспрессирующей гуманизированный фермент Cas9) [8] в клетки JLat10.6. Анализ SURVEYOR был впервые выполнен для измерения частоты NHEJ в результате целенаправленного расщепления ДНК-1 ДНК. NHEJ был продемонстрирован для всех 10 гРНК. Частота колебалась от 10% до 30% (рис. 2А). Целевые области вирусной ДНК также амплифицировали с помощью ПЦР и дополнительно исследовали путем секвенирования. Наблюдались как вставки, так и делеции различных длин нуклеотидов, причем gRNA T10 вызывал большинство типов делеций и вставок (рис. 2B). Эти данные иллюстрируют эффективность 10 гРНК при нацеливании Cas9 на расщепление и мутацию ДНК ВИЧ-1 в разных регионах. Фиг. 1
Иллюстрация десяти тестируемых РНК ВИЧ-1, проверенных в этом исследовании. (A) Расположение 10 направляющих РНК (T1-T10) в геноме ВИЧ-1. (B) Схематическое изображение связывания направляющей последовательности T1 gRNA (20 нуклеотидов, подчеркнуто) с ДНК ВИЧ-1 в контексте Cas9 (желтым). PAM (соседний мотив protospacer) выделяется зелеными буквами. Красная стрелка указывает сайт расщепления на Cas9. (C) Последовательности 10 целевых сайтов в штамме ВИЧ-1 генома HXB2 (от T1 до T10). Представлена ​​информация о сохранении каждой целевой последовательности в базе данных по ВИЧ. Оценка CRISPR каждой гРНК была рассчитана с использованием программы на http://www.genome-engineering.org.

Анализ мутаций в ДНК ВИЧ-1, вызванный обработкой CRISPR / Cas9. (A) Результаты анализа SURVEYOR для измерения NHEJ-событий, возникающих в результате лечения РНК-1. Показаны данные двух или трех независимых экспериментов по трансфекции. Процент мутированной ДНК (обозначенный стрелками) представлен в нижней части каждой полосы. (B) Мутации на каждом целевом сайте gRNA. Мутированные последовательности (удаления, вставки и замены) показаны красными буквами. PAM выделяются зелеными буквами. ДНК ВИЧ-1 дикого типа подчеркнута и показана в верхней части каждой выровненной панели последовательностей.

Чтобы измерить влияние мутаций ДНК, индуцированных gRNA / Cas9, на функцию интегрированной ДНК ВИЧ-1, мы сначала трансфицировали клетки JLat10.6 ДНК gRNA / Cas9 с последующей обработкой TNF-α (10 нг / мл) до индуцируют экспрессию вирусного гена, которая контролируется путем подсчета GFP-положительных клеток посредством проточной цитометрии. Результаты показали, что gRNA, нацеленная на ДНК GFP (названная T GFP), уменьшала экспрессию GFP в 5 раз (рисунок 3A). Никакого эффекта не наблюдалось для гРНК, которая нацелена на ДНК люциферазы рениллы (T RL). ГРНК, нацеленные на ДНК ВИЧ-1, уменьшали количество GFP-положительных клеток в разной степени, от 3-кратного (gRNA T3) до 20-кратного (gRNA T10) (рис. 3A). Только эти gRNAs, без помощи Cas9, не оказывали влияния на экспрессию GFP (рисунок 3B). Когда уровни ВИЧ-1 в культуральных супернатантах измеряли с помощью ELISA p24, gRNA T3 приводила к 3-кратному уменьшению по сравнению с 20-кратным уменьшением, связанным с gRNAs T4, T8 и T10 (фиг.3C). Только gRNAs, в отсутствие Cas9, не влияли на продукцию ВИЧ-1 (рисунок 3D), что еще раз подтверждает, что молекулы gRNA действуют на ДНК ВИЧ-1 путем постановки на охрану фермента Cas9. Вместе эти данные демонстрируют высокую эффективность системы CRISPR / Cas9 в нацеливании и инактивации провирусной ДНК ВИЧ-1. Рисунок 3
Подавление экспрессии гена ВИЧ-1 и продуцирование вируса гРНК / Cas9. (A, B) Влияние gRNA / Cas9 на экспрессию GFP. Клетки JLat10.6 трансфицировали плазмидной ДНК gRNA и hCas9 с использованием Neon (Life Technologies). TNF-α (10 нг / мл) добавляли через 16 часов после стимуляции экспрессии гена ВИЧ-1 от промотора LTR ВИЧ-1, который контролировался проточной цитометрией. В качестве положительного контроля была включена гРНК, нацеленная на ДНК GFP (так называемый T GFP (GTGAACCGCATCGAGCTGAA)). ГРНК, нацеленная на ДНК люциферазы рениллы (называемую T RL (GTAGCGCGGTGTATTATACC)), использовалась в качестве отрицательного контроля. Результаты, полученные с пустым вектором gRNA, были произвольно заданы как 100%. Показанные результаты представляют собой среднее значение трех независимых экспериментов по трансфекции. Эксперименты проводились также с одной только gRNA (без Cas9), и результаты показаны в (B). (C, D) Эффекты gRNA / Cas9 на производство вирусов. Уровни вирусов в супернатантах определяли с помощью ELISA, который измеряет антиген ВИЧ-1 p24. Показаны результаты трех независимых трансфекций. (D) представляет результаты экспериментов, проведенных с одной только gRNA (без Cas9). (E, F) Предварительная обработка TNF-α не увеличивает ингибирование ВИЧ-1 с помощью gRNA / Cas9. Клетки JLat10.6 обрабатывали TNF-α (10 нг / мл) в течение 16 часов до нуклеотрансфекции ДНК-плазмидой gRNA и hCas9. GFP-положительные клетки оценивали по проточной цитометрии, и результаты показаны в (E). Уровни вирусов в супернатантах определяли с помощью ELISA HIV-1 p24 и результатов, показанных в (F). Результаты представляют собой среднее значение трех независимых трансфекций. (G, H) Подавление ВИЧ-1 несколькими гРНК, которые нацелены на разные сайты ДНК ВИЧ-1. Три разные гРНК были совместно трансфицированы плазмидной ДНК hCas9. Выражение гена ВИЧ-1 (показано в (G)) и продуцирование вируса (показано в (H)) после лечения TNF-α, как описано выше. Показанные результаты представляют собой среднее значение трех независимых экспериментов по трансфекции. Звездочки обозначают P <0,05 (тест Mann-Whitney U, SPSS 16.0).

В клетках JLat10.6 без какой-либо внешней стимуляции ДНК ВИЧ-1 не транслируется в результате недоступности клеточного транскрипционного механизма для промотора LTR ВИЧ-1 [15,16]. Мы подозреваем, что эта недоступность, вероятно, является результатом модифицированной структуры хроматина, может препятствовать способности комплекса CRISPR / Cas9 нацеливаться на ДНК ВИЧ-1. В этом случае предварительная обработка ингибиторами HDAC, такими как SAHA, может считаться необходимой для активации экспрессии гена ВИЧ-1, чтобы повысить эффективность системы CRISPR / Cas9. Поэтому мы обработали клетки JLat10.6 TNF-α в течение 16 часов до нуклеотрансфекции ДНК-плазмидой gRNA и hCas9. В отличие от наших ожиданий, активация транскрипции ВИЧ-1 TNF-α не приводила к тому, что ДНК ВИЧ-1 более восприимчивы к ингибированию машиной CRISPR / Cas9 (рис. 3Е и F). Это наблюдение позволяет предположить, что система CRISPR / Cas9 имеет возможность доступа к транскрипционной тихой ДНК ВИЧ-1 без необходимости активации экспрессии вирусного гена TNF-α или родственных агентов, таких как SAHA. Это свойство системы CRISPR / Cas9 поддерживает его возможную полезность в ликвидации интегрированной ДНК ВИЧ-1 из латентно инфицированных иммунных клеток, таких как CD4 + Т-клетки и макрофаги, в которых транскрипция ВИЧ-1 также является инертной. Учитывая, что эти ВИЧ-1 латентно инфицированные клетки часто являются нециклическими, необходимы дальнейшие исследования для оценки того, может ли клеточный цикл влиять на эффективность CRISPR / Cas9.

Затем мы проверили, улучшают ли комбинации разных гРНК усиление торможения. Ожидается, что эта стратегия сочетания также снизит шансы на ВИЧ-1 для выхода из целевого показателя gRNA. Действительно, некоторые комбинации, такие как T1 / T6 / T9, T2 / T4 / T10 и T3 / T6 / T9, уменьшили количество GFP-положительных клеток и урожайность вирусов более чем в 24 раза (рисунок 3G и H) , Отмечается, что все три комбинации содержат gRNAs, которые нацелены на tat / rev, что указывает, что последовательности tat и rev могут представлять уязвимые сайты для таргетинга CRISPR / Cas9.

Мы отметили, что нацеливание на поли-ДНК (T5-T8) также привело к значительному снижению экспрессии GFP, которое управляется LTR и вирусным Tat-белком (рис. 3). Одна из возможностей заключается в том, что расщепление Cas9 ДНК pol, управляемое T5, T6, T7 или T8, вызывает ответ на повреждение ДНК, который вызывает гистоновую модификацию (например, H3K9me3) и последующее блокирование транскрипции соседних генов [17]. Чтобы проверить это, мы обработали клетки JLat10.6 контрольной РНК или направляющей РНК Т5-Т8 HIV-1 вместе с Cas9, а затем ChIP (хроматиновый иммунопреципитационный) анализ модификации гистонов в регионах LTR и GFP ВИЧ-1. Были изучены два типа модификации гистонов: H3K9me3, который отмечает подавление транскрипции и H3K36me3, который отмечает активацию транскрипции [18]. Результаты на фиг. 4 показывают, что ДНК LTR ДНК или GFP обогащена более чем в 2 раза антителами против H3K9me3 в клетках, обработанных РНК, направленными на HIV-1, по сравнению с клетками, которые были обработаны либо пустым вектором, либо gRNA, нацеленная на люциферазу (T RL). Напротив, ни антитела против H3, ни антитела против H3K36me3 не обогащали ДНК LTR ВИЧ-1 или ДНК GFP в результате лечения РНК-1 (рис. 4). Интересно, что лечение GFP gFP (T GFP) привело к специфическому обогащению ДНК GFP, связанной с антителом против H3K9me3; напротив, ДНК LTR ВИЧ-1 не была значительно обогащена (рисунок 4). Эти данные свидетельствуют о том, что в дополнение к генерации мутаций в целевой ДНК механизм CRISPR / Cas9 также индуцирует модификацию гистонов H3K9me3 на целевом сайте, что способствует подавлению транскрипции.
Влияние обработки gRNA / Cas9 на модификацию гистона при LTR ВИЧ-1. Клетки JLat10.6 обрабатывали гРНК, которые нацеливали ген pol-HIV-1 (T5-T8). Затем клетки собирали и подвергали анализу ChIP с использованием контрольных IgG, антител против H3, анти-H3K9me3 или антител против H3K36me3. Уровни ДНК LTR ВИЧ-1 (показанные в (A)) или ДНК GFP (показанные в (B)) в иммунопреципитированных материалах определяли с помощью количественной ПЦР. Показанные результаты представляют собой среднее значение трех независимых экспериментов. Звездочки обозначают P <0,05 (тест Mann-Whitney U, SPSS 16.0).

В заключение, результаты этого исследования демонстрируют большую эффективность системы CRISPR / Cas9 для нацеливания и инактивации провирусной ДНК ВИЧ-1 в латентной клеточной линии JLat10.6. Поскольку JLat10.6 представляет собой линию клональных клеток, в которой ВИЧ-1 интегрирован в конкретный сайт в клеточной ДНК, результаты этого исследования не могут прийти к выводу, может ли система CRISRP / Cas9 нацеливаться на ДНК ВИЧ-1, которая интегрирована в различные клеточные ДНК-локусы с разной эффективностью. Поскольку комплекс CRISPR / Cas9 нацелен как на транскрипцию, так и на транскрипционную активную ДНК ВИЧ-1 с аналогичной эффективностью, CRISPR / Cas9 должен быть эффективен в ликвидации резервуаров ВИЧ-1, в которых ВИЧ-1 существует в скрытом состоянии. В подтверждение наших данных в недавних исследованиях сообщалось о подавлении векторов на основе ВИЧ с использованием системы CRISPR / Cas9 [19,20]. В обоих исследованиях тестировались гРНК, нацеленные на ЛТР ВИЧ-1. Мы здесь протестировали 10 целевых сайтов по геному ВИЧ-1 и идентифицировали один сайт во втором экзоне Rev (называемый T10), который демонстрирует самый высокий уровень мутации Cas9. В отдельном исследовании система CRISPR / Cas9 использовалась для успешной генерации делеции CCR5Δ32 в плюрипотентных стволовых клетках с эффективностью 33% по сравнению с 14% -ной эффективностью при использовании метода TALENS [21]. Все эти результаты подтверждают полезность системы CRISPR / Cas9 в качестве нового подхода к редактированию генома для искоренения ВИЧ-1. Вызовы также существуют для нацеливания на сильно изменяемый вирус, такой как ВИЧ-1, с использованием системы CRISPR / Cas9, эффективность которой во многом зависит от того, насколько хорошо гРНК соответствует целевой вирусной ДНК-последовательности. Одним из решений может быть персонализированный подход, в котором гРНК предназначена для соответствия последовательностям ВИЧ-1, которые заархивированы в резервуаре отдельного пациента. Эти усилия могут особенно окупиться, если такой подход может быть использован для лечения инфицированных людей. Вторая стратегия может включать использование нескольких гРНК для нацеливания нескольких относительно консервативных сайтов в геноме ВИЧ-1, чтобы максимизировать эффективность и минимизировать выброс вируса. С быстро развивающимся полем CRISPR / Cas9 появятся новые инструменты, помогающие искоренить ВИЧ в клинических условиях.

Конкурирующие интересы

Авторы заявляют, что у них нет конкурирующих интересов.

Вклад авторов

WZ и CL задумали исследование, WZ, RL, JL и YD провели эксперименты, WZ, FG и CL проанализировали данные, CL, WZ и MW написал рукопись. Все авторы прочитали и утвердили окончательную рукопись.

Мы благодарим Ли Ли и Янь Сяо за их техническую помощь, д-р Джордж М Черч за предоставление плазмид gRNA и hCas9. Это исследование было поддержано Национальным 12-летним 5-летним проектом 2012ZX10001009, базовым научным пособием 2012IPB301 от Института биологии патогенов, 2012C01 и грантом для выдающегося приглашенного профессора из Китайской академии медицинских наук и Медицинского колледжа Пекинского союза, Программы для ученых Changjiang и группы инновационных исследований в университете (IRT13007), Министерства науки и техники Китая (2012CB911103, 2012ZX10001006-003 и 2013ZX10001005-002), а также Канадских институтов исследований в области здравоохранения.

Комментариев нет.

Добавить комментарий

Ваш e-mail не будет опубликован. Обязательные поля помечены *