Нажмите "Enter", чтобы перейти к контенту

Использование системы CRISPR / Cas9 для срыва латентного вируса ВИЧ-1

Harnessing the CRISPR/Cas9 system to disrupt latent HIV-1 provirus
Источник: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3752613/

Несмотря на то, что высокоактивная антиретровирусная терапия способна контролировать репликацию ВИЧ-1, вирус может лежать в состоянии покоя в геноме хозяина, известном как скрытый резервуар, и создает угрозу для повторного появления в любое время. Однако новые технологии, направленные на разрушение провируса ВИЧ-1, могут быть способны уничтожить вирусные геномы у инфицированных людей. В этом исследовании мы продемонстрировали потенциал системы CRISPR / Cas9 для редактирования генома ВИЧ-1 и блокирования его экспрессии. Когда LTR-таргетинг на компоненты CRISPR / Cas9 трансфицировали в экспрессионные и невосприимчивые Т-клетки ВИЧ-1 LTR, после стимуляции наблюдалась значительная потеря LTR-выраженной экспрессии. Анализ последовательности подтвердил, что эта система CRISPR / Cas9 эффективно расщепляет и мутирует целевые сайты LTR. Что еще более важно, эта система также смогла удалить внутренние вирусные гены из хромосомы клетки-хозяина. Наши результаты показывают, что система CRISPR / Cas9 может быть полезным инструментом для лечения инфекции ВИЧ-1.

Интеграция обратной транскрибируемой вирусной ДНК в геном клетки-хозяина является важным этапом в течение жизненного цикла ВИЧ-1. Интегрированную ретровирусную ДНК называют провирусом, который служит основным источником продуцирования вирусных белков. Экспрессия гена ВИЧ-1 регулируется активностью LTR-промотора и энхансера, где клеточные транскрипционные факторы, такие как NF-κB, SP-1 и TBP, связываются для повышения активности РНК-полимеразы II. Впоследствии белок Tat экспрессируется из ранних двойных сплайсированных транскриптов и связывается с участком транс-активационного ответа (TAR) РНК ВИЧ-1 для его эффективного удлинения2.

Латентная инфекция возникает, когда провирус ВИЧ-1 становится транскрипционно неактивным, что приводит к скрытому резервуару, который стал основным препятствием для предотвращения вирусной эрадикации у ВИЧ-инфицированных людей. Однако механизмы вирусного молчания и реактивации остаются не полностью понятыми3. Предыдущие исследования показали, что положение сайта интеграции сильно влияет на экспрессию вирусных генов и может быть одним из определяющих факторов задержки ВИЧ-14. В то время как высокоактивная антиретровирусная терапия (HARRT) резко снизила смертность от инфекции ВИЧ-1, в настоящее время нет эффективной стратегии нацеливания на скрытую форму провирусов ВИЧ-15.

В течение последнего десятилетия были разработаны новые методы редактирования генома, которые используют искусственные нуклеазы, такие как нуклеазы цинкового пальца (ZFNs) 6 и транскрипционные активаторные эффекторные нуклеазы (TALENs) 7. Эти молекулярно-инженерные нуклеазы распознают и расщепляют специфические нуклеотидные последовательности в геномах-мишенях для пищеварения, приводя к различным мутациям, таким как замены, делеции и вставки, индуцированные машиной для восстановления ДНК хозяина. Эти технологии позволили производить животных, управляемых геномом, у широкого круга видов, таких как Drosophila8, Zebrafish9 и Rat10. Однако ZFN или TALEN остаются несколько сложными и трудоемкими для разработки, разработки и эмпирического тестирования в сотовом контексте11. Недавно был разработан третий метод редактирования генома, основанный на кластеризованных регулярно расположенных промежуточных системах палиндромного повторения (CRISPR). Системы CRISPR были первоначально идентифицированы в бактериях и археях12 как часть адаптивной иммунной системы, зависящей от комплекса, состоящего из РНК CRISPR (crRNAs) и CRISPR-ассоциированных (Cas) белков, для деградации комплементарных последовательностей инвазивной вирусной и плазмидной ДНК. Mali et al. создал новую версию инструмента для редактирования генома, применимого к клеткам млекопитающих, называемую системой CRISPR / Cas9, которая основана на модификациях системы CRISPR типа Streptococcus pyogenes II типа в кРНК, слитой с транскондинированной tracrRNA13. Эта система CRISPR / Cas9 состоит из гистовой РНК (gRNA) и нуклеазы Cas9, оптимизированной кодоном человека, которая образует РНК-белковый комплекс для переваривания уникальных целевых последовательностей, сопоставимых с гРНК. Система CRISPR / Cas9 может быть использована путем простой трансфекции разработанной гРНК и гуманизированной плазмиды экспрессии g99 (hCas9) в клетки-мишени млекопитающих, что делает ее перспективным инструментом для различных применений.

В этом исследовании мы проверили способность системы CRISPR / Cas9 подавлять экспрессию ВИЧ-1 путем редактирования интегрированной провирусной ДНК ВИЧ-1. Cas9 и gRNA, предназначенные для нацеливания на ЛТР ВИЧ-1, трансфицировали и значительно ингибировали экспрессию LTR под контролем Tat. Эта система CRISPR / Cas9, ориентированная на LTR, также может вырезать провирусы из клеточного генома.

Мы разработали вектор экспрессии gRNA для нацеливания на LTR ВИЧ-1 под контролем промотора U6 полимеразы III человека. U6 транскрипция gRNA инициируется с гуанином и требует ориентированного на протоспакер-мотив (PAM) -NGG, за которым следует целевая последовательность пары 20-пар (bp). Соответственно, две плазмиды, экспрессирующие gRNA, были получены для мишеней 5 и 6 (T5 и T6), расположенных в последовательности TAR R-области и последовательности связывания NF-κB в области U3 соответственно (фиг.1А), как описано в методах. Чтобы проверить активность редактирования генома в системе CRISPR / Cas9, мы использовали антитела к ВИЧ-1, индуцированные провирус-клетками, продуцируемые вектором ВИЧ LTIG, который экспрессирует белки Tat и GFP под контролем промотора LTR, таким образом имитируя аутентичный ВИЧ-1 экспрессия гена4. Для оценки влияния системы CRISPR / Cas9 на ВИЧ-1 LTR клетки 293 T и HeLa были инфицированы LTIG-вектором, псевдотипированным белком-оболочкой VSV-G. Затем клетки, инфицированные вектором LTIG, были совместно трансфектированы плазмидой с экспрессией g5НК T5 или T6 вместе с экспрессионной плазмидой hCas9. Через пять дней после трансфекции (TF) среднюю интенсивность флуоресценции (MFI) экспрессии GFP и процент положительных клеток GFP анализировали с помощью проточной цитометрии. В 293 Т-клетках четкое снижение MFI и GFP-положительных клеток наблюдалось компонентами CRISPR / Cas9 (фиг.1B и C). T5, TAR-нацеливающая гРНК, была более эффективной, чем T6, и уменьшала средний процент положительных клеток GFP с 45,6% до 20,0% (p = 0,0003) (фиг.1С). Только небольшое снижение положительных клеток GFP наблюдалось в клетках HeLa, в то время как снижение MFI было более резким, чем в 293 Т-клетках (фиг.1C), вероятно, из-за более низкой эффективности TF компонентов CRISPR и более низкого уровня экспрессии GFP в клетках HeLa, чем в 293 Т-клетках. Эти результаты показали, что ВИЧ-1 LTR, нацеленная на систему CRISPR / Cas9, блокирует экспрессию гена ВИЧ-1 из провируса LTR. Поскольку наиболее эффективное ингибирование было получено Т5 как в клетках 293 Т, так и в HeLa, T5 использовали для дальнейших экспериментов.

Чтобы повысить активность ингибирования системы CRISPR / Cas9, мы разработали протокол для трансфекции компонентов CRISPR несколько раз. 293 Т-клеток многократно трансформировали с помощью плазмид T5 gRNA или gRNA и hCas9, а анализ проточной цитометрии проводили через пять дней после TF. Как и ожидалось, процент положительных клеток GFP был дополнительно уменьшен после нескольких раундов TF (фиг.1D). Тройной ТФ привел к значительному уменьшению среднего процента положительных клеток GFP с 40,8% до 2,1% (р = 0,0001). Затем из этих клеток выделяли фрагменты LTR с использованием набора праймеров, как показано на фиг.1А, и клонировали в плазмиду. Последовательный анализ области TAR клонов плазмидной ДНК показал, что 18 из 22 ДНК-клонов ВИЧ содержали различные мутации, от 1 до 31 п.н. делеции с конца предполагаемого сайта расщепления (фиг.2А). У двух клонов была комбинация мутаций делеции и вставки (фиг.2В). Эти образцы мутаций часто наблюдаются в результате репарации ДНК в пути, не гомологичном конце соединения (NHEJ), и являются типичными после редактирования генома14, что настоятельно указывает на то, что этот компонент T5 CRISPR / Cas9 генерирует двухцепочечную ДНК (ds) целевой сайт ВИЧ-1 ТАР и были отремонтированы по пути NHEJ. Эти результаты ясно показали, что система T5 CRISPR / Cas9 эффективно продуцирует мутации в области TAR провирусной ДНК.

Поскольку предположительно латентно инфицированные клетки являются CD4 + Т-клетками, мы затем проверили потенциал редактирования генома системы CRISPR / Cas9 в этих клетках. Чтобы проверить это, мы сгенерировали две клеточные линии клона Jurkat, c5 и c19, которые имитируют латентность ВИЧ. Эти клеточные клоны выделяли путем лимитирующего разбавления из популяций клеток, которые только экспрессировали GFP после индукции либо TNF-α, либо комбинацией 5-Aza-dC / TSA. Оба c5 и c19 ко-трансфицировали с помощью пустого вектора T5 или gRNA и экспрессирующей плазмиды hCas9. Через четыре дня клетки обрабатывали TNF-α или комбинацией 5-Aza-dC / TSA. Средний процент положительных клеток GFP после индукции TNF-α составлял 92,56% и 98,48% после TF с пустым вектором gRNA в c5 и c19 клетках соответственно. Напротив, средний процент положительных клеток GFP составлял 68,78% в c5 и 66,95% в клетках c19, трансфицированных T5 гРНК (фиг.3A и B). Аналогичное снижение экспрессии GFP наблюдалось в клетках c5 и c19, трансфецированных системой T5 CRISPR / Cas9 после 5-Aza-dC / TSA-обработки (фиг.3A и B). Эти данные свидетельствуют о том, что система T5 CRISPR / Cas9 продуцировала популяции клеток, которые были устойчивы к стимуляции TNF- и 5-Аза-dC / TSA.

Чтобы повысить эффективность системы T5 CRISPR / Cas9, мы выполнили несколько TF плазмид экспрессии T5 и hCas9. Этот подход значительно уменьшил повторную активацию скрытого провируса. Как показано на фиг.3C для c19, процент повторно активированных латентно инфицированных клеток был снижен с 97,8% до 35,5% после трех раундов TF (фиг.3C, p = 0,00002). Эти результаты наглядно продемонстрировали, что система T5 CRISPR / Cas9 способна предотвратить повторную активацию латентно интегрированного провируса в Т-клетках.

Ретровирусная провирусная ДНК содержит дублирующие области LTR на обоих концах интегрированного вирусного генома, что означает, что система CRISPR / Cas9 может одновременно расщеплять оба LTR и удалять внутреннюю область интегрированной провирусной ДНК из генома клетки-хозяина. Чтобы исследовать эту возможность, мы использовали клетки, трансдуцированные с помощью альтернативного вектора ВИЧ-1, отсутствовали в области U3 LTR и имели кассету промотора внутреннего удлинения-1 (EF) для экспрессии GFP (фиг.4A). Поскольку выражение GFP управляется независимым EF-промоутером, на него не должно влиять система редактирования генома, нацеленная на область LTR интегрированной провирусной ДНК. Таким образом, популяции негативных клеток GFP могут быть результатом провирусного иссечения. Более того, поскольку этот ВИЧ-вектор не обладает сайтом связывания NF-κB в области U3, эти клетки должны быть устойчивыми к Т6, а не Т5-опосредованному таргетированию. Как и ожидалось, только компоненты T5 CRISPR / Cas9 явно уменьшали популяции клеток, экспрессирующие GFP (фиг.4 A, p = 0,0014). Двойной TF этих компонентов приводил к дальнейшему снижению среднего значения положительных клеток GFP с 60,44% до 50,45% (p = 0,0010).

Затем мы провели количественный анализ ПЦР (qPCR) с использованием клеток c19 Jurkat, которые содержали скрытую интегрированную провирусную ДНК ВИЧ-1, вектор LTIG. Как показано на фиг.3, система T5 CRISPR / Cas9 значительно уменьшала экспрессию GFP, управляемую LTR. Мы рассуждали, что если ингибирование является чисто результатом мутаций LTR, тогда число копий ДНК EGFP в геноме клетки-хозяина должно оставаться неизменным после лечения T5 CRISPR / Cas9. Альтернативно, если снижение экспрессии GFP частично связано с удалением интегрированной вирусной ДНК, количество ДНК EGFP будет уменьшено после лечения T5 CRISPR / Cas9. Для этого анализа использовали c19 клетки, показанные на фиг.3C. Результат анализа qPCR ясно показал, что относительное количество ДНК EGFP было уменьшено с помощью процедуры T5, но не с использованием gRNA-очистки CRISPR / Cas9 (фиг.4B). В среднем 31,8% провируса вырезали из гена клетки-хозяина после того, как компоненты CRISPR / Cas9 были трансфицированы три раза. Чтобы получить прямое доказательство эффекта провирус-эксцизии CRISPR, был проведен ПЦР-анализ с использованием генов-специфических праймеров клеток-хозяев, фланкирующих сайт провирусной интеграции. После определения сайтов интеграции c19, хромосомы 16 в скрытых LTIG-трансдуцированных клетках Jurkat (снимок 4D), мы разработали набор праймеров, специфичный для обеих последовательностей, смежных с сайтом интеграции c19-провируса. Предполагается, что удаление провируса оставляет след одного LTR, и проведенная нами ПЦР способна обнаруживать видимый след в виде дополнительного фрагмента размером 1,067 п.о. только в клетках, трансфицированных T5 CRISPR / Cas9 (фиг.4C). Кроме того, анализ последовательности этого продукта ПЦР подтвердил, что удаление провируса привело к одному участку LTR с различными мутациями из сайта расщепления (фиг.4D). Эти результаты наглядно демонстрируют, что система CRISPR / Cas9, нацеленная на ВИЧ-1 LTR, имеет потенциал для поглощения скрытой формы провирусной ДНК ВИЧ-1 из хромосомы клетки-хозяина.

В этом исследовании мы успешно нарушили экспрессию вируса ВИЧ-1, использующего систему CRISPR / Cas9 (рис.1). Важно отметить, что это нарушение не только ограничивало транскрипционно активный провирус, но и блокировало выражение скрытого интегрированного провируса (рис.3). Предполагается, что белки Cas9 содержат мотивы RuvC и HNH15, которые обладают автономной активностью расщепления ssDNA. Интересно, что мутанты, лишенные одного из мотивов, становятся никейными эндонуклеазами16. Допустимо, что независимая активность никей в каждом домене может повысить эффективный доступ к гетерохроматинному состоянию латентно интегрированного провируса. Другая возможность заключается в том, что Cas9 имеет высокоэффективную систему контроля цели, аналогичную ранее описанной для системы Cas317.

T6 gRNA, которая была нацелена на сайт связывания NF-κB, также сильно подавляла активность промотора LTR (фиг.1). Однако эффект был слабее, чем эффект Т5 гРНК. В этом исследовании мы использовали вектор LTIG, модифицированный из LTR штамма ВИЧ-1 NL4-3, который обладает двумя соседними узлами связывания NF-κB18. Целевой сайт T6 находится в конце 5′-сайта связывания NF-κB, что означает, что мутации могут не полностью трансформировать транскрипцию, так как сайт связывания 3’NF-κB может оставаться функциональным. С другой стороны, T5 гРНК, которая нацелена на ТАР, является глубоко эффективной в нарушении генной экспрессии ВИЧ-1. Предполагаемый сайт расщепления был помещен в шейку области штоковой петли TAR, что имеет решающее значение для формирования тройного комплекса Cyclin T1-Tat-TAR19. Таким образом, последовательность ТАР может быть одной из лучших целей для блокирования экспрессии вируса ВИЧ-1. Целевая специфичность системы CRISPR / Cas очень высока, и одна мутация может нарушить таргетинг20, а это означает, что некоторые провирусы могут уйти от этого механизма редактирования генома, если мутации возникают в целевых последовательностях. Однако, учитывая, что область TAR относительно консервативна, и существует мало различий среди подтипов ВИЧ-121, она все же может быть подходящей целью для устранения латентно зараженного провируса.

Возможно, самым важным находком в этом исследовании является то, что мы могли бы вырезать провирус из генома хозяина ВИЧ-1-инфицированных клеток, что может стать лучом надежды на ликвидацию ВИЧ-1 у инфицированных людей. Тем не менее, существует множество препятствий, которые необходимо устранить, прежде чем использовать редактирование генома для лечения элиминации ВИЧ-1, таких как генная терапия. Во-первых, эффективность редактирования генома и / или провирусного иссечения должна определяться количественно в первичных клетках, инфицированных ВИЧ, включая латентно инфицированные CD4 + покоящиеся Т-клетки. Во-вторых, должна быть разработана эффективная система доставки. К счастью, система CRISPR / Cas9 имеет преимущество по сравнению с TALENs22. Таким образом, система CRISPR может быть поставлена ​​лентивирующими векторами, тогда как TALENs не связаны с их большими размерами и повторяющимися последовательностями23. Последнее препятствие касается возможных внецелевых эффектов, которые уместны для всех стратегий редактирования генома, которые могут привести к неспецифическим событиям модификации генов. Если у Cas9 есть побочные эффекты, то удаление внецелевой активности может быть лучшим подходом перед использованием системы CRISPR / Cas для лечения ВИЧ-инфекции.

gRNA-экспрессионные плазмиды были сконструированы в соответствии с протоколом производителя. Вкратце, чтобы получить фрагмент вставки dsDNA 100 б.п., содержащий последовательность мишени (20 б.п.) и последовательность PAM, использовали набор олигонуклеотидов и фрагмент был получен с использованием флюоресмидной полимеразы (NEB). Фрагмент dsDNA очищали и вставляли в сайт AflII вектора gRNA-клонирования (адгеген) с системой сборки Гибсона (NEB). Два набора олигонуклеотидов, предназначенных для 5 и 6, перечислены следующим образом: HE388 (TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGttagaccagatctgagcct) и HE389 (GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACaggctcagatctggtctaaC); и HE384 (TTTCTTGGCTTATATATCTTGTGGAAAGGACGAAACACCGctacaagggactttccgct) и HE385 (GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACagcggaaagtcccttgtagC) соответственно. Строчные буквы указывают на целевую последовательность. Эти олигонуклеотидные комплексы длиной 60 нт отожжены друг с другом в 20 нт комплементарной последовательности на 3′-концах.

Вирусы были получены, как описано ранее24. Вкратце, трансформировали 293 Т-клетки и супернатанты культуры фильтровали через 48 часов после TF. Чтобы подготовить VSV-G псевдотипированный вектор LTIG, pEV731, любезно предоставленный доктором Эриком Вердином25, pMD. G, pMDLg / pRRE и pRSV Rev (хелперные плазмиды) были совместно трансфицированы. Для получения VSV-G псевдотипированного вектора EG-PRE вектор pCS-CDF-EG-PRE и те же вспомогательные плазмиды были совместно трансфицированы, как описано ранее26.

293 Т и HeLa поддерживали в модифицированной среде Дульбекко Игл (DMEM), содержащей 10% фетальной телячьей сыворотки (FCS), 100 ед / мл пенициллина и 100 г / мл стрептомицина. Ячейки Jurkat поддерживали в среде RPMI 1640, содержащей 10% FCS, 100 ед. / Мл пенициллина и 100 г / мл стрептомицина.

293 Т-клетки трансфицировали методом фосфата кальция24. Клетки HeLa трансфицировали Lipofectamine2000 (invitrogen) в соответствии с протоколом производителя. Клетки клона Jurkat трансфицировали системой трансфекции NEON (жизненная технология). Для TF системы CRISPR / Cas9 использовали 1 мкг экспрессирующего вектора hCas9 и 1 мкг экспрессирующего вектора gRNA. Уровень экспрессии GFP анализировали через 5 дней после ТФ. Клетки суспендировали в забуференном фосфатом физиологическом растворе (PBS), содержащем 1% формамида. Потоковая цитометрия проводилась с помощью FACScCalibur (BD Biosciences), и данные анализировались с использованием программного обеспечения CellQuest (BD Biosciences).

Ячейки Jurkat инфицировали LTIG-псевдотипированным вектором при MOI 0,5 и культивировали для одного слабого. После обработки 10 нг / мл TNF-α в течение 24 часов положительные клетки GFP сортировали с помощью FACSAria (BD) и культивировали в течение еще одного месяца для ослабления экспрессии GFP. Затем отрицательные клетки GFP сортировали четыре раза, и клетки клонировали путем предельного разведения. После расширения клетки клона обрабатывали 10 нг / мл TNF-α (R & D-системы) или комбинацией 1 мкг / мл 5-Аза-dC (SIGMA-ALDRICH) и 1 мкМ TSA (SIGMA-ALDRICH) и скринировали для возможности реактивации после стимуляции, проточной цитометрией.

Геномную ДНК, извлеченную из клонов клеток Jurkat, расщепляли комбинацией BamHI и BclI, или NcoI и BspHI, и повторно лигировали с помощью лиганды T4. Продукты лигирования выделяли EtOH и использовали в качестве матрицы для обратной ПЦР. Для этой ПЦР использовали LA taq (TAKARA) в соответствии с протоколом производителя. Праймерными наборами, используемыми для обратной ПЦР, были HE410 (CTCCTCGCCCTTGCTCACCA) и M667 (GGCTAACTAGGGAACCCACTGC). Продукты ПЦР клонировали в вектор pGEM-T (Promega) и секвенировали с использованием праймеров M13. Набор праймеров HE433 (AGCACATCACACTCCTCTG) и HE435 (AGACATGAGCCACTATGTCT) использовали для ПЦР-амплификации интегрированного провируса в c19.

Количество ДНК EGFP количественно определяли в ПЦР в реальном времени, как описано выше2728.

Все данные были выражены как среднее ± стандартное отклонение (S.D.). Тестовый тест учащегося использовался для обозначения различий между группами. Значения P показаны на каждом рисунке.

ОН. и Ю.Коянаги написал основной текст рукописи. ОН. и N.M., приготовленные на фигурах 1, 2, 3, 4B, C и D. Y. Kanemura подготовили рисунок 4A. Все авторы рассмотрели рукопись.

Эта работа была частично поддержана грантами из следующих источников: «Грант-в-помощи для молодых ученых» (B24790438) и «Грант-в-помощи для оказания помощи в научных исследованиях» (B24390112) от Японского общества содействия науке , Научные исследования по инновационным областям (24115008) от Министерства образования, культуры, спорта, науки и техники и Исследования по ВИЧ / СПИДу от Министерства здравоохранения, труда и благосостояния Японии.

(A) Схема провируса, полученного из вектора LTIG и LTR. Два целевых сайта CRISPR / Cas9 были указаны в нижней части LTR. (B и C) GFP после лечения CRISPR / Cas9. 293 T и HeLa были инфицированы LTIG-вектором, псевдотипированным белком VSV-G. Через неделю после заражения клетки ко-трансфицировали вектором экспрессии gRNA и вектором экспрессии hCas9. Уровень экспрессии GFP анализировали с помощью проточной цитометрии через 5 дней после ТФ. (B) показаны типичные гистограммы. (C) показаны положительные проценты GFP (верхний, n = 3) и МФО (снизу, n = 3). (D) Процент GFP положительных 293 Т-клеток после множественного TF с системой CRISPR / Cas9. Блок-схема эксперимента изображена с левой стороны. Процент положительных клеток GFP в результате одиночного, двойного и тройного TF показан с правой стороны. Шкалы ошибок на C и D показывают стандартные отклонения (n = 3).

Показана последовательность ДНК области TAR LTR. Двадцать две последовательности были получены из LTIG-инфицированных 293 Т-клеток, которые три раза трансфицировали Т5 гРНК. Последовательность ссылок WT показана сверху. Целевая последовательность T5 указана оранжевым цветом. Предполагаемый сайт расщепления обозначен стрелкой. (A) последовательность TAR с удалениями. Восемнадцать из 22 клонов были делеционными мутантами. (B) TAR с обеими удалениями и вставками. Два из 22 клонов были мутантами, состоящими из введения и удаления. Красные и синие цвета указывают на вставку и непредвиденную мутацию соответственно.

Использовали клеточные линии Jurkat, латентно-трансдуцированные вектором LTIG. Эти клеточные линии совместно трансфицировали вектором экспрессии gRNA и вектором экспрессии hCas9. Клетки обрабатывали TNF-α или комбинацией 5-Aza-dC и TSA через 4 дня после TF. (A и B). Уровень экспрессии GFP после 48 часов стимуляции TNF-α и 24 часа стимуляции 5-Аза-dC и TSA. Репрезентативные гистограммы показаны в A. Положительный процент GFP показан в B (n = 3). (C) Множественный TF T5 или gRNA пустой вектор и hCas9 экспрессионная плазмида. Сплошные линии с квадратами и кружками указывают c19 и c5, совместно трансфицированные gRNA пустым и hCas9 экспрессионным вектором, соответственно. Пунктирные линии с x и треугольниками указывают c19 и c5, совместно трансфицированные с помощью вектора экспрессии T5 и hCas9, соответственно. Шкалы ошибок в B и C показывают стандартные отклонения (n = 3).

(A) Иссечение лентивирусного вектора с помощью системы CRISPR / Cas9. 293 Т-клеток, трансдуцированных лентивирусным вектором, содержащим EF-промотор, экспрессирующий EGFP, обрабатывали системой CRISPR / Cas9. На рисунке показана схема вектора лентивируса, используемого в этом анализе. Процент положительных клеток GFP после одиночного или двойного TF компонентов CRISPR / Cas9 показан на дне (n = 3). (B) Исключение прошивки LTIG с системой CRISPR / Cas9. Геномную ДНК экстрагировали из образцов, полученных на фиг.3C, и выполняли qPCR (n = 3). Показано относительное количество ДНК EGFP. (C) ПЦР-амплификацию провирусного вируса ВИЧ-1. Набор праймеров был разработан для последовательности генома клетки-хозяина, фланкирующей сайт провирусной интеграции в c19. Правая сторона показана схема продуктов ПЦР с указанием геномных последовательностей, пронуклеума полной длины и одного отпечатка LTR, полученного в результате провирусного иссечения. (D) Последовательность ДНК одного следа LTR была получена из провирусного иссечения. TAR-последовательность WT LTR показана сверху, выделенной жирным шрифтом. Целевая последовательность гена T5 указана оранжевым цветом. Предполагаемый сайт расщепления обозначен стрелкой. Последовательности LTR из пяти клонов показаны посередине. Удаления обозначаются тире. Вставка показана красным цветом. Прямой повтор 5-bp в ДНК хозяина, фланкирующий конец LTR, показан зеленым цветом. Последовательность генома клетки-хозяина указана на дне.

Комментариев нет.

Добавить комментарий

Ваш e-mail не будет опубликован. Обязательные поля помечены *